Abstract: Background and Objective: Soy yogurt is fermented soy milk and its nutrient-rich with isoflavones. Soy yogurt decreases blood glucose levels by utilizing the conversion of isoflavones. This study aimed to analyze the effect of soy yogurt on blood glucose level and Glut4 gene expression on rats' soleus muscle. Materials and Methods: Twenty-five rats (eighteen-weeks old) were divided into 5 groups, e.g., the control (P0), positive control (P1, 100% yogurt) and three treatment groups (P2, 50% soy yogurt+50% yogurt; P3, 75% yogurt+25% soy yogurt and P4, 75% soy yogurt+25% yogurt). All treatment groups were treated with different soy yogurt formula and administered for 12 weeks by gavaging. Under anesthetized, rats were sacrificed, then blood samples and soleus muscle were collected and stored at -80°C until use. RNA was extracted from soleus muscle and run for Glut4 mRNA expression using (RT)-PCR. Data were analyzed using one way ANOVA and followed by post hoc test LSD (Least Significant Differences test). Results: There is no difference in rat body weight among groups after 12 weeks of soy yogurt consumption. Blood glucose levels were decreased at least 25% lower level compared to the control baseline by the various formulation of soy yogurt. Interestingly, there is a distinct pattern of Glut4 mRNA expression level in the soleus muscle, P1 increased the expression but not with other formulations decreased the expression (P2, P3 and P4). Conclusion: Taken together, a different formulation of soymilk and cowmilk effectively reduces blood glucose level and modulates Glut4 mRNA expression. In addition, a specific combination of bacteria type for fermenting soy yogurt could be a key to effectiveness for modulating blood glucose levels.
INTRODUCTION
Soybean (Glycine max) is a type of leguminous plant which has an important antioxidant namely isoflavones (genistein, daidzein and glycitein), phytic acid and saponins1. Soybeans also contain carbohydrates, phytochemicals, saponins, phytic acid and fiber. Thus, soy protein in diet might give many proven health benefits1,2.
Soy protein or isoflavones can improve glycemic control that can increase insulin sensitivity and reduce the risk of diabetes1. Soy milk is a good source of protein. Soy milk and cow milk can be fermented to produce sour soy milk (soy yogurt and yogurt). Fermentation conditions will influence bioactive peptides formation. In fermented processed products, the bioactive peptides formed depend on the type of bacteria present in the starter culture and the degree of hydrolysis (fermentation time) has happened. An adequate proteolysis process is needed to facilitate the extrication of bioactive peptides from protein, in the excessive proteolysis process that will decrease its activity3. Fermentation is one of the efforts carried out and has been proven to increase nutritional value and improve soy milk acceptability. In addition, soy yogurt also has some benefits needed by the lactic acid bacteria fermentation process which decrease in glucose level in the bloodstream, prevent cancer, balance the digestive system and overcome fungal and bacterial infections1,3.
Streptococcus, Lactobacillus and Bifidobacterium are often used as a starter for making yogurt or soy yogurt. Fermentation will change in the content of various isoflavones and β-glucosidase activity in soy milk or cow milk. It had reported formulation bacteria is important for determining the content of fermented milk. Streptococcus thermophilus as a starter had shown that it resulted a higher content of aglycone and increased beta-glucosidase activity. The quantity isoflavone content increases, this can be observed in the percentage of daidzein from 14.24 to 36.20, genistein from 6.89 to 28.80 and glycitein 2.45 to 12.44, this takes place after 24 hours of fermentation4. In during the fermentation process, the highest β-glucosidase activity and bioconversion of isoflavones after 12 hours is occurred in L. rhamnosus, this is influenced by an increase in the content of isoflavone aglycones in fermented soy milk which improve the biological function of soy milk5.
