Abstract: Identification and differentiation of Orseolia species in Nigeria was carried out using SCAR-PCR analysis. Twenty-three insects from 9 localities in Nigeria and three reference insects (Orseolia bonzii, Orseolia nwanzei and Orseolia oryzivora) were analyzed. Out of the 60 SCAR primers screened, only four produced clear amplified DNA fragments at annealing temperature of 55°C that differentiated all the 26 Orseolia species. Cluster analysis revealed two major insect genotypes (OSG-1 and OSG-2). The OSG-1 was further divided into two subgroups (OSG-1a and OSG-1b). Eleven insects were genotyped as OSG-1a, 14 as OSG-1b and one as OSG-2. Only NG1 and NG2 were identical among the insects of OSG-1a genotype. OSG-1b genotype produced two different groups of identical insects. While O. bonzii and O. oryzivora were genotyped as OSG-1b along with other twelve insects, only O. nwanzei was genotyped as OSG-2. OSG-1b genotype constitutes about 54% O. bonzii and O. oryzivora in Nigeria, OSG-2 genotype represents 4% of O. nwanzei in Nigeria while OSG-1a genotype covers 42% of yet unknown Orseolia species in Nigeria. This information would strongly assist breeding programmes aiming at effective development of cultivars with durable resistance to African rice gall midge (AfRGM) in Nigeria.
INTRODUCTION
The African Rice Gall Midge (AfRGM), Orseolia oryzivora Harris and Gagné (Diptera: Cecidomyiidae), is a serious insect pest of rainfed and irrigated lowland rice and is found only in Africa. It is an increasingly important insect pest of lowland rice in Nigeria (Ukwungwu et al., 1989). The pest was initially thought to be the same species as the Asian gall midge, Orseolia oryzae (Wood-Mason) but later separated from Asian rice gall midge based on the morphological characters of larvae, pupae and adults from the identical (Pathak and Dhaliwal, 1981; Waterhouse, 1993).
Orseolia oryzivora has been reported in thirteen West African countries including Burkina Faso, Mali, Nigeria, Sierra Leone and Cameroun (Ukwungwu et al., 1989; Ukwungwu and Joshi, 1992; Harris et al., 1999; Nwilene et al., 2002). The first major outbreak in Nigeria occurred in 1988 and affected about 50, 000 ha of rice. In the worst hit area in Abakaliki, Ebonyi State, about 45 to 80% tillers were infested on the worst affected fields. In the following year, similar damage was reported further South in the forest zone (Ukwungwu and Joshi, 1992). The insect has assumed a greater importance in recent years, especially after the introduction of high yielding varieties, changes in crop management practices and intensification of the production systems.
Field sampling has shown that AfRGM can increase very rapidly on many of the improved high-yielding rice varieties currently grown by farmers, thereby allowing for serious outbreaks to develop quickly. Thus, developing new rice varieties with higher levels of resistance to AfRGM is very important for improved management of the pest. However, this resistance can break down as a result of genetic change in the pest population (Katiyar et al., 2000; Lingaraj et al., 2008). Recent studies by the WARDA Integrated Pest Management Task Force have showed that the resistance of rice varieties to AfRGM differs markedly from one location to another. This is probably due to genetic differences between the AfRGM populations at different locations.
An understanding of this genetic variation amongst the population of the O. oryzivora is necessary for breeding programmes aimed at effective development of cultivars with durable resistance to AfRGM in Nigeria. Polymerase Chain Reaction (PCR) based genetic markers are widely used for molecular detection, genome mapping, map-based cloning and analysis of genetic variation in insects. These marker systems include random amplified polymorphic DNA (RAPD) (Williams et al., 1990), Simple Sequence Repeats (SSR) (Tautz, 1989; Brown and Tanskley, 1996), Inter Simple Sequence Repeats (ISSR) polymerase chain reaction (Zeitkeinicz et al., 1994) and Amplified Fragment Length Polymorphisms (AFLP) (Vos et al., 1995). Sequence Characterized Amplified Regions (SCARs) are based on sequencing the polymorphic fragment derived from RAPD primers and designing longer primers that will specifically bind to this fragment (Nwilene et al., 2006). The present study aimed at using SCAR-PCR technique for the identification and differentiation of Orseolia species from Nigeria. The information from the study would strongly assist rice breeding programmes aiming at effective development of cultivars with durable resistance to African Rice Gall Midge (AfRGM) in Nigeria.
