Abstract: RNAi based “host plant mediated pathogen gene silencing” has emerged as a novel strategy for the efficient control of pathogens infecting various important food crops. Artifical microRNAs (amiRNAs) represent a robust and recently developed miRNA based strategy for the effective posttranscriptional gene silencing in plants. Phytophthora infestans RXLR effector Avr3a suppresses hypersensitive cell death in host cells and responsible for virulence. In the present investigation, the effect of artificial microRNAs are studied on the target transcript, Avr3a gene of P. infestans. Five Avr3a amiRNA gene constructs developed targeting five different regions of Avr3a gene of P. infestans and were transformed into two popular Indian potato cultivars i.e., Kufri Khyati and Kufri Pukharaj. Screening analysis study revealed that most of the transgenic lines were susceptible (15) and few lines (4) were found to be moderately or partially resistance. Target effector gene expression level and the pathogen load were determined to identify whether the resistant observed was RNA mediated. Real time PCR analysis showed that there is reduction in pathogen load as well as in transcript level of Avr3a in resistant lines as compared to the non-transgenic control. This revealed that, the invading P. infestans withdraws the dsRNA/amiRNAs from the host cell leading to the silencing of the Avr3a gene expression causing pathogen death and/or loss of virulence. The amiRNA technology developed in this study appears to be potential and promising for durable and long lasting resistance in potato to combat the notorious oomycete, P. infestans.
INTRODUCTION
Late blight caused by the fungus, Phytophthora infestans is the most devastating and dreadful disease of potato worldwide. The disease was also responsible for the infamous Irish potato famine in 1845 which caused social turbulence in Europe. Late blight disease caused by the pathogen is still one of the most biological threats to the food security that costs the world wide losses estimated over $13 billion annually (Haverkort et al., 2008). Since the tragedy of great Irish famine in 1840s, phytopathologists have focused much attention and research on P. infestans due to its global economic importance. The genome of P. infestans encode a large and diverse repertoire of secreted disease effector proteins (>700) that alter host cell structure and functions. There are two classes of effectors i.e., apoplastic effectors and cytoplasmic effectors that targets different sites in infected host plant tissue. Apoplastic effectors are secreted into the plant extracellular space where they interact with extracellular targets and surface receptors whereas cytoplasmic effectors are translocated inside the plant cell presumably through specialized structures like infection vesicles and haustoria that invaginate inside the living host cells. Apoplastic effectors involve the secreted pathogens and host derived hydrolytic enzymes and corresponding inhibitor proteins. Cytoplasmic effectors are modular proteins organized into two main functional domains which consist of an N-terminal region, a highly conserved sequence motif that is the signal peptide and RXLR-dEER motif (Arginine, any amino acid, leucine, Arginine), involved in secretion and translocation inside plant cells. The other one is C-terminal domain carrying the biochemical effector activity that follows the RXLR domain (Kamoun, 2006, 2007; Morgan and Kamoun, 2007). RXLR effector Avr3a from P. infestans is originally avirulence effector, recognized by R3a, the corresponding resistance protein in potato. In P. infestans two isoforms of Avr3a have been identified that differ by three amino acids i.e., Avr3a(C19)K80I103, Avr3a(S19)E80M103 referred to as AVR3aKI and AVR3aEM respectively. AVR3aKI but not AVR3aEM activates potato resistance protein R3a to trigger Effector-Triggered Immunity (ETI). In addition, both forms are able to suppress host cell death induced by the P. infestans elicitin infestin 1(INF1), in the absence of R3a. AVR3aKI exhibits stronger inhibition whereas suppression by AVR3a EM is weak. As the cytoplasmic effector protein, Avr3a has been reported to modulate host processes during infection by suppressing hypersensitive cell death, amiRNA-mediated silencing of gene encoding Avr3a protein of P. infestans in transgenic host background will be aimed for silencing of the targeted gene and consequently imparting late blight resistance. RNA-mediated gene silencing in plants is a collective manifestation of broadly two different functions-defence against molecular parasites like viruses, transposons and introduced transgenes by either post-transcriptional or transcriptional gene silencing and orchestration of developmental stages by regulation of endogenous gene expression at post-transcriptional level by microRNA (miRNA).
