Abstract: Among some Bacillus species, a protein highly homologous to HU, classified HB and coded by hbs gene. According to the recent studies, the sequence of hbs gene just in one strain of Bacillus subtilis exists in gene bank (ATCC 23857). In this study, DNA from Bacillus subtilis ATCC 6633 was extracted and investigated by PCR. The PCR product was sequenced and shown to differ in just one nucleotide from B. subtilis ATCC 23857. Hence, it was chosen as reference and for the first time, used for non-radioactive labeled probe preparation. The PCR product in Bacillus subtilis with ATCC 6633 was labeled using non-radioactive DIG-labeled nucleotides and conditions of probe preparation and hybridization were optimized and checked it by Southern blotting.
INTRODUCTION
Histone-Like Proteins (HLPs) in bacteria are small, basic proteins that contribute to the control of gene expression, recombination, DNA replication and compression of the bacterial DNA in the nucleoid (Swinger and Rice, 2007). Among the HLPs, HU family proteins are widespread in prokaryotes and members of the family have at least 20% amino acid sequence identity (Dixon-Fly and Caro, 1999). Several proteins with properties and structures highly homologous to HU proteins have been isolated from other bacteria and bacteriophages. It seems that HU protein sequence on various strains of one species could be different. One of the best- studied histone like protein is HU of Escherichia coli (Ussery et al., 2001). The HU family has three classes, but the distribution is not uniform in Gram-negative and Gram-positive bacteria. Furthermore, whereas HU proteins from enterobacteria are predominantly heterotypic dimers, the HU proteins isolated to date from gram-positive bacteria are all homotypic dimers (Oberto et al., 1994; Yokohama et al., 1997). Among the HB proteins of different Bacillus species so far sequenced, conservation is more than 80% (Wolfgang and Marahiel, 2002).
Bacillus subtilis harbors only one histone-like protein, Hbsu, encoded by the essential hbs gene (Micka et al., 1991; Micka and Marahiel, 1992; Schmid, 1990). The HBsu protein shows homology to HU protein from E. coli and it has 57 and 52% identical amino acid residues with HU-2 and HU-1, respectively. Like HU, HBsu unspecifically binds to DNA. In contrast to HU, which forms predominantly heterodimers, HBsu binds DNA as a homodimer (Wolfgang and Marahiel, 2002).
The Hbsu is bound to SRP that is a long piece of RNA to which an additional protein (Yamane et al., 2004). Studies have determined the levels of HBsu in the spore, its localization in the forespore and explored the ability of HBsu to modulate the effects of a/b-type Small Acid-Soluble Proteins (SASP) on the DNase digestion, persistence length, supercoiling and UV photochemistry of DNA in vitro (Ross and Setlow, 2000). HBsu of the mesophilic B. subtilis and Bacillus stearothermophilus HU (BstHU) display 87% identity and 94% similarity together and so a nearly identical 3D-structure for both can be assumed (Wolfgang and Marahiel, 2002).
In this study, for the detection of hbs gene in some Bacillus subtilis strains, this gene was analyzed in Bacillus subtilis ATCC 6633 by PCR and this strain was chosen as reference. Whereas DIG-labeled probes maintain the detection sensitivity and furthermore, non-radioactive probe labeling and detection technology do not involve hazardous substances, the labeled probes are stable, can be stored for a long period and reused several times. For the first time, it was used for non-radioactive labeled probe preparation and the PCR product was labeled using of a non-radioactive DIG-labeled nucleotide following it which was used for the detection of hbs gene in this strain (ATCC 6633) by Southern Blotting.
MATERIALS AND METHODS
This project has been conducted at Alzahra University since the middle of 2008.
Bacterial strain and media: Bacillus subtilis ATCC 6633 was grown on nutrient agar at 28°C for 24 h.
