Abstract: Background and Objective: HIF-1α and EGFL7 are genes found in the placenta that play an important role in the regulation of trophoblast differentiation, hypoxia is glycolysis, red blood cell production and angiogenesis. Indonesia has antioxidant plants such as andaliman (Zanthoxylum acanthopodium) and haramonting (Rhodomyrtus tomentosa). This study aimed to analyze the role of EGFL7 and HIF-1α genes on human trophoblast after administration of these 2 herbs. Materials and Methods: This study used HTR8 trophoblast cells with 4 incubation times, namely 30 min 1, 3 and 16 hrs (overnight) with a total of 48 weeks and then observed the cells. Cells were cultured in RPMI1640, then RNA isolation was performed, mRNA was reverse transcribed and analyzed using RT-PCR. Results: Nanoherbal Zanthoxylum acanthopodium (NZA) to the EGFL7 gene, the longer the incubation time of human trophoblast cells, the less expression of the EGFL7 gene (p<0.05). On the other hand, in the administration of Nanoherbal Rhodomyrtus tomentose (NRT), the longer the incubation time of human trophoblast cells, the higher the expression of the EGFL7 gene. In the HIF-1α gene, only incubation time >16 hrs of human trophoblast cells treated with Nanoherbal Zanthoxylum acanthopodium (NZA) can reduce HIF-1α gene expression. However, the longer the incubation time of human trophoblast cells on the administration of Nanoherbal Rhodomyrtus tomentosa (NRT), the more the HIF-1α gene expression decreased (p<0.01). Conclusion: Rhodomyrtus tomentosa gave a more significant effect than Zanthoxylum acanthopodium.
INTRODUCTION
Hypoxia-induced Factor 1 alpha (HIF-1α) is a gene found in the body and placenta. This gene in the placenta plays an important role in the regulation of trophoblast differentiation and molecular pathways1. Over expression of this protein can lead to inflammatory disease, preeclampsia and high blood pressure1. Hypoxia induces nuclear translocation to form HIF and then binds to hypoxia response elements of related genes2. The target genes involved in hypoxia are glycolysis, red blood cell production and angiogenesis1,2. Low oxygen in trophoblast cells is an extrinsic factor for cell migration, invasion and proliferation2. The role of autophagy in hypoxic trophoblast has a role in placentation3. Autophagy can lead to poor placentation in some cases of placental problems such as hypertension or preeclampsia3. Epidermal Growth Factor-like domain 7 (EGFL7) is an endothelial-restricted gene in embryonic vascular development4. EGFL7 in the placenta is expressed on maternal and fetal vascular endothelium throughout placental development4. EGFL7 can regulate cell migration and trophoblast cell invasion by activating the MAPK, PI3K and NOTCH signalling pathways5. EGFL7 is also referred to as a soluble, extracellular matrix-bound gene in the developing embryo5. However, this gene is also found in embryonic stem cells, pre-and peri-implantation embryos and primordial germ cells5,6. EGFL7 is largely derived during late embryogenesis and in the endothelium and is upregulated during pathological and physiological angiogenesis, such as in utero6. EGFL7 is associated with HIF because it is regulated in response to hypoxia6.
Indonesia has a wealth of herbs because it is located in a tropical climate and is traversed by the equator. Some of the plants from Indonesia that have high antioxidants are andaliman (Zanthoxylum acanthopodium) and haramonting (Rhodomyrtus tomentosa). Both of these plants are often used by the public for traditional health medicine and anti-inflammatory properties7,8. Haramonting fruit extracts showed antioxidant activity9-11. In studies using rats placenta, andaliman and nano-sized haramonting can reduce MDA levels, increase HSP-70 and improve liver and placenta12-14. Molecularly, andaliman can inhibit apoptosis through cytochrome c and FasL in the placenta15 and affect the activity of Hes1 and notch1 genes in human trophoblasts16.
This study aimed to analyze the role of EGFL7 and HIF-1α genes after being given andaliman and haramonting in human trophoblasts. Thus providing information to us whether this herb is beneficial for the EGFL7 and HIF-1α genes that affect the embryo and placenta in pregnant women.
MATERIALS AND METHODS
Study area: The research project was conducted from April, 2019-2020. The research was carried out in the Physiology Laboratory, Department of Biology, Faculty of Mathematics and Natural Sciences, University of Sumatera Utara, Medan, Indonesia and the Department of Biomedicine and the prevention. Faculty of Medicines, University of Rome Tor Vergata, Rome, Italy.