Glut4 plays a role in glucose homeostasis, studies in mice with one allele of Glut4 gene is altered has 50% reduction in Glut4 expression in skeletal muscle, heart and fat cells. It caused mice to suffer severe insulin resistance and developing diabetes6,7. In normal muscle and fat cells, Glut4 is recycled between the membrane of plasma and intracellular storage vesicles. Glut4 differs from other glucose transporters, which is about 90% located in the intracellular when the condition is not stimulating insulin or other stimuli such as exercise. In the presence of insulin or other stimuli, the balance of this recycling process is changed to support translocation of Glut4 from intracellular storage vesicles towards the membrane of plasma and also to transverse tubules in muscle cells so that an increase in the maximum speed of glucose transport into cells8.
Insulin acts on the target cells by activating tyrosine kinase. Autophosphorylation of tyrosine kinase insulin receptors stimulates the catalytic activity of tyrosine kinase receptors that produce tyrosine phosphorylation from Insulin Receptor Substrates (IRSs) including IRS1, IRS2, IRS3, IRS4, Gab1 and Shc. This bond then activates the enzyme phosphatidylinositol 3 kinase (PI3K). PI3K phosphorylates specific phosphoinositides to form PIP2 into PIP3. PIP3 then activates serine/threonine kinase, phosphoinositide-dependent kinase-1 (PDK1). Activation of PDK1 causes activation of Akt / protein kinase B (PKB) and protein kinases C λ and ζ (PKCλ /ζ). The signal transduction activator activates the phosphorylation of its substrate, AS160 that stimulates Glut4 translocation (an insulin-dependent glucose-carrying protein) from the intracellular vesicle exocytosis to the cell surface so that glucose can enter the cell9,10. The intracellular translocation of Glut4 into the membrane of plasma is stimulated by expression of the active form of protein kinase B or atypical isoform PKC in cell culture experiments. Both of these kinases are chemical mediators in the process of insulin stimulating Glut4 translocation in vivo. Good atypical PKC isoforms have been shown that blocking their work will weaken Glut4 movement, whereas studies of activation of blocked PKB have conflicting results. Furthermore, in muscle cells of diabetic subjects, at concentrations of ecological insulin, glucose transport stimulation has been shown to be impaired, whereas activation of PKB is normal6,7.
Skeletal muscle is the main organ that utilizes glucose stimulated by insulin and converts it into energy so that the body has the energy to produce movement and do activities. Skeletal muscle is the main network that contributes to systemic glucose depletion in post-prandial conditions to maintain normal glycemia. Insulin has a rapid effect to induce glucose uptake and glycogen synthesis in protein-independent synthesis mechanisms. During hypoxia-related muscle contractions, the level of glycogenolysis and glucose uptake increases to prepare glucose needed for glycolytic process10. Muscle glucose absorption is well adjusted to ensure glucose homeostasis and for the needs of the energy muscles that are needed quickly, but continuously8,10. Glut4 and Glut1 are expressed in skeletal muscle and modulated on the development stage and fiber types composition. Glut4 is expressed in oxidative and glycolytic muscle fibers differentially in mice. During fetal life in mice, the dominant glucose carrier Glut1, with marked expression suppressed perinatally, as a consequence of changes that occur in the pre-transaction stage. In contrast, expression of skeletal muscle Glut4 in fetal mice is very low will induce continuous Glut4 mRNA and protein occurs in the perinatal phase6,7. Glut4 is in an insulin-responsive vesicle, insulin stimulation will move these vesicles toward the cell surface and then insert Glut4 to move into the plasma membrane, to absorb glucose. In the present study, we analyze the effect of different soy yogurt formulation on blood glucose level and its correlation with Glut4 mRNA expression in rat soleus muscle.
MATERIALS AND METHODS
The present study was carried out as a collaborative research work between the Faculty of Animal Husbandry and Faculty of Medicine, Universitas Padjadjaran in the period of July 2017 until June 2018.