Nucleic acid preparation: Genomic DNA from Bacillus subtilis ATCC 6633 was extracted using DNPTM kit solution (Fermentas). Bacterial culture was centrifuged for 10 min at 7500 g and resuspended in 100 μL of protease buffer. It was then placed at 95°C for 10 min (before this step lysis solution pre-warmed by placing in 37°C for 20 min and gentle shaking). One hundred microliters of sample was mixed with 400 μL of lysis solution and vortexed for 15-20 sec. The sample should be completely homogenized at this step. Then 300 μL of precipitation solution was added and gently mixed by ten times inversion and placed in -20°C for 20 min, then centrifuged at 12,000 g for 10 min. After this step, the supernatant was decanted by gently inverting the tube and then placed on tissue paper for 2-3 sec. Subsequently, 1 mL washing buffer was added to pellet, gently mixed by inverting ten times and centrifuged at 12,000 g for 5 min, then decanted. The washing buffer was completely poured off and pellet dried at 65°C for 5 min. Then, the pellet was suspended in 50 μL of solvent buffer by gentle shaking and placing at 65°C for 5 min. In the final step, undissolved material was precipitated by 30 sec centrifuging at 12,000 g. Supernatant contains purified DNA.
Primers and PCR conditions: PCR reactions were carried out using forward primer (CGCGGATCCATGAAC AAAACAGAACTTATC) and reverse primer (TCCCCCGGGGTTTTCCGGCAACTGCGT) (Kohler and Marahiel, 1997) to amplify the hbs gene encoding HBsu protein in B. subtilis. PCR was carried out in a 50 μL volume containing 0.01 μg μL-1 template DNA, 0.5 μM of each primer, 5 μL of 10x Taq Polymerase buffer, 2 mM of MgCl2, 0.2 mM of each dNTP, 0.5 μL of Taq DNA polymerase and 31 μL of autoclaved distilled water. Amplifications were performed in a thermal cycler and initiated with a primary denaturation step at 93°C for 3 min, followed by 35 cycles of 93°C for 45 sec, 70°C for 30 sec and 72°C for 1.30 min. PCR products were analyzed by electrophoresis in 2% agarose gel and visualized by ethidium bromide staining. The product of amplification was a DNA fragment 290 bp in length and fragment sequencing was carried out from both ends using the same primer pair.
Probe preparation: Probe was labeled with DIG-11-dUTP (Roche, Manneheim, Germany) by PCR according to the manufacturer’s instruction. For a standard PCR setting, the following nucleotide concentrations were used: 10 μM DIG-11-dUTP (Roch, Manneheim, Germany), 190 μM dTTP and 200 μM of each dATP, dGTP, dCTP. This concentration of labeled nucleotides allows the highly sensitive detection of PCR products after gel electrophoresis and Southern blotting.
To determine the probe yield, dilution series of labeled probe were spotted on a positively charged nylon membranes (Roche, Manneheim, Germany) and directly detected with DIG nucleic acid detection kit (Roche, Manneheim, Germany), using enzyme immunoassay and enzyme-catalyzed color reaction with NBT/BCIP.
Southern blot analysis: For Southern blot analysis, 0.5 μg μL-1 of genomic DNA from B. subtilis ATCC 6633 digested with EcoRI enzyme in a 20 μL reaction containing of buffer for 1 h at 37°C. The digested DNA was size-fractionated on 0.8% agarose gel containing ethidium bromide.
Upward capillary transfer of the DNA was performed over night onto positively charged nylon membranes using 0.4 N, followed by UV cross- linking.
The membrane was placed in a hybridization bag containing 20 mL prehybridization solution with 5xSSC, 0.1% (w/v) N-lauryl-sarcosine, 0.02 (w/v) SDS, 2% blocking reagent per 100 cm2 of membrane surface area. The bag was sealed and prehybridized at the hybridization temperature, 68°C, for 1 h, then double-stranded DNA probes, heated in a boiling water bath for 10 min to denature the DNA, was chilled directly on ice. The probe was diluted in hybridization solution and at least 3.5 mL hybridization solution for a blot of 10x10 cm. The prehybridization solution was discarded from the bag and the hybridization solution containing the DIG-labeled probe was added. The probe was allowed to hybridize at 68°C over night. At the end of the hybridization, the hybridization solution was poured from the bag.
Detection of labeled probe: The membranes were washed for 2 min and blocked for 30 min using the DIG wash and block buffer set (Roche, Manneheim, Germany), followed by a new incubation for 30 min in blocking solution containing 0.075 U mL-1 Anti-Digoxigenin-Ab Fab fragments (Roche, Manneheim, Germany). Subsequently, the membranes were washed for 2x15 min in washing buffer and soaked in detection buffer for 3 min. Finally, the membrane was incubated in 10 mL freshly prepared color substrate solution in appropriate container in the dark for color development.