The amiRNAs become a gene silencing alternative with all the advantages of previous methods of Post Transcriptional Gene Silencing (PTGS) and with additional advantages regarding specificity and durability. The concept of artificial microRNA-mediated gene silencing has emerged recently and has been proven to be very robust, precise and stable in plants (Alvarez et al., 2006; Niu et al., 2006; Schwab et al., 2006; Fahim et al., 2012). In plants, RNAi technology is emerging as a promising genetic tool in the development of pests and pathogen resistant plants. Host Induced Gene Silencing (HIGS) allows the silencing of genes in plant pathogens by expressing an RNAi construct against specific genes endogenous to the pathogen in the host plant. Reduced development of root knot nematodes as well as Lepidoptera and Coleoptera insects through host induced RNAi has been reported (Huang et al., 2006; Baum et al., 2007; Mao et al., 2007). Recently study done by Nowara et al. (2010) suggested the exchange of small non coding RNA between cereal hosts and Blumeria graminis. Based upon this, the possibility of exchange of amiRNAs against Avr3a gene from potato into P. infestans is tested for conferring late blight resistance.
MATERIALS AND METHODS
Constructions of amiRNAs
Backbone: Arabidopsis pre-miRNA 164b stem-loop backbone of 153 nucleotides were chosen for expression of Avr3a amiRNAs in transgenic potato. Appropriate primers designed replacing Arabidopsis miRNA164b sequence and incorporating individual Avr3a amiRNA into the pre-miRNA backbone.
Target gene: The P. infestans genome sequence web site, http://www.broad.mit.edu/annotation/genome/phytophthora_infestans/Home.html, was mined for the presence of genes carrying RXLR motif. A total of 40 annotated genes sequences were obtained and aligned for sequence similarity using CLUSTAL X programme. All the 40 genes showed high sequence divergence as they belong to different gene families. Therefore, one important P. infestans gene, Avr3a which is involved in pathogen virulence by suppression of host cell death, was targeted for development of RNAi gene construct. Three Avr3a gene homologues were obtained from the P. infestans genome web site. The Avr3a 14368 whole genome sequence was chosen for development of amiRNA gene construct.
Designing and selection of amiRNA (artificial micro RNAs): A number of potential amiRNA sequences were obtained against Avr3a mRNA with the help of Web microRNA Designer (Schwab et al., 2006; Ossowski et al., 2008) tool platform (http://wmd3.weigelworld.org “Last Time Access on This Date 2014-08-28”). The amiRNA sequences were filtered based on the most common determinants of plant miRNAs-U at the 5' end, A at position 10 and preferentially UU at the 3' end and C at position 19 (Schwab et al., 2005). Finally, five amiRNAs having complementarity against five different regions of Avr3a mRNA and without any off-targets finally selected for amiRNA construct development. Arabidopsis pre-miRNA 164b stem-loop backbone of 153 nucleotides was chosen for expression of Avr3a amiRNAs in transgenic potato. Higher expression rate of amiRNAs were generated in tobacco and tomato using the Arabidopsis miR164b precursor sequence (Alvarez et al., 2006). Appropriate primers were designed replacing Arabidopsis miRNA 164b sequence and incorporating individual Avr3a amiRNA into the pre-miRNA backbone.
Cloning of amiRNAs: Modified pre-miRNA 164b: Avr3a amiRNAs was PCR amplified by primer extension using error-proof Pfu Taq polymerase and appropriately designed primers. Total five pre-miRNA 164b:Avr3a amiRNAs were PCR amplified. The five pre-miRNA 164b: Avr3a amiRNAs were cloned into the pUC19 cloning vector and transformed into E. coli strain DH5α cells following the heat thaw method. The recombinant plasmids harbouring pUC19:Avr3a-amiRNAs were got sequenced from Genei, Bangalore. Sequencing was done using M13 forward and reverse primers.
Development of binary vector cassette: Plant binary vector, pBI121 used for sub-cloning of five Avr3a-amiRNAs. Two microgram of pBI121 was digested with 10U of XbaI and SacI in 1X TangoTM buffer [33 mM Tris-acetate (pH 7.9 at 37°C), 10 mM Mg-acetate, 66 mM K-acetate and 0.1 mg mL‾1 BSA] (Fermentas Life Sciences). The reaction incubated overnight at 37°C and run on 1% agarose gel. The vector backbone was gel eluted using QiaQuick® gel extraction kit (Qiagen) and stored at -20°C. The region of pBI121 vector contained GUS reporter gene under the control of CaMV 35S promoter and NOS terminator. GUS reporter gene removed by restricting pBI121 with the restiction enzymes, XbaI and SacI and the backbone was gel eluted. The pUC19 containing Avr3a-amiRNa was restricted with XbaI and SacI in 1X TangoTM (Fermentas Life Sciences) at 37°C for 5 h and loaded on 1.5% agarose gel. The gel portion containing an insert of 202 base pairs was carefully cut and was gel eluted using QiaQuick® gel extraction kit (Qiagen). The restricted digested Avr3a-amiRNA insert was ligated onto pBI121 vector backbone by incubating overnight at 22°C. The ligation mixture was used to transform competent E. coli DH5α cells and transformed colonies were selected and glycerol stocks were maintained. Resulting colonies on the LA kanamycin plates were inoculated in 5 mL LB media and plasmids were isolated using QIAprep® Spin Miniprep Kit (Qiagen) as per manufacturer’s protocol. The plasmid was digested with XbaI and SacI for 5 h at 37°C. Digestion products were analyzed on an agarose gel and the transformants carrying the recombinant plasmids were selected.