Animal: Twenty five Wistar rats, 18 weeks old, female, were bred in the Animal Facility of PT. Bio Farma, Indonesia. Rats were kept at 24°C under a 12 hrs light, 12 hrs dark cycle (light on, 6 am to 6 pm) and 55% relative humidity, with food and water ad libitum for 80 weeks in Animal Physiology Laboratory, Physiology Division, Faculty of Medicine, Universitas Padjadjaran. Rats were divided randomly into five groups treatment. Control group which was not given the treatment as the control group (P0), Group-1 was given treatment by 100 % yogurt (P1), Group-2 was given treatment by 50% soy yogurt and 50% yogurt (P2), Group-2 was given treatment by 75% yogurt and 25% soy yogurt (P3) and Group-2 was given treatment by 75% soy yogurt dan 25% yogurt (P4). All rats were habituated for 7 days prior to treatments. Soy yogurt or yogurt was administered by gavaging, 2 mL/day/rats for 12 weeks. Rats were sacrificed using the CO2 chamber, blood samples were collected via cardiac puncture and soleus muscle were dissected, weighed and dipped frozen in liquid nitrogen. Soleus muscle was stored in the freezer at -80°C until use.
Materials: Formulation of soy yogurt and yogurt were produced with specific bacteria formula fermentation (Supplemental Table 1) according to the procedure published. Milk fermentation was performed at the Faculty of Animal Husbandry, Universitas Padjadjaran, Jatinangor, Indonesia11.
Blood Glucose level: Five micromillimeter blood sample was utilized for determining blood glucose levels after 12 weeks of treatment using Rat Glucose Assay Kit (Crystal Chem, Cat. number: 81693, USA). All procedure followed manufactured protocols.
Semi-quantitative Reverse Transcript (RT) PCR: RNA of soleus muscle was isolated using Trizol reagent from Invitrogen, USA and procedures was performed according to the manufacturer’s instructions. Equal amount of 50 ng RNA was amplified using Onestep PCR kit (Bioline, USA)12. Specific Glut4 primers were designed with Forward: 5'GGGCTGTGAGTGAGTGCTTTC-3', Reverse 5'CAGCGAGGCAAGGCTAGA-3' and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as internal control of gene expression, GAPDH primer sequences as followed: Forward 5'GTTACCAGGGCTGCCTTCTC-3', Reverse 5'GATGGTGATGGGTTTCCCGT3'). Glut4 expression results for each sample were normalized with Gapdh mRNA levels for integrity of the results. Equal of PCR Products was run into agarose 1,2 % gel in TAE buffer and Image was captured for density analysis using Image J software.
| Supplemental Table 1 | Composition of probiotics used in the study |
Statistical analysis: Data were analyzed with One-Way Analyze of Variance (ANOVA) and followed by LSD post hoc test by using SPSS 20.0. Statistical significance was designated at p<0.05. Data are expressed as mean±standard of deviation (SD).
RESULTS AND DISCUSSION
Difference soy yogurt formulation effects on weight changes: Fermented milk, yogurt and soy yogurt are believed as a health drink. Potential mechanisms of action of yogurt include an increase in body fat loss, a decrease in food intake and increase in satiety, a decrease in glycemic and insulin response, altered gut hormone response, replacement of less healthy foods and altered gut microbiota13. Surprisingly, different formulation fermented soy and cow milk combination did not induce a significant change in Rat’s body weight after 12 weeks of treatment (Fig. 1).
Different soy yogurt formulation reduces on blood glucose level: Different soy yogurt formulation decreased blood glucose level baseline level Treatment groups reduced the average baseline of blood glucose level around 25% compared to control group (Fig. 2). Group P2 showed the lowest blood glucose compared to another group, it reflected the specific formulation of percentage cow and soy milk with bacteria combination plays an important role in reducing blood glucose levels. Details comparison average mean of blood glucose level between experimental groups was statistically tested and presented in Table 1.