RESULTS AND DISCUSSION
The Hbs gene of the B. subtilis ATCC 6633 was successfully amplified and a single PCR product of the desired length, approximately 290 base pairs, was produced (Fig. 1).
Nucleotide sequence of the hbs gene was aligned with this gene in B. subtilis ATCC 23857 in the Gene bank and shown highconservation among the strains. In B. subtilis ATCC 6633, one nucleotide differs which does not bring about change in the codon (Fig. 2).
So, the PCR product was labeled using non-radioactive DIG-labeled nucleotide. The labeling of the PCR probes was analyzed through gel electrophoresis (Fig. 3).
For the selection of the specific yield of the labeling probe, dilution series of labeled PCR products was prepared and compared with DIG-labeled control DNA by DIG nucleic acid detection kit (Roche, Mannheim, Germany) by dot blotting (Fig. 4).
To verify the quality of the successfully amplified PCR probe (a 241 bp fragment of the chromosomal hbs gene), the labeled probe was hybridized to a chromosomal DNA blot and detected under conditions as indicated in materials and methods. Chromosomal DNA that had been cleaved with the restriction enzyme EcoRI revealed in the corresponding Southern blot the presence of one major band in each digest (Fig. 5). The probe recognized one band of about 5.4 kb in the EcoRI digests. This suggested the presence hbs gene within one these fragment.
More than 30 members of the family of histone-like proteins, all with a size of about 90 amino acids and an overall basic net charge, have been identified (Oberto et al., 1994). One of them is HU family. Several proteins with properties and structures highly homologous to those of HU protein have been isolated from bacteria and bacteriophages but it seems that HU protein sequence of various strains of one species could be different. Among some Bacillus species (B. caldolyticus, B. globigii, B. stearothermophilus and B. subtilis), a protein highly homologous to HU, classified HB, has been isolated and characterized (Wolfgang and Marahiel, 2002). Among the HB proteins of different Bacillus species so far sequenced, conservation is more than 80% (Kamaua et al., 2005). Bacillus subtilis genome encodes one HB protein by hbs gene that is called Hbsu (Kunst et al., 1997).
| Fig. 1: | Identification of the hbs gene of B. subtilis strains on 2% agarose gel. Lane 1: hbs gene, Lane 2: DNA size marker (100-3000 bp) |
| Fig. 2: | Alignment of the nucleotide sequences of the hbs gene from the B. subtilis ATCC 6633 with B. subtilis ATCC 23857 as reference |
| Fig. 3: | Labeling of the PCR probes, Lane M: DNA size marker (100-3000 bp), Lane 1: Unlabeled PCR products, Lane 2: Labeled PCR products |
| Fig. 4: | Dot blot direct detection for quantification of labeled probes and compared with DIG-labeled control DNA. Lane 1: Serial dilutions of DIG-labeled control DNA, Lane 2: Serial dilutions of the labeled PCR product |
Detection of the hbs gene has been done before using a radioactive probe (Micka et al., 1991), but in this study, detection of the hbs gene was done using a specific non-radioactive method for probe labeling in B. subtilis strain. Thus, DNA from B. subtilis ATCC 6633 was extracted and hbs gene was successfully amplified. A single PCR product of the length approximately 290 bp was produced. Then, PCR product was sequenced and shown to differ in just one nucleotide from B. subtilis ATCC 23857.
| Fig. 5: | Identification of the hbs gene of B. subtilis. (A) Lane M: DNA size marker (100-10000 bp), lane 1: Restriction analysis of genomic DNA isolated from B. subtilis ATCC 6633. Chromosomal DNA has been digested with the restriction enzyme EcoRI. The cleaved products were separated and visualized on a 0.8% agarose gel. (B) lane 2: Southern blot analysis revealed one major band after digestion by EcoRI restriction enzyme and hybridization with the PCR probe. The probe recognized one fragment at about 5.4 kb that has hbs gene |
The PCR product from B. subtilis ATCC 6633 was labeled using a non-radioactive DIG-labeled nucleotide and the conditions for probe preparation and hybridization were optimized. Subsequently, the probe was examined in the detection of hbs gene in Bacillus subtilis ATCC 6633 by Southern blotting.
ACKNOWLEDGMENTS
This study was financially supported by Alzahra University.