MATERIALS AND METHODS
Insect Collection and Storage
Twenty-three insects (Table 1), consisting of 2 larvae
and 21 pupae were collected at random from 9 localities in lowland and irrigated
ecologies in Nigeria. These larvae and pupae were preserved in absolute ethanol
at -20°C inside 2 mL eppendorf tubes before genomic DNA extraction. The
study was conducted between November 2008 and February 2009. The genomic DNA
extraction and SCAR-PCR analysis were carried out at Central Biotechnology Laboratory,
IITA Ibadan, Nigeria.
| Table 1: | Identity of Orseolia species used in the present study |
Genomic DNA Extraction
The 23 insects were then processed for DNA analyses according to Nicol
et al. (1997) and Thottappilly et al.
(1999), with some modification. Each was ground in liquid nitrogen, suspended
in 200 μL of CTAB buffer (50 mM Tris (pH 8.0), 0.7 mM NaCl, 10 mM EDTA,
2% hexadecyltrimethylammonium bromide and 0.1% 2-mercaptoethanol), followed
by the addition of 50 mL of 20% sodium dodecyl sulphate and incubated at 65°C
for 30 min. The DNA was purified by two extractions with phenol: chloroform:isoamyl
alcohol (24:25:1) and precipitated with -20°C absolute ethanol. After washing
with 70% ethanol, the DNA was dried and re-suspended in 150 μL of sterile
distilled water. The DNA concentration was measured using a DU-65 UV spectrophotometer
(Beckman Instruments, Inc., Fullerto, California, USA) at 260 nm. DNA degradation
was checked by electrophoresis on a 1% agarose gel in TAE (45 mM Tris-acetate,
1 mM EDTA (pH 8.0).
SCAR-PCR Analysis
The PCR analysis of genomic DNA from the 23 insects was carried out using SCAR
primers developed by Nwilene et al. (2006). Genomic
DNA from O. bonzii, O. nwanzei and O. oryzivora was included
in the PCR analysis as control. Each of the designed SCAR primer pairs (one
forward and one reverse SCAR primer) was tested on the insects genomic DNA.
A total of sixty SCAR primer pairs were screened for their ability to amplify
the insect genomic DNA. Four of these primers (Table 2) were
found useful, since they gave polymorphism and were used in amplifying genomic
DNA of all the 26 insects. Amplifications were performed in 25 mL reaction mixture
consisting of genomic DNA, reaction buffer (Promega), 100 mM each of dATP, dCTP,
dGTP and dTTP, 0.2 mM for each forward and reverse SCAR primer, 2.5 mM MgCl2
and 1U of Taq polymerase (Boehringer, Germany). Two different annealing temperatures
(60 and 55°C) were screened to determine the optimal annealing temperature.
Amplification of genomic DNA with SCAR primers was done using 1 cycle of 94°C
for 4 min, 35 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for
2 min and 1 cycle of 72°C for 7 min.
| Table 2: | Identity of SCAR primers that gave polymorphism after screening and used in the present study |
The amplification products were resolved by electrophoresis in a 1.4% agarose and stained in 0.5 mg mL-1 ethidium bromide solution. The presence and the absence of the SCAR band were visually scored and compared for each of the three Orseolia species. The banding patterns were photographed over UV light using a red filter.
Cluster Analysis
Positions of unequivocally scorable SCAR bands were transformed into a binary
character matrix (1 for the presence and 0 for the absence of a band at a particular
position). Pairwise distance matrices were compiled by the NTSYS-pc 2.0 software
(Rohlf, 2000) using the Jaccard co-efficient of similarity
(Ivchenko and Honov, 1998). Dendrograms were created
by the unweighted pairgroup method arithmetic (UPGMA) average cluster analysis
(Sneath and Sokal, 1973; Jako et
al., 2009).
RESULTS AND DISCUSSION
Identification and differentiation of Orseolia species in Nigeria was carried out using SCAR-PCR analysis. Of 60 SCAR primers screened, only four SCAR primers produced clear amplified DNA fragments at annealing temperature of 55°C. All the 26 insects were differentiated by SCAR-PCR analysis using the four SCAR primer pairs (Fig. 1-4). Cluster analysis revealed two major insect genotypes (OSG-1 and OSG-2) (Fig. 5). The OSG-1 genotype was further divided into two subgroups (OSG-1a and OSG-1b). Eleven insects were genotyped as OSG-1a, fourteen others were grouped as OSG-1b and one insect was genotyped as OSG-2 (Fig. 1). Among the insects with the OSG-1a genotype, only NG1 and NG2 were identical. Two different groups of identical insects were identified among OSG-1b genotype. All the three reference insects (O. bonzii, O. nwanzei and O. oryzivora) were genetically distinct. While O. bonzii and O. oryzivora were genotyped as OSG-1b along with other twelve insects, only O. nwanzei was genotyped as OSG-2. OSG-1b genotype constitutes about 54% O. bonzii and O. oryzivora in Nigeria, OSG-2 genotype represents 4% of O. nwanzei in Nigeria while OSG-1a genotype covers 42% of yet unknown Orseolia species in Nigeria (Table 3).