Alteration of glucose levels after treatment with a different formulation of soy yogurt might be determined by specific protein resulted from the fermentation process. Beside protein composition like isoflavones also may take some role. The isoflavones play as important compounds in soy yogurt by inhibiting the enzyme α-glucosidase which plays a role in the entry of glucose into the intestinal lumen and this potentially reduced blood glucose levels in the bloodstream. Isoflavones bind to the active binding site of glucose in the α-glucosidase enzyme so that the enzyme was unable to digest the substrate. In vitro studies show that pure isoflavones (genistein, daidzein) had inhibitory activity against the α-glucosidase enzyme4,14. Isoflavone glycosides, genistein, daidzin and glicitin also released the sugar portion and are converted into isoflavone aglycones, genistein, daidzein and glycitein by protease15,16. In addition, after the fermentation process, many organic compounds were broken down into smaller molecules by microbial enzymes and then exert various physiological effects.
| Fig. 1: | Different bacteria composition and soy/cow milk formulation in fermentation does not change Rat’s body weight. Data is presented as average with standard of deviation (SD). White bar represents control group and black bars represent treatment group (P1, P2, P3 and P4), *Significant was considered with p<0.05) |
| Fig. 2: | Different bacteria composition and soy/cow milk formulation in fermentation decreases blood glucose level after 12 weeks treatment. Data is presented as average with standard of deviation (SD). White bar represents control group, and black bars represent treatment group (P1, P2, P3 and P4), *Significant was considered with p<0.05) |
| Table 1: | Comparison average mean of blood glucose level between experimental groups |
*p-value <0.05 is considered as significant, Post hoc test is utilized the LSD test | |
| Fig. 3: | Different bacteria composition and soy/cow milk formulation in fermentation (P2, P3 and P4) decreases Glut4 mRNA expression in soleus muscle after 12 weeks treatment. Data is presented as average with standard of deviation (SD). White bar represents control group, and black bars represent treatment group (P1, P2, P3, and P4), *Significant was considered with p<0.05) |
| Table 2: | Significant and Comparison of average Glut4 mRNA levels between treatments |
Value p = value of significance/significance; *: Post hoc test further with the LSD test, Significance value p<0.05 | |
Therefore, we explore a different combination of bacteria for fermented soymilk. Type of microorganisms enhances biofunctional properties by increasing the level of aglycone isoflavones and peptides3,14. Lactic acid bacteria in soy yogurt would produce a compound that will fight pathogenic microbial infections in the body, such as infections due to the fungus Candida albicans and the bacterium Helicobacter pylori. This compound was a compound with low molecular weight either in the form of proteins or short peptides that have the activity of inhibiting or killing microbes (antimicrobial)2,3,17. Thus, it had supported and convinced our finding that different formulation of soy yogurt could decrease by 25% rats' blood glucose level after 12 weeks of administration (Fig. 2).
Difference soy yogurt formulation effects on Glut4 gene expression in soleus muscle: Our data showed a potential link that decrease of blood glucose might directly or indirectly correlated with the role of Glut4. Glut4 is very closely related to glucose metabolism and involved in insulin. Glut4 expression is regulated in human red skeletal muscle cells that express excessive glycogen phosphorylase. It was regulated in a state of relative insulin deficiency, such as fasting. Glut4 is not down-regulated by fasting in white skeletal muscle, insulin levels were sufficient to directly regulate the expression of this transporter only under certain cellular conditions. Glut4 had an important role in regulating the transport of glucose-stimulated by insulin. In addition, Glut4 is very influential in insulin-resistant conditions18.
Zucker diabetic rats (ZDF/drt) and diabetic SHR/N-cp rats. ZDF/drt rats have reduced Glut4 protein levels in adipose tissue. In addition, both ZDF/drt and SHR/N-cp rats have reduced levels of Glut4 in skeletal muscle. In ZDF/drt rats, the Glut4 protein was reduced to a greater extent in skeletal muscle enriched with red glycolytic fibers compared to skeletal muscle enriched with white oxidative fibers19. The experimental model that was widely used in insulinopenic diabetes, was streptozotocin-induced diabetic rats. This model showed intact insulin resistance of the body and reduces the expression of Glut4 protein in skeletal and cardiac muscles.