Agrobacterium mediated plant transformation: The binary vector cassette, pBI121:CaMV:Avr3a-amiRNA, was mobilized into Agrobacterium tumefaciens strain, EHA105 (Hood et al., 1993) by freeze-thaw method (Chen et al., 1994). Inter-nodal stem cuttings (0.5-1 cm) of Kufri Khyati and Kufri Pukhraj cultivars used as explants for transformation. Agrobacterium strain containing the pBI121: CaMV: Avr3a-amiRNA2 and pBI121:CaMV:Avr3a-amiRNA4 construct used for transformation. About 2000 inter-nodal stem explants of two potato cultivars were transformed with Avr3a-amiRNA-2 and Avr3a-amiRNA-4 constructs by Agrobacterium-mediated transformation. The regenerated adventitious shoot buds firstly selected on selective media containing antibiotic kanamycin (50 mg L-1). Although, multiple shoot formation seen in some internodes, only one shoot was counted as independent putative transformant. The regenerated adventitious shoot buds were transformed into multiplication media for development into plantlets.
RT-PCR: Total RNA was isolated from transformed potato cultivars Kufri Khyati and Kukri Pukhraj using Trizol reagent (Invitrogen). Total 600 putative amiRNA transgenic lines of Kufri Khyati and Kufri Pukhraj was screened for NPTII gene expression using one-step RT-PCR (GeNeiTM OneStep AMV RT-PCR Kit, Bangalore Genei) according to the protocol as suggested by the manufacturer. NPTII specific primer designed to amplify a 700 bp cDNA fragment using the total RNA of the transgenic lines as template. The isolated RNA was treated with RNase-free DNaseI to remove traces of contaminating DNA. The sequence of the primers used for RT-PCR amplification of NPTII 5' CCA ACG CTA TGT CCT GAT AG 3' (forward primer) and 5' TTT GTC AAG ACC GAC CTG TC 3' (reverse primer). A negative control was also included to check the presence of contaminating DNA.
Resistance/susceptibility assessment: Susceptible potato cultivars i.e., Kufri Khyati and Kufri Pukhraj were used to study late blight disease development. Sporangia were harvested from 10-14 d old cultures of P. infestans isolates Kalyani 08-1 (A1 mating type) and HP10-45 and HP10-22 (A2 mating type) grown on Rye-B agar medium at 18°C in darkness. The sporangia were harvested using 10 mL sterile water and a cotton swab. The suspensions were filtered through four layers of cheesecloth to remove mycelial fragments and were adjusted to 25,000 sporangia per milliliter with a hemacytometer. The suspensions were placed at 4-10°C. After 1 h, the zoospores were released. Thirteen lines of NptII amiRNA 2 (Kufri Khyati), 4 lines of amiRNA4 (Kufri Pukhraj) and 2 lines of amiRNA4 (Kufri Khyati) were screened for late blight resistance in Screening chamber (18°C temperature and ≥90% RH). The zoospores suspension adjusted to 40,000-50,000 mL‾1 was sprayed on 19 NptII positive lines. Disease development visually assessed every day for seven days after the first symptoms appeared. The symptoms were firstly appeared on 4th day and the readings were taken from 4th day onwards. Sample collection was started after 24 h post inoculation (hpi) from all NptII positive lines. Collected leaf samples were snap frozen in liquid nitrogen and stored at -80°C prior to further molecular assays. Percentage of area infected with late blight disease and the scoring was given classified on 1-9 scale modified from (Malcolmson, 1976). On the basis of screening assays and disease score, total 4 lines were finally selected for further molecular analysis.
DNA isolation and southern blot analysis: Genomic DNA was isolated from the four moderately resistant transgenic lines by cetyltrimetylammonium bromide protocol (Murray and Thompson, 1980) as modified by Luo et al. (2001). DNA quality was checked spectrophotometrically by Nano-drop spectrophotometer (Thermoscientific) and analyzed by means of 0.8% gel electrophoresis in 1X TAE (Tris acetate EDTA) buffer stained with ethidium bromide. DNA (12 μg) for each line was completely digested with BamHI and was resolved by means of 0.8% gel electrophoresis and then transferred onto a Hybond Tm-N+ (GE Healthcare) by capillary transfer. The DNA fragment corresponds to 690 bp fragment of NptII gene was PCR amplified with forward primer 5’GAGGCTATTCGGCTATGACTG 3’ and reverse primer 5’ CCTCGTGCTTTACGGTATCGC 3’ and gel eluted. The gel eluted DNA fragment was labelled with α [32P]-dCTP by the use of Amersham TM-Megaprime DNA labeling kit (GE Healthcare). Hybridization was performed at 65°C overnight. Membrane was washed twice in washing buffer (2X SSC, 0.1% SDS) for 30 min and analyzed on phosphoimager (Biorad).
