Abstract: Toxoplasms gondii was detected in sera and urine of acutely infected mice. Animals were inoculated intraperitoneally with tachyzoites of T. gondii, RH strain. Ten animals were killed every day from day 1 up to day 7 post infection. Urine and sera of animals were collected and stored at -20°C until use. PCR performed by B1 gene amplification. Toxoplasma was detected in sera from 3 days post infection and in urine from 5 days post infection. No parasite was detected in control group.
INTRODUCTION
Toxoplasmosis is a world-wide endemic disease, caused by Toxoplasma gondii. Infected immunocompetent individuals present only with mild symptoms or may even be completely asymptomatic. In congenitally infected children and immunocompromised persons infection causes high rates of morbidity and mortality (Fuentes et al., 1996).
The classical diagnosis of toxoplasmosis in based on detection of specific antibodies that have poor efficiency, especially in neonates and in immunocomprosied patients. There have been many studies to detect parasite or its components in experimental infection (Raizman and Neva, 1975; Hafid et al., 1991) or in human toxoplasmosis (Van Knapen and Panggabean, 1977; Hafid et al., 1995). Recently PCR assays for the detection of T. gondii DNA with primers specific to different regions of genome of the parasite have been developed (Burg et al., 1989). Several studies were performed for the diagnosis of different forms of toxoplasmosis with different kinds of samples by PCR (Grover et al., 1990; Johnson et al., 1993). Huskinson et al. (1989) had suggested the detection of T. gondii in urine of experimentally infected mice by immunoblotting, Nguyen et al. (1996) detected T. gondii in blood, urine and brain of infected mice by PCR-DEIA and Hafid et al. (2000) have compared PCR, capture ELISA and immunoblotting for detection of T. gondii in sera of experimentally infected mice. In this study PCR was evaluated for detection of T. gondii in serum and urine of experimentally infected mice with tachyzoites of RH strain, with the aim of improvement of diagnosis in human toxoplasmosis.
MATERIALS AND METHODS
The this study was performed at the Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Science from Nov. 2005 to April 2006. One hundred male Balb/c mice were infected by intraperitoneal route with 5x104 tachyzoites of T. gondii RH strain. Urine samples were collected from animals then they were killed and whole blood were removed from them and centrifuged for 10 min at 200 g. This procedure was done from day one up to day seven post infection. The collected sera and urine were kept frozen at -20°C until use. Sera and urine of ten uninfected mice were collected as negative controls.
The DNA extraction was performed on 200 μL of serum and urine from infected and non-infected mice and tachyzoites of T. gondii with PCR kit (QIA Gene amp DNA mini kit, Germany) in accordance with the manufacturer’s instructions.
Amplification of the B1 gene was performed according to the method of Burg et al. (1989) with two primers, 5’ATTGCCCGTCCAAACTGCAACAACTG and 5’TGGGTCTACGTCGATGGCATGACAAC.
Briefly 10 μL of DNA product extraction were added to 10 μL of 10 x PCR buffer (10 mM. Roche, Germany), 5 μL of 25 mM MgCl2 (Roche, Germany), 2 μL of each 10 mM deoxynucleoside triphosphate (dATP, dCTP, dGTP and dTTP; Roche, Germany), 20 pmol of each primer (Roche, Germany), 10 IU of Taq-DNA Polymerase and 18 μL of distilled water. The reaction performed in thermocycler (Techne, Uk).
After an initial denaturation step at 94°C for 4 min, 35 cycles were run, consisting of denaturation (94°C for 1 min), annealing (58°C for 45 sec), extension (72°C for 1 min) and a final extension at 72°C for 10 min.
PCR Products and DNA mol. wt marker (100 bp ladder, Biolab, England) were analyzed simultaneously by electrophoresis in an agarose 1% w/v gel (Merck, Germany) in 1xTAE buffer. Amplified fragments of 570 bp were visualized under UV illumination after staining with ethidium bromide (Sigma, USA). A positive control (DNA extracted from tachyzoites) and negative control (DNA extracted from non-infected mice) were tested in each experiment.
RESULTS
The PCR assay gave positive results from serum and urine samples. The parasite was detected from day 3 post infection in serum of all experimentally infected mice. The results were positive in days 3, 4, 5 6 and 7 post infection in serum samples. The amplified fragments related to sera of 6th day were more intensive than fragment related to other days of infection. All control groups had negative results (Fig. 1a).
The parasite was detected in urine of all mice from 5 days post infection. The PCR gave positive results in days, 5, 6 and 7 post infections in urine samples.
| Fig. 1a: | Detection of T. gondii RH strain in mice sera by PCR.
M, mol. wt marker (100 bp ladder); T¯, negative control, D, day post
infection |
| Fig. 1b: | Detection of T. gondii RH strain in mice urine by PCR.
M, mol. wt marker (100 bp ladder); T¯, negative control, D, day post
infection |
The results for urine of control groups were negative (Fig. 1b). The amplified fragments were more intensive in sera than urine.
DISCUSSION
The molecular diagnosis of toxoplasmosis essentially relies on the PCR assays. Numerous PCR assays have been developed, using different sets of primers for different DNA targets and each has been tested, usually, with small numbers of biological samples from different body sites (Weiss, 1995). The most widely used targets are B1 and P30 genes. In this study primers from the 35 fold repetitive B1 gene were designed. Serum and urine of infected mice were compared. DNA was detected in sera from 3 days and in urine from 5 days post infection.
Although 2 initial studies could not detect any parasitemia, either in infected mice (Savva et al., 1990) or human (Ho-Yen et al., 1992), all subsequent studies did so. In experimental model, with virulent strain, parasitemia was detected (Angel et al., 1997; Wiess et al., 1991; Joss et al., 1993; Hafid et al., 2000), between 1 and 5 days post infection. There are few studies performed for Toxoplasma detection from urine. In one study four infants suspected of having Toxoplasma gondii infection were studied with different methods including PCR. T. gondii was detected by PCR in the urine of all of them (Fuentes et al., 1996). In other study, Toxoplasma gondii antigens were detected in urine of acutely infected mice by enzyme-linked immunosorbent assay (Huskinson et al., 1989).
In present study, T. gondii was detected in both serum and urine of infected mice by B1 gene amplification. The results suggest that isolation of parasite is possible both in sera and urine of experimentally infected mice.
Taken together, parasitemia could be detected in infection with T. gondii by PCR. So it would be a useful tool for early detection of toxoplasmosis in human infection especially in neonates and immunocompromised patients but the time period at which the parasite is present in human urine is unknown so, more studies are necessary in human toxoplasmosis especially in acute period of the disease.