Subscribe Now Subscribe Today
Research Article
 

Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis



Francis E. Nwilene, Amos Onasanya, Tolulope A. Agunbiade, Mark N. Ukwungwu, Yacouba Sere, Ivan Ingelbrecht, Abou Togola, Dona Dakouo, Ba Malick, Souleymane Nacro, Abdoulaye Hamadoun, Noe Woin and James Charles
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

Identification and differentiation of Orseolia species in Nigeria was carried out using SCAR-PCR analysis. Twenty-three insects from 9 localities in Nigeria and three reference insects (Orseolia bonzii, Orseolia nwanzei and Orseolia oryzivora) were analyzed. Out of the 60 SCAR primers screened, only four produced clear amplified DNA fragments at annealing temperature of 55°C that differentiated all the 26 Orseolia species. Cluster analysis revealed two major insect genotypes (OSG-1 and OSG-2). The OSG-1 was further divided into two subgroups (OSG-1a and OSG-1b). Eleven insects were genotyped as OSG-1a, 14 as OSG-1b and one as OSG-2. Only NG1 and NG2 were identical among the insects of OSG-1a genotype. OSG-1b genotype produced two different groups of identical insects. While O. bonzii and O. oryzivora were genotyped as OSG-1b along with other twelve insects, only O. nwanzei was genotyped as OSG-2. OSG-1b genotype constitutes about 54% O. bonzii and O. oryzivora in Nigeria, OSG-2 genotype represents 4% of O. nwanzei in Nigeria while OSG-1a genotype covers 42% of yet unknown Orseolia species in Nigeria. This information would strongly assist breeding programmes aiming at effective development of cultivars with durable resistance to African rice gall midge (AfRGM) in Nigeria.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Francis E. Nwilene, Amos Onasanya, Tolulope A. Agunbiade, Mark N. Ukwungwu, Yacouba Sere, Ivan Ingelbrecht, Abou Togola, Dona Dakouo, Ba Malick, Souleymane Nacro, Abdoulaye Hamadoun, Noe Woin and James Charles, 2010. Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis. Trends in Applied Sciences Research, 5: 188-196.

DOI: 10.3923/tasr.2010.188.196

URL: https://scialert.net/abstract/?doi=tasr.2010.188.196
 

INTRODUCTION

The African Rice Gall Midge (AfRGM), Orseolia oryzivora Harris and Gagné (Diptera: Cecidomyiidae), is a serious insect pest of rainfed and irrigated lowland rice and is found only in Africa. It is an increasingly important insect pest of lowland rice in Nigeria (Ukwungwu et al., 1989). The pest was initially thought to be the same species as the Asian gall midge, Orseolia oryzae (Wood-Mason) but later separated from Asian rice gall midge based on the morphological characters of larvae, pupae and adults from the identical (Pathak and Dhaliwal, 1981; Waterhouse, 1993).

Orseolia oryzivora has been reported in thirteen West African countries including Burkina Faso, Mali, Nigeria, Sierra Leone and Cameroun (Ukwungwu et al., 1989; Ukwungwu and Joshi, 1992; Harris et al., 1999; Nwilene et al., 2002). The first major outbreak in Nigeria occurred in 1988 and affected about 50, 000 ha of rice. In the worst hit area in Abakaliki, Ebonyi State, about 45 to 80% tillers were infested on the worst affected fields. In the following year, similar damage was reported further South in the forest zone (Ukwungwu and Joshi, 1992). The insect has assumed a greater importance in recent years, especially after the introduction of high yielding varieties, changes in crop management practices and intensification of the production systems.

Field sampling has shown that AfRGM can increase very rapidly on many of the improved high-yielding rice varieties currently grown by farmers, thereby allowing for serious outbreaks to develop quickly. Thus, developing new rice varieties with higher levels of resistance to AfRGM is very important for improved management of the pest. However, this resistance can break down as a result of genetic change in the pest population (Katiyar et al., 2000; Lingaraj et al., 2008). Recent studies by the WARDA Integrated Pest Management Task Force have showed that the resistance of rice varieties to AfRGM differs markedly from one location to another. This is probably due to genetic differences between the AfRGM populations at different locations.