Quantitative real time PCR assay: Total RNA extracted from all the infected plant tissues using the RNeasy® Plant Mini Kit (Qiagen) according to manufacturer’s instructions. The quantity and quality of RNA sample was checked using Nano spectrophotometer (ND-2000Thermo scientific) and all RNA samples were adjusted to the same concentration. RNA quality was further assessed using the Agilent-2100 Bioanalyzer and RNA 6000 Nano chips (Agilent Technologies, Singapore). For each method the measurement was done in duplicates. First strand cDNA was synthesized by reverse transcribing 2 μg of total RNA with high-capacity cDNA Reverse Transcription kit (Applied Biosystems, USA) in a 20 μL reaction using mixture of random primers and oligo-dT’s in 1:1 ratio according to manufacturer’s instructions. The cDNAs then used as template for real time PCR. For the relative expression studies of Avr3a gene, the relative expression studies of Avr3a gene, the actin primer ActA Fwd (5’CATCAAGGAGAAGCTGACGTACA-3’) and ActA R 5’-GACGACTCGGCGGCAG-3’ of P. infestans was used as a reference control. Primers were designed using the Primer Express software (version 3, Applied Biosystems) and were synthesized from Sigma Aldrich Private Limited. In order to confirm the sequences of the amplicons, PCR was performed on cDNA for all designed primer pairs. The products were analyzed on 2% agarose gel. A series of 10 fold of three dilutions of cDNA (10-1,000 fold dilution), were made to determine the gene specific PCR amplification efficiency for each primer pair in RT-PCR experiments. Based on the Ct values for all dilution points in a series, a standard curve was generated using linear regression and the slope. PCR amplification efficiency of the primer was determined using the following equation:
Efficiency (%) = 10(-1/slope) X100%
Real-ime PCR was performed in an optical 96-well plate with an 7900 HT real time PCR machine (Applied Biosystems) and universal cycling conditions (50°C for 2 min, 95°C for 10 min, 40 cycles for 15 sec at 95°C and 60°C for 60 sec) in final volume of 20 μL. Reactions contained, SYBR Green Master Mix (Applied Biosystems), 2 pM of a gene specific forward and reverse primers and 1 μL of the diluted cDNA. A Non-Template Control (NTC) was also included in each run for each gene. Each experiment was conducted in three technical replicates for both Avr3a gene as well as elongation factor1-α gene. The 2‾ΔΔCT method was used to analyze the relative transcript level of Avr3a. To check for the specificity of PCR amplification dissociation curve was generated. The Ct values were automatically determined for each reaction using SDS version 2.3 and RQ manager version 1.2 (Applied Biosystems) software with default parameters.
In planta monitoring of Phytophthora infestans growth: Progression of P. infestans was monitored by the quantitative real time PCR (qPCR) in the four selected NptII positive lines after the whole plant screening assay. The EF-1α Fwd (5'-ATTGGAAACGGATATGCTCCA-3') and EF-1α Rev (5'-TCCTTACCTGAACGCCTGTCA-3') based on the sequence of elongation factor gene from the Solanum tuberosum were used to quantify the DNA of Kufri Khyati and Kufri Pukhraj cultivars. The PiO8-3-3Fwd (5-'CAATTCGCCACCTTCTTCGA-3') and PiO8-3-3 Rev (5'-GCCTTCCTGCCCTCAAGAAC-3') (Eschen-Lippold et al., 2007; Halim et al., 2007) were designed based on highly repetitive sequences from the P. infestans genome (Judelson and Tooley, 2000). These highly repetitive sequences were used to quantify the DNA of P. infestans. For reducing the variability in DNA quality, the DNA isolation from the P. infestans leaves from the control cultivars and leaves from infected NptII positive lines was done with the NucleoSpin® Plant Machery-Nagel II as per manufacturer’s instructions. Purified DNAs were quantified by using Nano-drop spectrophotometer (ND-2000 Thermo scientific) and DNA integrity and quality was further evaluated by agarose gel electrophoresis. The DNA from potato cultivars i.e., Kufri ineKhyati and Kufri Pukhraj (200-0.32 ng) and P. infestans (20-0.032 ng) were fivefold serially diluted to construct standard curves. These curves were further evaluated for potato and P. infestans DNA with EF-1α and Pi08 primers. The quantitative PCRs (qPCRs) was performed in a total volume of 20 μL using SYBR Green technology on the Light Cycler 480II (Roche Biosystems). Cycling conditions were at 95°C for 15 min followed by the 40 cycles for 15 sec at 95°C, 15 sec at 60°C (Ef-1α and Pio8), 30 sec at 72°C at single acquisition mode. Melting curve analysis was at 95°C for 5 min, 55°C for 15 sec and 95°C in continuous mode.