Preparation of nanoherbal Zanthoxylum acanthopodium (NZA) and Rhodomyrtus tomentose (NRT): Andaliman (Zanthoxylum acanthopodium) and haramonting (Rhodomyrtus tomentosa) originate from a plantation in Berastagi, Kabanjahe, Sumatera Utara, Indonesia. Andaliman fruit and haramonting leaves are washed and then air-dried. Andaliman takes 3 weeks to dry while haramonting leaves only 7 days (1 week). The dried samples were sent to the Indonesian Institute of Sciences (LIPI, Jakarta) to be made into nanoherbs using High Energy Milling (HEM).
Study design: The cells used were HTR8 trophoblast cells as many as 300,000 cells/well. Because it uses 48 wells, the total cells needed are 144.106. This study used 4 incubation times, namely 30 min, 1, 3 and 16 hrs (overnight) with a total of 48 wells and then observed the cells. 24 wells for Nanoherbal Zanthoxylum acanthopodium (NZA) and another 24 wells for Nanoherbal Rhodomyrtus tomentosa (NRT). About 10 mg of nanoherbals andaliman and haramonting were dissolved in 1% DMSO then filtered using a 0.45 μm filter membrane and then stored at room temperature and can be used for treatment using HTR8 cells.
Cell culture: HTR8/SVneo EVT cells in the Department of Biomedicine and the prevent University of Rome Tor Vergata, Rome, Italy). The cell line used was HTR8-ATG4BC74A. HTR8/SVneo cells were cultured in RPMI1640 supplemented with 10% FBS, 100 U mL–1 penicillin and 100 g mL–1 streptomycin under a 5% CO2 atmosphere at 37°C16.
RNA isolation: RNA was derived from cell cultures that had been prepared using TRIZOL Reagent (Roche Diagnostics GmbH). HTR8 in 4 time zones namely 30 min, 1, 3 and 16 hrs (overnight)16. DNA contamination was removed by DNAse treatment. mRNA was reverse transcribed using random primers and the superscript first-strand synthesis system (Invitrogen). Gene expression was measured using Real Master Mix SYBR ROX (Eppendorf, Hamburg, Germany). Differences between gene expression were quantified using the Ct method with normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
RT-PCR: RNA was isolated using Trizol (Invitrogen) and reverse-transcribed using qScript cDNA Supermix (Quanta Biosciences). Gene expression was measured quantitatively using SYBR green (applied biosciences) and a specific primer set for-HIF-1α and EGFL7.
Differences between target expressions were quantified using the CT method with normalization to GADPH with the following primers:
| • | EGFL7 : 5’-CCACAAAAAAGAAGAAGGCTACCC-3’ |
| • | 5’-TCCAAGAAGGACCCTGCTCACTC-3’ |
| • | GAPDH: 5’-TCGGAGTCAACGGATTTGGT-3’ |
| • | 5’-GAATTTGCCATGGGTGGAAT-3 |
| • | 5’-GAATTTGCCATGGGTGGAAT-3 |
| • | HIF-1α : 5’ GCTCATCAGTTGCCACTTCC3’ |
| • | 5’ CGCTGRGTGTTTWGTTCTT3’ |
Data analysis: All gene analysis results were performed 3 times. Data were expressed as Mean±Standard error and analyzed using a one-way analysis of variance (ANOVA) test with sigmaplot application, (*p<0.05 and **p<0.001).
RESULTS
Administration of NZA and NRT on the morphology of human trophoblast cells: The administration of Nanoherbal andaliman (NZA) and haramonting (NRT) did not affect the life of human trophoblast cells. The number of viable, differentiated, active and proliferating cells in the control group (Fig.1a) was almost the same as that of human trophoblast cells when the nanoherbal andaliman (Fig.1b) and haramonting (Fig.1c) were administered. Based on the microscopic picture, it is known that these 2 herbs are not toxic and safe on human trophoblast cells.
EGFL7 expression on human trophoblasts by nanoherbal Zanthoxylum acanthopodium (NZA): Administration of Nanoherbal Zanthoxylum acanthopodium (NZA) at an incubation time of 30 min (Fig. 2a) to the EGFL7 gene showed a significant difference (p<0.05) in human trophoblast cells compared to the control group. When the incubation time became 1 hr (Fig. 2b), it was found that the expression of EGFL7 decreased significantly (p<0.05). The decrease in EGFL7 expression continued to occur at 3 hrs of incubation (Fig. 2c) and overnight (Fig. 2d). Based on this analysis, it is known that the longer the incubation time of human trophoblast cells with Nanoherbal Zanthoxylum acanthopodium (NZA) treatment, the lower the expression of the EGFL7 gene.