The existence of genetic variation among Orseolia species, as revealed by SCAR-PCR analyses, demonstrates its fingerprinting and diagnostic potential that could be used to identify and differentiate these insect species (Maruthi et al., 2007; Lu and Adang, 1996; Kakouli-Duarte et al., 2001; Armstrong et al., 1997; Behura et al., 1999). The use of genetic markers to efficiently and effectively identify genetic variations in the species is important in the management of the insects (Maruthi et al., 2007; Lu and Adang, 1996; Kakouli-Duarte et al., 2001; Armstrong et al., 1997; Behura et al., 1999).
| Fig. 1: | The DNA fingerprinting patterns of Orseolia species using SCAR primer (OSSP5 forward: 5’ATTACGCCCAGGTACCACAA3’; OSSP7 reverse: 5’CGCCCAGGTAC CATAACAAC3’), M: 1 kb molecular size marker |
| Fig. 2: | The DNA fingerprinting patterns of Orseolia species using SCAR primer (OSSP11 forward: 5’AGTGATTACGCCCAGGTCAG3’; OSSP6 reverse: 5’ACCGCACCGAAT GATACCTA3’), M: 1 kb molecular size marker |
| Fig. 3: | The DNA fingerprinting patterns of Orseolia species using SCAR primer (OSSP14 forward: 5’CACTAGTGATTACGCCCAGGT3’; OSSP7 reverse: 5’CGCCCAGGTACC ATAACAAC3’), M: 1 kb molecular size marker |
Insect classification and genetic relationships are important issues for entomologists working on host plant resistance and biological control (Maruthi et al., 2007; Lu and Adang, 1996; Kakouli-Duarte et al., 2001; Armstrong et al., 1997; Behura et al., 1999). The application of SCARs as demonstrated in this study seems very useful in this regard.
| Fig. 4: | The DNA fingerprinting patterns of Orseolia species using SCAR primer (OSSP16 forward: 5’TGATTACGCCCAGGTCGAT3’; OSSP1 reverse: 5’GATTACGCCCAG GTCACTGT3’), M: 1 kb molecular size marker |
| Fig. 5: | Cluster analysis of Orseolia species as revealed by SCAR markers |
| Table 3: | Orseolia species genotype distribution and population structure in Nigeria |
| -: Absent, +: Present | |
Using SCAR to determine genetic relationships should allow entomologists to identify and differentiate insect species before and after their release in the field. This will also assist scientists to study species composition existing in a locality before the introduction of a new species, thereby detecting the level of outcross between other species in the field (Maruthi et al., 2007; Armstrong et al., 1997; Behura et al., 1999). The present study confirms the earlier studies on the existence of O. bonzii, O. nwanzei and O. oryzivora in Nigeria (Nwilene et al., 2006), but Orseolia species genotype distribution and population structure in Nigeria as revealed by this study was not established in the previous study conducted by Nwilene et al. (2006). The distinct DNA fingerprints obtained in this study for different Orseolia species are potentially useful for their field diagnostic purposes to identify different biotypes of gall midge as well as detecting biotype variant outbreak in different locality (Maruthi et al., 2007; Behura et al., 1999). In addition, the DNA fingerprint defined by each Orseolia species should be useful for epidemiological surveys, identification of new species and to differentiate aggressive from non-aggressive species (Behura et al., 1999). This information will strongly assist breeding programmes aimed at effective development of cultivars with durable resistance to AfRGM in Nigeria.
CONCLUSION
Using SCAR-PCR analysis, identification and differential of Orseolia species in Nigeria has been made possible. Two major Orseolia species genotypes as well as Orseolia species genotype distribution and population structure in Nigeria were revealed by this study. The OSG-1a genotype that covers about 42% of yet unknown Orseolia species in Nigeria needs further investigation to establish their identity either as one new Orseolia species or as two or more new Orseolia species. This finding will further establish the actual number of Orseolia species in Nigeria, their genotype distribution and population structure towards achieving effective development of cultivars with durable resistance to AfRGM in Nigeria.
ACKNOWLEDGMENTS
The authors would like to thank Mr. Adebayo Kehinde for his technical support and the Central Biotechnology laboratory, International Institute of Tropical Agriculture (IITA) for SCAR-PCR analysis.