An understanding of this genetic variation amongst the population of the O. oryzivora is necessary for breeding programmes aimed at effective development of cultivars with durable resistance to AfRGM in Nigeria. Polymerase Chain Reaction (PCR) based genetic markers are widely used for molecular detection, genome mapping, map-based cloning and analysis of genetic variation in insects. These marker systems include random amplified polymorphic DNA (RAPD) (Williams et al., 1990), Simple Sequence Repeats (SSR) (Tautz, 1989; Brown and Tanskley, 1996), Inter Simple Sequence Repeats (ISSR) polymerase chain reaction (Zeitkeinicz et al., 1994) and Amplified Fragment Length Polymorphisms (AFLP) (Vos et al., 1995). Sequence Characterized Amplified Regions (SCARs) are based on sequencing the polymorphic fragment derived from RAPD primers and designing longer primers that will specifically bind to this fragment (Nwilene et al., 2006). The present study aimed at using SCAR-PCR technique for the identification and differentiation of Orseolia species from Nigeria. The information from the study would strongly assist rice breeding programmes aiming at effective development of cultivars with durable resistance to African Rice Gall Midge (AfRGM) in Nigeria.

MATERIALS AND METHODS

Insect Collection and Storage
Twenty-three insects (Table 1), consisting of 2 larvae and 21 pupae were collected at random from 9 localities in lowland and irrigated ecologies in Nigeria. These larvae and pupae were preserved in absolute ethanol at -20°C inside 2 mL eppendorf tubes before genomic DNA extraction. The study was conducted between November 2008 and February 2009. The genomic DNA extraction and SCAR-PCR analysis were carried out at Central Biotechnology Laboratory, IITA Ibadan, Nigeria.

Table 1: Identity of Orseolia species used in the present study
Image for - Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis

Genomic DNA Extraction
The 23 insects were then processed for DNA analyses according to Nicol et al. (1997) and Thottappilly et al. (1999), with some modification. Each was ground in liquid nitrogen, suspended in 200 μL of CTAB buffer (50 mM Tris (pH 8.0), 0.7 mM NaCl, 10 mM EDTA, 2% hexadecyltrimethylammonium bromide and 0.1% 2-mercaptoethanol), followed by the addition of 50 mL of 20% sodium dodecyl sulphate and incubated at 65°C for 30 min. The DNA was purified by two extractions with phenol: chloroform:isoamyl alcohol (24:25:1) and precipitated with -20°C absolute ethanol. After washing with 70% ethanol, the DNA was dried and re-suspended in 150 μL of sterile distilled water. The DNA concentration was measured using a DU-65 UV spectrophotometer (Beckman Instruments, Inc., Fullerto, California, USA) at 260 nm. DNA degradation was checked by electrophoresis on a 1% agarose gel in TAE (45 mM Tris-acetate, 1 mM EDTA (pH 8.0).

SCAR-PCR Analysis
The PCR analysis of genomic DNA from the 23 insects was carried out using SCAR primers developed by Nwilene et al. (2006). Genomic DNA from O. bonzii, O. nwanzei and O. oryzivora was included in the PCR analysis as control. Each of the designed SCAR primer pairs (one forward and one reverse SCAR primer) was tested on the insects genomic DNA. A total of sixty SCAR primer pairs were screened for their ability to amplify the insect genomic DNA. Four of these primers (Table 2) were found useful, since they gave polymorphism and were used in amplifying genomic DNA of all the 26 insects. Amplifications were performed in 25 mL reaction mixture consisting of genomic DNA, reaction buffer (Promega), 100 mM each of dATP, dCTP, dGTP and dTTP, 0.2 mM for each forward and reverse SCAR primer, 2.5 mM MgCl2 and 1U of Taq polymerase (Boehringer, Germany). Two different annealing temperatures (60 and 55°C) were screened to determine the optimal annealing temperature. Amplification of genomic DNA with SCAR primers was done using 1 cycle of 94°C for 4 min, 35 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 2 min and 1 cycle of 72°C for 7 min.

Table 2: Identity of SCAR primers that gave polymorphism after screening and used in the present study
Image for - Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis

The amplification products were resolved by electrophoresis in a 1.4% agarose and stained in 0.5 mg mL-1 ethidium bromide solution. The presence and the absence of the SCAR band were visually scored and compared for each of the three Orseolia species. The banding patterns were photographed over UV light using a red filter.