HIF-1α expression on human trophoblasts by nanoherbal Zanthoxylum acanthopodium (NZA): Administration of Nanoherbal Zanthoxylum acanthopodium (NZA) at 30 min incubation time (Fig. 3a) to the HIF-1α gene showed an increase (p<0.05) in human trophoblast cells compared to the untreated group. In the 1 hr incubation group (Fig. 3b), HIF-1α expression remained significantly increased (p<0.05). However, there was a decrease in HIF-1α expression at 3 hrs of incubation (Fig. 3c) although not significant (p>0.05) and a significant decrease in HIF-1α expression overnight (Fig. 3d) significantly (p<0.05).
| Fig. 1(a-c): | Human trophoblast cell proliferation, (a) Human trophoblast cells, without herbs (untreated) (b) Human trophoblast cells were given nanoherbal Zanthoxylum acanthopodium (NZA) and (c) Human trophoblast cells were treated with nanoherbal Rhodomyrtus tomentosa (NRT) |
| Fig. 2(a-d): | EGFL7 expression on human trophoblasts placenta after nanoherbal Zanthoxylum acanthopodium (NZA) administration, (a)Treatment on 30 min, (b) Treatment on 1 hr, (c) Treatment on 3 hrs and (d) Treatment on 16 hrs Untreated: Control, NZA: Nanoherbal Zanthoxylum acanthopodium (*p<0.05 versus untreated) |
| Fig. 3(a-d): | HIF-1α expression on human trophoblasts placenta after nanoherbal Zanthoxylum acanthopodium (NZA) administration, (a) Treatment on 30 min, (b) Treatment on 1 hr, (c) Treatment on 3 hrs and (d) Treatment on 16 hrs Untreated: Control, NZA: Nanoherbal Zanthoxylum acanthopodium (*p<0.05 versus untreated and nsp>0.05 vs. untreated) |
| Fig. 4(a-d): | EGFL7 expression on human trophoblasts placenta after nanoherbal Rhodomyrtus tomentosa (NRT) administration, (a) Treatment on 30 min, (b) Treatment on 1 hr, (c) Treatment on 3 hrs and (d) Treatment on 16 hrs Untreated: Control, NRT: Nanoherbal Rhodomyrtus tomentosa, (*p<0.05 versus untreated, **p<0.01 versus untreated and nsp>0.05 vs untreated) |
| Fig. 5(a-d): | HIF-1α expression on human trophoblasts placenta after nanoherbal Rhodomyrtus tomentosa (NRT) administration, (a) Treatment on 30 min, (b) Treatment on 1 hr, (c) Treatment on 3 hrs and (d) Treatment on 16 hrs Untreated: Control, NRT: Nanoherbal Rhodomyrtus tomentosa, (*p<0.05 versus untreated, **p<0.01 versus untreated and nsp>0.05 vs untreated) |
Based on this analysis, it is known that only incubation time >16 hrs of human trophoblast cells on NZA administration can reduce HIF-1α gene expression.
EGFL7 expression on human trophoblasts by nanoherbal Rhodomyrtus tomentose (NRT): The administration of Nanoherbal Rhodomyrtus tomentose (NRT) at an incubation time of 30 min (Fig. 4a) to the EGFL7 gene showed significant differences (p<0.05) in human trophoblast cells compared to the control group. In the 1 hr incubation group there was a decrease but not significantly (Fig. 4b), when the incubation time was increased to 3 hrs (Fig. 4c) there was a significant increase in EGFL7 expression (p<0.05). The increase in EGFL7 expression continued to occur at 16 hrs incubation time (Fig. 4d) with p<0.01). Based on this analysis, it is known that the longer the incubation time of human trophoblast cells on NRT administration, the higher the expression of the EGFL7 gene.