Three technical replicas were performed and their mean values were used further. The qPCR efficiencies for Ef-1α and Pio8 were obtained using standard dilution curves in triplicates for K. Khyati and K. Pukhraj cultivars and P. infestans DNA, respectively. The qPCR efficiencies were calculated according to the equation:
E =10(-1/slope) x100%
The progression of P. infestans as well as its load was quantified in four selected NptII positive lines by qPCR at time point by normalizing the Pi08 values with the corresponding Ef-1α values for each individual sample using Ef-1α and Pi08 primers.
RESULTS
Selection of Avr3a amiRNA sequences: The amiRNA sequences and their target region in the Avr3a mRNA were selected by using Web MicroRNA Designer tool platform, http://wmd2.weigelworld.org “Last Time Access on This Date 2014-08-28”. Five amiRNAs having complementarity against five different regions of Avr3a mRNA and without any off-targets were finally selected for amiRNA construct development. Arabidopsis pre-miRNA 164b stem-loop backbone of 153 nucleotides (Fig. 1) was chosen for expression of Avr3a amiRNAs in transgenic potato.
| Fig. 1: | Stem loop structure and nucleotide sequence of Arabidopsis pre-miRNA164b.miRNA sequence is shown in red and miRNA*sequence is shown in bold black |
| Fig. 2: | Modified Arabidopsis pre-miRNA 164b harbouring Avr3a amiRNAs.amiRNA sequences shown in red and amiRNA* sequence shown in blue |
| Fig. 3: | Map of T-DNA region of binary vector cassette pBI121:Avr3a-amiRNA |
Cloning and expression of amiRNAs in transgenic potato: Modified pre-miRNA 164b:Avr3a amiRNAs was PCR amplified by primer extension using error-proof Pfu Taq polymerase and appropriately designed primers (Fig. 2). The PCR amplified and purified mir164b-Avr3a-amiRNA(s) were shuttled into pUC19 plasmid. Avr3a-amiRNA 1-5 from pUC19 was sub-cloned into plant binary vector, pBI121 under the control of CaMV 35S promoter (Fig. 3). Efficient amiRNA-mediated gene silencing has been observed to occur in a quantitative fashion, with strong promoters often causing higher degrees of gene silencing (Schwab et al., 2006; Alvarez et al., 2006; Ossowski et al., 2008). Restriction digestion analysis by XbaI and SacI enzymes confirmed the ligation Avr3a-amiRNA1-5 in pBI12I. Five binary vector cassettes, pBI121: Avr3a:amiRNA 1-5 were mobilized into Agrobacterium tumefaciens for transformation into two popular Indian potato cultivars, Kufri Pukhraj and Kufri Khyati. Nearly 2000 internodal stem explants of the cultivar were transformed with each of the amiRNA2 and amiRNA4 gene constructs. About 600 putative transformants were obtained for all the amiRNA constructs which were multiplied in kanamycin containing medium. In-vitro multiplied putative transformants of Kufri Pukhraj and Kufri Khyati cultivars were screened for NPTII gene expression through Reverse transcriptase PCR (Fig. 4a-b). Total 19 NptII positive lines oftlinewere obtained through reverse transcriptase PCR analysis i.e., 13 lines of amiRNA 2 (Kufri Khyati), 2 lines of amiRNA4 (Kufri Khyati) and 4 lines of amiRNA 2 and 4 (Kufri Pukhraj).
| Fig. 4(a-b): | (a) RT-PCR confirming the presence of NptII gene in amiRNA enconding Avr3a putative transgenic plants M: 1 kb ladder, 2-21: Samples, 1: Negative control, 22: Positive control and (b) Equal concentration of RNA as on 1.5% agarose gel |
| Fig. 5(a-b): | (a) Left: Disease progression of K. Pukhraj amiR 4.5002 transgenic line as compared to the K. Pukhraj control. Right: Disease progression of K. Khyati amiR 2.1153 in comparison to the K. Khyati control (b) Left: Disease progression of K. Khyati amiR4.4091 transgenic line as compared to the non transformed K. Khyati control. Right: Disease progression of K. Khyati amiR2.1219 transgenic line as compared to the non transformed K. Khyati control |
Screening for late blight resistance: For the evaluation of late blight resistance, the 19 NptII positive lines were planted in the greenhouse for 45 days and then shifted to Phytophthora infestans screening chamber. Out of 19 NptII, four transgenic lines were found to be moderately resistant as compared to the non transformed plants. Percentage of area infected with late blight disease and the scoring was given classified on 1-9 scale modified from Malcolmson (1976). On the basis of Malcolmson (1976) the transformants were classified as silenced, partially silenced and non silenced. Total four lines i.e., amir2.1153 (Kufri Khyati), amir 2.1219 (Kufri Khyati), amir4.5002 (Kufri Pukhraj) and amir4.4091 (Kufri Khyati) were found to be moderately resistant or partially silenced (Fig. 5a-b). The selected moderately resistant lines were further evaluated through real time PCR analysis.