Cluster Analysis
Positions of unequivocally scorable SCAR bands were transformed into a binary character matrix (1 for the presence and 0 for the absence of a band at a particular position). Pairwise distance matrices were compiled by the NTSYS-pc 2.0 software (Rohlf, 2000) using the Jaccard co-efficient of similarity (Ivchenko and Honov, 1998). Dendrograms were created by the unweighted pairgroup method arithmetic (UPGMA) average cluster analysis (Sneath and Sokal, 1973; Jako et al., 2009).

RESULTS AND DISCUSSION

Identification and differentiation of Orseolia species in Nigeria was carried out using SCAR-PCR analysis. Of 60 SCAR primers screened, only four SCAR primers produced clear amplified DNA fragments at annealing temperature of 55°C. All the 26 insects were differentiated by SCAR-PCR analysis using the four SCAR primer pairs (Fig. 1-4). Cluster analysis revealed two major insect genotypes (OSG-1 and OSG-2) (Fig. 5). The OSG-1 genotype was further divided into two subgroups (OSG-1a and OSG-1b). Eleven insects were genotyped as OSG-1a, fourteen others were grouped as OSG-1b and one insect was genotyped as OSG-2 (Fig. 1). Among the insects with the OSG-1a genotype, only NG1 and NG2 were identical. Two different groups of identical insects were identified among OSG-1b genotype. All the three reference insects (O. bonzii, O. nwanzei and O. oryzivora) were genetically distinct. While O. bonzii and O. oryzivora were genotyped as OSG-1b along with other twelve insects, only O. nwanzei was genotyped as OSG-2. OSG-1b genotype constitutes about 54% O. bonzii and O. oryzivora in Nigeria, OSG-2 genotype represents 4% of O. nwanzei in Nigeria while OSG-1a genotype covers 42% of yet unknown Orseolia species in Nigeria (Table 3).

The existence of genetic variation among Orseolia species, as revealed by SCAR-PCR analyses, demonstrates its fingerprinting and diagnostic potential that could be used to identify and differentiate these insect species (Maruthi et al., 2007; Lu and Adang, 1996; Kakouli-Duarte et al., 2001; Armstrong et al., 1997; Behura et al., 1999). The use of genetic markers to efficiently and effectively identify genetic variations in the species is important in the management of the insects (Maruthi et al., 2007; Lu and Adang, 1996; Kakouli-Duarte et al., 2001; Armstrong et al., 1997; Behura et al., 1999).

Image for - Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis
Fig. 1: The DNA fingerprinting patterns of Orseolia species using SCAR primer (OSSP5 forward: 5’ATTACGCCCAGGTACCACAA3’; OSSP7 reverse: 5’CGCCCAGGTAC CATAACAAC3’), M: 1 kb molecular size marker

Image for - Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis
Fig. 2: The DNA fingerprinting patterns of Orseolia species using SCAR primer (OSSP11 forward: 5’AGTGATTACGCCCAGGTCAG3’; OSSP6 reverse: 5’ACCGCACCGAAT GATACCTA3’), M: 1 kb molecular size marker

Image for - Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis
Fig. 3: The DNA fingerprinting patterns of Orseolia species using SCAR primer (OSSP14 forward: 5’CACTAGTGATTACGCCCAGGT3’; OSSP7 reverse: 5’CGCCCAGGTACC ATAACAAC3’), M: 1 kb molecular size marker

Insect classification and genetic relationships are important issues for entomologists working on host plant resistance and biological control (Maruthi et al., 2007; Lu and Adang, 1996; Kakouli-Duarte et al., 2001; Armstrong et al., 1997; Behura et al., 1999). The application of SCARs as demonstrated in this study seems very useful in this regard.


Image for - Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis
Fig. 4: The DNA fingerprinting patterns of Orseolia species using SCAR primer (OSSP16 forward: 5’TGATTACGCCCAGGTCGAT3’; OSSP1 reverse: 5’GATTACGCCCAG GTCACTGT3’), M: 1 kb molecular size marker

Image for - Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis
Fig. 5: Cluster analysis of Orseolia species as revealed by SCAR markers

Table 3: Orseolia species genotype distribution and population structure in Nigeria
Image for - Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis
-: Absent, +: Present