HIF-1α expression on human trophoblasts by nanoherbal Rhodomyrtus tomentose (NRT): Administration of Nanoherbal Rhodomyrtus tomentosa (NRT) at 30 min incubation time (Fig. 5a) to the HIF-1α gene showed non-significant differences (p>0.05) in human trophoblast cells compared to the untreated group. In the group with an incubation time of 1 hr (Fig. 5b), HIF-1α expression decreased significantly (p<0.05). The decrease in HIF-1α expression continued to occur at the incubation time of 3 hrs (Fig. 5c) significantly (p<0.05). The longest incubation (overnight) showed a significant difference (Fig. 5d) with p<0.05). Based on this analysis, it is known that the longer the incubation time of human trophoblast cells on NRT administration, the more the HIF-1α gene expression decreases.
DISCUSSION
Based on the microscopic, it is known that these 2 herbs are not toxic and may affect genes expression in pregnancy. The administration of Nanoherbal andaliman (NZA) and Nanoherbal haramonting (NRT) are safe for human trophoblast cells. The trophoblast is very important for placental perfusion in maintaining fetal growth16,17. Failure of interstitial and endovascular trophoblast invasion may result in inadequate spiral artery transformation, resulting in preeclampsia or fetal growth restriction17. So both of these herbs are still relatively safe in pregnancy.
In the administration of Nanoherbal Zanthoxylum acanthopodium (NZA) to the EGFL7 gene, the longer the incubation time of human trophoblast cells, the less expression of the EGFL7 gene. On the other hand, the longer the incubation time of human trophoblast cells in the administration of Nanoherbal Rhodomyrtus tomentose (NRT), the higher the expression of the EGFL7 gene. Rhodomyrtus tomentose gave a more significant effect than Zanthoxylum acanthopodium. Flavonoids, steroids, glycosides, saponins and tannins are among the ingredients found in NRT. Furthermore, NRT has emulsion properties that meet drug requirements as well as strong antioxidant activity. The LC50 and LD50 values in the toxicity test were 2961.535 ppm and 10.4 0.135 mg kg–1 b.wt., respectively. The Zanthoxylum family has quite a lot of steroid compounds. The danger of excessive steroids on cells can cause fat accumulation and hypertension18.
In the HIF-1α gene, only incubation time >16 hrs of human trophoblast cells treated with Nanoherbal Zanthoxylum acanthopodium (NZA) can reduce HIF-1α gene expression. However, the longer the incubation time of human trophoblast cells on the administration of Nanoherbal Rhodomyrtus tomentose (NRT), the more the HIF-1α gene expression decreased. Incubation time also affects gene expression because cells also need time and adapt to the environment or medium. HIF-1α is sensitive to oxygen because it acts as a regulator of cellular transcription at low oxygen levels. Increased levels and activity of these genes are associated with cell state and inhibition of trophoblast differentiation19. The loss of the HIF-1α gene is also detrimental in placental development, so it is known that inappropriate HIF-1α stabilization can result in prolonged HIF-1α activity that can adversely affect trophoblast differentiation and ultimately can lead to placental abnormalities20. Rhodomyrtus tomentose can significantly reduce HIF-1α because this plant has higher antioxidants than Zanthoxylum acanthopodium10,11. The Zanthoxylum family has quite a lot of steroid compounds. The danger of excessive steroids on cells can cause fat accumulation and hypertension18. Based on this analysis, it was found that NRT was better in the expression of HIF-1α and EGL7 genes in human trophoblasts than NZA.
The implications of this study include the examination of the EGFL7 and HIF-1α genes in the human placental trophoblast, which is required in drug discovery pregnancy. The nano herbs andaliman and haramonting should be studied further to the expression of other target genes. Placental markers undergo hypoxia, proliferation, organogenesis and placental development because signalling genes EGFL7 and HIF-1α are important in the process of linking maternal and fetal cells.
CONCLUSION
Rhodomyrtus tomentose gave a more significant effect than Zanthoxylum acanthopodium because Rhodomyrtus tomentose has emulsion characteristics that meet drug requirements and strong antioxidant activity than Zanthoxylum acanthopodium. This was evidenced by a significant difference (p<0.01) in the expression of HIF and EGFL7 genes on human trophoblast cells.
SIGNIFICANCE STATEMENT
This study discovers that Rhodomyrtus tomentosa (haramonting) fruits can as herbal for placental problem therapy molecularly. This study will help the researcher to uncover the role of Rhodomyrtus tomentosa in molecular signalling of other target genes for drug development in hypertension. Thus, a new theory on the role of andaliman and haramonting in the HIF and EGFL7 pathways expression in human trophoblast may be arrived at.