Transcript abundance of the Avr3a gene in transgenic lines: Real time PCR analysis was done to study the effect of artificial microRNAs on the Avr3a target transcript using P. infestans actin primer as endogenous control. Analysis of relative gene expression in the present study was done by 2‾ΔΔCT method as given by Livak and Schmittgen (2001).
| Fig. 6(a-b): | Expression analysis through Real time PCR of Avr3a transcript in silenced versus non silenced backgrounds. (a) Reduction in expression level of Avr3a gene in the amiR K. Khyati silenced plants when compared to the non-silenced control is shown. Errors bars represent standard deviation of three independent biological repeats and (b) Expression of Avr3a transcript in silenced transgenic line K. Pukhraj amir 4.5002 versuses non silenced K. Pukhraj control |
Result of quantitative real time PCR (qRT-PCR) revealed the reduction in the target transcript of four selected partially resistant lines i.e., amir2.1153 (Kufri Khyati), amir 2.1219 (Kufri Khyati), amir4.5002 (Kufri Pukhraj) and amir4.4091 (Kufri Khyati). The transcript level of Avr3a was higher at 48 h post-inoculation (hpi) and then decreased sharply over time till 144 hpi as compared to the non transformed control potato cultivars. The expression of the Avr3a-amiRNA construct led to the reduction in transcript level of the Avr3a gene in the P. infestans. This data coincided with the less disease progression in partially resistant lines. Nearly, 95% reduction in Avr3a transcript was found in all the four selected transgenic lines (Fig. 6a-b) as comparison to the fully infected non-transformed control plants. Relative gene expression studies in resistant lines through real time PCR analysis confirmed the silencing of the Avr3a gene in P. infestans.
Growth progression of pathogen: Phytophthora infestans load was quantified in four selected NptII positive lines by qPCR by normalizing the Pi08 values with the corresponding Ef-1α values for each individual sample using Ef-1α and Pi08 primers. The standard curves showed consistent amplification over the different amount of DNA analyzed for both target amplicons (Fig. 7a, 8a, 9a). The assay allowed the detection of the pathogen biomass interms of DNA at 24 (hpi) while the first symptom of the disease was observed at 72 hpi. The transcripts studied showed high qPCR efficiency rates (E>99%) and high linearity correlation efficient R2>0.999 (Fig. 7b, 8b, 9b). Although the quantified pathogen DNA increased progressively until the end of bioassay, but the pathogen accumulation in the moderately or partially resistant lines was less as compared to the non transformed lines (Fig. 10). The line no amiR 2.1219 (Kufri Khyati) showed very much less accumulation of pathogen DNA as compared to transgenic lines.
| Fig. 7(a-b): | Quantification of serial diluted Phytophthora infestans DNA, (a) Quantitative real time PCR amplification profile of 5-fold serially diluted P. infestans and (b) Standard curve for qPCR analyses of 5-fold serial dilution of P. infestans DNA using Pio8 primers |
| Fig. 8(a-b): | Quantification of serial diluted K. Pukhraj control DNA, (a) Amplication curve quantitative real time PCR amplification profile of 5-fold serially diluted K. Pukhraj and (b) Standard curve for qPCR analyses of 5-fold serial dilution of K. Pukhraj DNA using EF-1α primers |
| Fig. 9(a-b): | Quantification of serial diluted K. Khyati Control DNA, (a) Quantitative real time PCR amplification profile of 5-fold serially diluted K. Khyati and (b) Standard curve for qPCR analyses of 5-fold serial dilution of K. Khyati DNA using EF-1α primers |
Copy number analysis of Avr3a transcript in transgenic lines: Southern analysis of four silenced transgenic lines revealed that Kufri Khyati amiR4.4091 carried two copies of transgene. Kufri Khyati amiR2.1219, Kufri Khyati amiR2.1153 and Kukri Pukhraj amiR 4.5002 carried single copy of transgenic while the control plants are not showing any integration of the gene (Fig. 11). Results of experiment are very good in terms of copy number as it is well known fact that, transgenic plants with single or low copy number have highest level of transgene expression and high copy number of transgene is related to low and unstable expression (Vaucheret et al., 1998).