Using SCAR to determine genetic relationships should allow entomologists to identify and differentiate insect species before and after their release in the field. This will also assist scientists to study species composition existing in a locality before the introduction of a new species, thereby detecting the level of outcross between other species in the field (Maruthi et al., 2007; Armstrong et al., 1997; Behura et al., 1999). The present study confirms the earlier studies on the existence of O. bonzii, O. nwanzei and O. oryzivora in Nigeria (Nwilene et al., 2006), but Orseolia species genotype distribution and population structure in Nigeria as revealed by this study was not established in the previous study conducted by Nwilene et al. (2006). The distinct DNA fingerprints obtained in this study for different Orseolia species are potentially useful for their field diagnostic purposes to identify different biotypes of gall midge as well as detecting biotype variant outbreak in different locality (Maruthi et al., 2007; Behura et al., 1999). In addition, the DNA fingerprint defined by each Orseolia species should be useful for epidemiological surveys, identification of new species and to differentiate aggressive from non-aggressive species (Behura et al., 1999). This information will strongly assist breeding programmes aimed at effective development of cultivars with durable resistance to AfRGM in Nigeria.

CONCLUSION

Using SCAR-PCR analysis, identification and differential of Orseolia species in Nigeria has been made possible. Two major Orseolia species genotypes as well as Orseolia species genotype distribution and population structure in Nigeria were revealed by this study. The OSG-1a genotype that covers about 42% of yet unknown Orseolia species in Nigeria needs further investigation to establish their identity either as one new Orseolia species or as two or more new Orseolia species. This finding will further establish the actual number of Orseolia species in Nigeria, their genotype distribution and population structure towards achieving effective development of cultivars with durable resistance to AfRGM in Nigeria.

ACKNOWLEDGMENTS

The authors would like to thank Mr. Adebayo Kehinde for his technical support and the Central Biotechnology laboratory, International Institute of Tropical Agriculture (IITA) for SCAR-PCR analysis.

REFERENCES

1:  Armstrong, K.F., C.M. Cameron and E.R. Frampton, 1997. Fruit fly diptera: Tephritidae) species identification a rapid molecular diagnostic technique for quarantine application. Bull. Entomol. Res., 87: 111-118.
Direct Link  |  

2:  Behura, S.K., S.C. Sahu, S. Rajamani, A. Devi, R. Mago, S. Nair and M. Mohan, 1999. Differentiation of Asian rice gall midge, Orseolia oryzae (Wood-Mason), biotypes by sequence characterized amplified regions (SCARs). Insect Mol. Biol., 8: 391-397.
PubMed  |  Direct Link  |  

3:  Brown, P. and S.D. Tanskley, 1996. Characterization and genetic mapping of simple sequence repeats (SSR) in the tomato genome. Mol. General Genet., 250: 39-49.
CrossRef  |  Direct Link  |  

4:  Jako, E., E. Ari, P. Ittzes, A. Horvath and J. Podani, 2009. BOOL-AN: A method for comparative sequence analysis and phylogenetic reconstruction. Mol. Phylogenet. Evol., 52: 887-897.
CrossRef  |  Direct Link  |  

5:  Harris, K.M., C.T. Williams, O. Okhidievbie, J. LaSalle and A. Polaszek, 1999. Description of a new species of Orseolia (Diptera: Cecidomyiidae) from Paspalum in West Africa, with notes on its parasitoids, ecology and relevance to natural biological control of the African rice gall midge, O. oryzivora. Bull. Entomol. Res., 89: 441-448.
CrossRef  |  Direct Link  |  

6:  Ivchenko, G.I. and S.A. Honov, 1998. On the jaccard similarity test. J. Math. Sci., 88: 789-794.
CrossRef  |  Direct Link  |  

7:  Kakouli-Duarte, T., D.G. Casey and A.M. Burnell, 2001. Development of a diagnostic DNA probe for the fruit flies Ceratitis capitata and Ceratitis rosa (Diptera: Tephritidae) using amplified fragment-length polymorphism. J. Econ. Entomol., 94: 989-997.
CrossRef  |  Direct Link  |  

8:  Katiyar, S.K., G. Chandel, Y. Tan, Y. Zhang and B. Huang et al., 2000. Biodiversity of Asian rice gall midge (Orseolia oryzae wood mason) from five countries examined by AFLP analysis. Genome, 43: 322-332.
Direct Link  |  

9:  Lingaraj, V.K., A.K. Chakravarthy and T.N. Eregowda, 2008. Detection of Asian rice gall midge (Orseolia oryzae) biotype 1 in the new locations of Karnataka, South India. Bull. Insectol., 61: 277-281.
Direct Link  |  