Interestingly, the difference of soy yogurt formulation alters differently Glut4 mRNA expression level in the soleus muscle. All group treatment group beside P1, (P2, P3 and P4) decreased small but significant the Glut4 gene expression level in the soleus muscle (Fig. 3). Glut4 mRNA expression of soy yogurt treatment P2, P3 and P4 were lowered by 15-18% compare to control whereas P1 showed that there is no changes after treatment for 12 weeks. Significant comparison each group was presented in Table 2. There are several factors which might explain the different effect of soy yogurt formulation on Glut4 mRNA expression. First of all, this effect need to be studied further since in our study only soleus muscle had been explored, it seem that muscle fiber type could give a specific response. Secondly, fermented protein type as result from different bacteria formulation (Supplemental Table 1) or milk based will altered and partially affect the blood glucose regulation without involving Glut4 regulation. It had been reported that the effect of diabetes was depend on the type of skeletal muscle fiber and RNA expression level could be not pararel with its protein levels due to post transcription modification. In contrast, Glut4 protein was reduced in white skeletal muscle fiber, along with an increase in unchanged Glut4 mRNA levels and Glut4 transcription. Therefore, role of insulin as a potential regulatory factor would determine the expression of Glut418,19. Thirdly, the posttranscriptional process of modification will determine Glut4 mRNA expression in the soleus muscle, therefore the mRNA expression could be different and contrast with the protein level pattern. Our limitation is information about Glut4 protein level after treatment 12 weeks. Molecular regulation provided cell control over structure and function and the basis for cell differentiation, morphogenesis and the versatility and adaptability of each organism. It could be function as a substrate for evolutionary change, because control of the time, location and amount of gene expression could have a profound effect on the function of genes in cells or in multicellular organisms19,20. The activity of transcription factors was further modulated by intracellular signals that cause post-translational protein modification including phosphorylation, acetylation, or glycosylation and those changes will affect the ability of transcription factors to bind, directly or indirectly to the promoter DNA, to recruit RNA polymerases, or to support the extension of newly synthesized RNA molecules. There was a significant effect of the specific effects of non-DNA sequences on transcription18. This effect was referred to as epigenetic and involves high-order structure of DNA, specific non-sequence DNA binding proteins and chemical modification of DNA. In general, the epigenetic effect of changing the accessibility of DNA was into proteins thus modulating transcription7.
However, we did not explore the type of proteins and metabolites after combination soy and cow milk fermented. In addition, we were not able to count the glycogen content in the liver and muscle for confirming glucose utilization and involvement of the glucose signaling pathway. Further, these data will clarify the role of fermented milk in regulating blood glucose levels and its detailed molecular mechanism.
CONCLUSION
Different combinations of bacteria and percentage formulation of cow milk and soy milk reduce blood glucose level and modulate Glut4 expression in soleus muscle. Percent combination Soy and cow milk and combinations of bacteria for the fermentation process might be an important factor for modulating blood glucose levels.
SIGNIFICANCE STATEMENT
This study discovers the potential importance of percentage combination soy/cow milk and bacteria composition during the fermentation process for modulating blood glucose levels. It showed that 12-week treatment could modulate blood glucose baseline and Glut4 expression. In addition, it is important to understand specific bacteria combinations for the fermentation of soy or cow milk. Our data support the potential of fermented soymilk and cowmilk’s consumption might be very beneficial for health purposes.
ACKNOWLEDGMENT
This work was supported by PDUPT from Indonesian Ministry Research, Technology and Higher Education Grant No: 1827/UN6.3.1/LT/2020 to Ronny Lesmana (2020) and Academic Leadership Grant 2020 to Lovita Adriani (2020).