DISCUSSION
Host Induced Gene Silencing (HIGS) in the plant fungal pathosystem is defined as the transformation of gene silencing construct into a host cell which targets a fungal gene responsible for virulence and metabolic functions. Recently, Nowara et al. (2010) and Yin et al. (2011) have also shown the host induced gene silencing effective against the obligate parasites Blumeria and Puccinia, respectively. Niblett and Bailey (2012) have also shown the transformation of potato plant carrying the hair pin construct of elicitin and ribosomal RNA (rRNA) genes from P. infestans respectively, confers resistance against P. infestans.
Compared with conventional RNAi, amiRNAs offer several advantages. First, miRNA precursors generally generate only a single effective small RNA of known sequence. Therefore, potential off-targets of amiRNAs can be more accurately predicted than those of longer hairpin constructs. Second, because miRNA-insensitive variants can be generated that do not differ in the encoded protein sequence of targets (Palatnik et al., 2003), mutant defects of amiRNA-expressing plants can be complemented which is not easily possible with RNAi plants.
| Fig. 10(a-b): | Growth of Phytophthora infestans in inoculated transgenic lines as compared to the non transgenic line. The pathogen load was quantified from infected leaf tissue by normailizing the Pio8 values with the corrosponding Ef-1α values for each individual sample. (a) P. infestans load in inoculated K. Pukhraj amir4.5002 transgenic line as compared to the non transgenic K. Pukhraj control.The pathogen load was quantified fronm infected leaf tissue by normailizing the Pio8 values with the corrosponding Ef-1α values for each individual sample and (b) P. infestans load in inoculated K. Khyati amir 4.5002 transgenic line as compared to the non transgenic K. Khyati control. The pathogen load was quantified fronm infected leaf tissue by normailizing the Pio8 values with the corrosponding Ef-1α values for each individual sample |
| Fig. 11: | Southern blot hybridization analysis of the Avr3a gene copy number in the four moderately resistant lines. Genomic DNA was digested with BamHI. The probe used in southern blot hybridization spans the neomycin phosphotransferase II gene. Lanes: 1: K. Khyati control, 2: K. khyati 4091, 3: K. Khyati 1219, 4: K. Khyati 1153, 5: K. Pukhraj amiR5002, 6: K. Pukhraj control |
Third, because of their exquisite specificity, amiRNAs can possibly be adapted for allele-specific knockouts. Fourth, as with natural miRNAs, amiRNAs are likely to be particularly useful for targeting groups of closely related genes, including tandemly arrayed genes. Due to specificity in silencing the target gene, the technique of miRNA-mediated gene silencing is increasingly being used for crop improvement by introduction of artificial microRNA (amiRNA) Ossowski et al. (2008). Schwab et al. (2006) found that, parameters for target selection by amiRNAs are similar to those of naturally occurring microRNAs. As the P. infestans Avr3a is an essential modular virulence effector, therefore the amiRNAs targeting the Avr3a gene of P. infestans in potato plant confers the moderate resistance against late blight pathogen. Previous study showed that the alteration of several nucleotides within the miRNA sequence does not affect its biogenesis as long as the positions of mismatches within the precursor stem loop remain unaffected (Vaucheret et al., 2004).
Five amiRNA’s generated through the WMD were introduced into Arabidopsis thaliana miRNA164b by overlapping PCR. Arabidopsis miRNA precursors have been modified to silence endogenous and exogenous target genes in the dicotyledonous plants (Niu et al., 2006; Qu et al., 2008; Schwab et al., 2006; Alvarez et al., 2006; Parizotto et al., 2004). The resulting PCR fragments were shuttled into the pUC19 cloning vector and sub-cloned into the plant binary vector pBI121 under the control of CaMV35 S promoter. The amiRNA constructs can easily be generated using a standardized cloning procedure (Schwab et al., 2006). The amiRNA construct against the Avr3a gene of P. infestans was mobilized into two potato cultivars K. Khyati and K. Pukhraj, susceptible to late blight.