10:  Lu, Y.J. and M.J. Adang, 1996. Distinguishing fall armyworm (Lepidoptera: Noctuidae) strains using a diagnostic mitochondrial DNA marker. Florida Entomol., 79: 48-55.
Direct Link  |  

11:  Maruthi, M.N., A.R. Rekha, P. Sseruwagi and R.J. Hillocks, 2007. Mitochondrial DNA variability and development of a PCR diagnostic test for populations of the whitefly Bemisia afer (priesner and hosny). Mol. Biotechnol., 35: 31-40.
CrossRef  |  Direct Link  |  

12:  Nicol, D., K.F. Armstrong, S.D. Wratten, C.M. Cameron, C.M. Frampton and B. Fenton, 1997. Genetic variation in an introduced aphid pest Metopolophium dirhodum in New Zealand and relation to individuals from Europe. Mol. Ecol., 6: 255-265.
Direct Link  |  

13:  Nwilene, F.E., C.T. Williams, M.N. Ukwungwu, D. Dakouo and S. Nacro et al., 2002. Reactions of differential rice genotypes to African rice gall midge in West Africa. Int. J. Pest Manage., 48: 195-201.
Direct Link  |  

14:  Nwilene, F.E., K.M. Harris, O. Okhidievbie, A. Onasanya, Y. Sere and I. Ingelbrecht, 2006. Morphological diversity and genomic DNA fingerprinting of the African rice gall midge Orseolia oryzivora (Diptera Cecidomyiidae) and of two other species of African Orseolia. Int. J. Trop. Insect Sci., 26: 256-265.
CrossRef  |  Direct Link  |  

15:  Pathak, M.D. and G.S. Dhaliwal, 1981. Trends and strategies for rice insect problems in tropical Asia. IRRI, http://openlibrary.org/b/OL13287604M.

16:  Rohlf, F.J., 2000. NTSys pc, Version 2.02, Exeter Software. Setauket, New York, USA.

17:  Sneath, P.H.A. and R.R. Sokal, 1973. The Principle and Practice of Numerical Classification. In: Numerical Taxonomy, Kennedy, D. and R.B. Park (Eds.). Freeman, San Francisco

18:  Tautz, D., 1989. Hypervariability of simple sequences as a general source of polymorphic DNA markers. Nucleic Acids Res., 17: 6463-6471.
PubMed  |  

19:  Thottappilly, G., H.D. Mignouna, A. Onasanya, M. Abang, O. Oyelakin and N.K. Singh, 1999. Identification and differentiation of isolates of Colletotrichum gloeosporioides from yam by random amplified polymorphic dna markers. Afr. Crop Sci. J., 7: 195-205.
Direct Link  |  

20:  Ukwungwu, M.N. and R.C. Joshi, 1992. Distribution of the African rice gall midge, Orseolia oryzivora Harris and Gagne and its parasitoids in Nigeria. Trop. Pest Manage., 38: 241-244.
CrossRef  |  Direct Link  |  

21:  Ukwungwu, M.N., M.D. Winslow and V.T. John, 1989. Severe outbreak of rice gall midge (GM) in the savanna zone, Nigeria. Int. Rice Res. Newslet., 14: 36-37.

22:  Vos, P., R. Hogers, M. Bleeker, M. Reijans and T. van de Lee et al., 1995. AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res., 23: 4407-4414.
CrossRef  |  PubMed  |  Direct Link  |  

23:  Waterhouse, D.F., 1993. The Major Arthropod Pests and Weeds of Agriculture in Southeast Asia: Distribution, Importance and Origin. Australian Centre for International Research, Canberra, Australia, pp: 141

24:  Williams, J.G.K., A.R. Kubelik, K.J. Livak, J.A. Rafalski and S.V. Tingey, 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res., 18: 6531-6535.
CrossRef  |  PubMed  |  Direct Link  |  

25:  Zietkiewicz, E., A. Rafalski and D. Labuda, 1994. Genome fingerprinting by Simple Sequence Repeat (SSR)-anchored polymerase chain reaction amplification. Genomics, 20: 176-183.
CrossRef  |  PubMed  |  Direct Link  |  

©  2021 Science Alert. All Rights Reserved