Pakistan Journal of Biological Sciences1028-88801812-5735Asian Network for Scientific Information10.3923/pjbs.2019.585.589PolloGracia Alice Victoria SumarauwSarah Celia Pertiwi HesselSofia Safitri TalleiTrina Ekawati 1220192212Background and Objective: Genetic variation in the form of a single nucleotide polymorphisms (SNPs) in the tumor necrosis factor alpha (TNF-α) promoter region is known to influence the regulation of TNF-α production, transcription and translation and has been linked to several diseases. Primer sequences that amplify DNA flanking the -308 sequence are not universal, therefore, research on SNP conducted in this area still uses different primer pairs. The purpose of this research was to design and optimize universal primers to amplify DNA sequences covering the TNF-α -308 promoter area for other researchers to study the presence of SNPs in the -308 nucleotide and beyond. Materials and Methods: The peripheral blood samples for DNA preparation were obtained from 3 participants. The DNAs were extracted using available commercial kit. The candidate of universal primers were designed using BLAST and Primer3 softwares. Amplification of DNA region flanked by the designed primer pairs was performed using PCR method using available commercial kit. Results: The study showed that there were significant differences between the 5 primary pairs studied. From the 5 pairs of primers, the TNF-α 1 primer pair (TNF-α 1F: AACCAGCATTATGAGTCTC and TNF-α 1R: AACAACTGCCTTTATATGTC) and the TNF-α 2 primer pair (TNF-α 2F: TGAAACCAGCATTATGAGT and TNF-α 2R: AACAACTGCCTTTATATGTC) produced single, distinct, sharp and thick bands. Conclusion: From this study it can be concluded that TNF-α 1 and TNF-α 2 primer pairs have the potential to be used as universal primers to study the SNPs in the TNF-α -308 promoter region.]]>Parameswaran, N. and S. Patial,20102087103Kushibiki, S.,201182504511Ghamari, E., P. Farnia, S. Saif, M. Marashian, J. Ghanavi, P. Farnia and A.A. Velayati,201655561Feng, R.N., Y. Li and C.H. Sun,200985e4e7Cui, G., H. Wang, R. Li, L. Zhang and Z. Li et al.,20122012Zhang, B.B., X.Z. Liu, J. Sun, Y.W. Yin and Q.Q. Sun,20132013Singh, S., A. Sharma and S.K. Arora,20142014Hu, Q., G.G. Lou, Y.C. Liu, L. Qian and B.D. Lv,2014767075Umapathy, D., E. Krishnamoorthy, V. Mariappanadar, V. Viswanathan and K.M. Ramkumar,201810721132121Jamil, K., A. Jayaraman, J. Ahmad, S. Joshi and S.K. Yerra,20172411951203Wu, C.C., Y.K. Huang, C.Y. Huang, H.S. Shiue and Y.S. Pu et al.,20182018Kavya, S.R.,20154112Lorenz, T.C.,20122012Garibyan, L. and N. Avashia,201313314Dieffenbach, C.W. and G.S. Dveksler,1995Jaric, M., J. Segal, E. Silva-Herzog, L. Schneper, K. Mathee and G. Narasimhan,20132013Ye, J., G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen and T.L. Madden,20122012SantaLucia, J.,19989514601465Wright, E.S.,20192019Thachuk, C. and A. Condon,20072007pp: 123130Miura, F., C. Uematsu, Y. Sakaki and T. Ito,20052143634370Kwok, S., D.E. Kellogg, N. McKinney, D. Spasic, L. Goda, C. Levenson and J.J. Sninsky,1990189991005