Regenerated lines were tested for NPTII expression by reverse transcriptase polymerase chain reaction (RT-PCR) using specific primers for NPTII gene. In the present investigation we observed 3-4% of transformation efficiency. It depends on many factors like bacterial strain, bacterial concentration, pre-culture period, co-cultivation period, immersion time, acetosyringone concentration, temperature, explant type, pH, etc. (Uranbey et al., 2005). On the basis of whole plant screening assays and disease score, total four lines showing moderate resistance were finally selected for further molecular analysis by quantitative real time PCR. Analysis through real time PCR showed that there is 80-95% reduction in Avr3a transcript level as compared to total RNA recovered from the fully infected non transformed control plants. Infection by Irish famine pathogen involves two phases: a biotrophic phase up to 36 h post inoculation (36 h.p.i) in which P. infestans form haustoria and require living plant tissue and necrotrophic phase in which infected tissue become necrotrophic. Haustoria are also implicated in the translocation of effector molecules from pathogen into host cells (Whisson et al., 2007; Rafiqi et al., 2012). Panwar et al. (2013) successfully demonstrated that the host generated small non-coding RNA molecules are translocated inside the fungus through the EHM using either nutrient transport or vesicle trafficking mechanisms, or other, yet undiscovered pathways. Haas et al. (2009) showed that 79 RXLR effectors up-regulated during the bio-trophic phase of infection (48-72 hpi). It was interesting to note that there is drastic reduction in Avr3a mRNA expression level at 48 h after inoculation up to 96 h after inoculation. Present data supports that amiRNA’s generated in the potato plant tissue significantly reduced the P. infestans Avr3a transcript level during the bio-trophic phase of infection in comparison to the non transformed control plants.
No effect on plant growth and development was also discernible for Avr3a silencing. The lack of resistance in some plants may involve other mechanisms, such as DNA methylation or formation of heterochromatin.
Phytophtora infestans biomass quantified in moderate resistant NptII lines by real time PCR. The P. infestans load infection in the host tissues quantified from 24 h after inoculation up to 144 h after inoculation. In this assay, quick and efficient simultaneous plant-pathogen DNA purification was done which was followed by qPCR in which biomass of pathogen was performed. The qPCR estimation allow the detection of genomic DNA in order of fg (fentogram) (Qu et al., 2008) and the Pi08 target is of high copy number (14000 copies per nucleus) (Judelson and Tooley, 2000). Analysis studies demonstrated that although the pathogen load increases with time but the amiRNAs generated in the moderately resistant lines showed that reduced transcript level of Avr3a in P. infestans as compared to the RNA recovered from the non-transformed control plants. This suggest that the time interval for kicking in of host induced gene silencing leading to reduction of Avr3a accumulation i.e., P. infestans load. amiRNA’s generated in the transgenic lines reduced the bio-trophic phase of infection, resulting in disease suppression in moderately silenced lines as compared to the non transformed plants. The amiRNA transgenic lines produced in this study have been maintained more than two years without losing the expression of amiRNAs and phenotypes, suggesting that amiRNAs transgenic lines are stable and remain active. Expression and biomass data analysis strongly emphasized that the RNAi technology can be successful, if generate multiple genes are generated in controlling P. infestans infection in potato plants.
All the four moderately silenced lines tested for southern were found positive for presence of NPTII gene. Two out of the three lines had single copy of transgene and one line had two copies of transgene. In present study, vector backbone pBI121 have selectable marker gene NPTII at left border, so the copy number of NPTII gene corresponds to the copy number of amiRNA silencing insert. In Agrobacterium tumefaciens mediated genetic transformation, transfer is initiated at right border and terminated at the left border (Rommens et al., 2005). The NPTII gene is present at the left border of the amiRNA binary vector cassette, so its presence can confirm the presence of pre-amiRNA backbone also.
Further, the partial silencing or moderate resistance in selected NptII positive lines are attributed to the fact that the genome of P. infestans contains strikingly rich and diverse population of transposons, all together making up 75% of the entire genome content. The genome comprised of conserved gene order blocks having relatively high gene density and low repeat content and is separated by region in which gene order is not conserved, having low gene density and high repeat content (Haas et al., 2009). Around 700 predicted effectors genes are interspersed among the transposons (Whisson et al., 2012). Further the formation of heterochromatin was reported to spread from the point of silenced loci upto 600 bp outward in P. infestans (Judelson and Tani, 2007). Effectors may be influenced by the gene silencing mechanisms that control the transposons in view of their close proximity to the mobile elements (Whisson et al., 2012).
The obtained results demonstrate the efficacy of amiRNAs expression in targeting a fungal gene through host delivered gene silencing approach. These results suggest that the amiRNAs represents a robust approach for the mining of effectors gene or virulence genes responsible for the late blight disease. Further, the need of research effort is to understand the interactions between different effectors protein, signal transduction pathways followed by the effector proteins for translocation into host cells and the contribution of RXLR effectors to disease pathogenesis. It also propose to address in future research the mining and stacking of other effectors gene on a single or multiple constructs and to study the influence of nearby transposons on the evolution and expression of effectors for providing durable resistance against late blight pathogen.
ACKNOWLEDGMENT
This study was supported by grants from the Indian Council of Agricultural Research (ICAR), New Delhi. We thank them for their financial support.