Abstract: In the present study, gynaecological examinations were carried out on 916 buffaloes and samples of vaginal swabs, blood and milk were collected. Serum samples were checked for brucellosis and assayed for progesterone level. Vaginal swabs and milk samples were examined for zoonotic bacteria that may be transmitted to veterinarians during handling and examination of these animals during the different phases of the reproductive cycle. 1.09% of the serum samples were positive for brucella antibodies. Zoonotic bacteria were isolated from vaginal swabs (E. coli, Y. enterocolitica, Klebsiella sp., E. faecalis, S. aureus and Bacillus sp.) and milk samples (E. oli, Klebsiella pneumoniae, Salmonella typhimurium, Serratia marescens, S. aureus and Streptococcus agalactiae). PCR analysis showed that E. coli O157 and O119 isolated from animal suffering from ovarian inactivity were positive for the toxigenic genes (VT-II, stx-2 and eae-A). It can be concluded that risk of development of a zoonotic disease can be lessened by early recognition of infected animals, proper animal handling, basic biosecurity precautions and most importantly, personal hygiene.
INTRODUCTION
The world buffalo population is 160 million heads which represent an integral part of the agricultural economy in many developing countries (FAO, 2005). However, this species tends to suffer from a lot of reproductive disorders, mainly inactive ovaries and long calving interval (Ahmed et al., 2006) and subjected to gynaecological intervention in higher frequency than other species.
Injuries and other occupational hazards reported together with work days lost demonstrate a need for improving the working environment of veterinarians and their staff and the development of comprehensive health and safety programs in general. One of the inherent risks in the practice of veterinary medicine is exposure to zoonotic agents. In an Australian survey, 4% of veterinarians were reported to have acquired zoonotic diseases (Hill et al., 2000; Jeyaretnam et al., 2000). Also, a variety of zoonotic diseases may be encountered in animal practice, including, S. aureus infection, Cl. difficile-associated diarrhea, salmonellosis, campylobacteriosis, dermatophytosis and blastomycosis (Weese et al., 2002). Moreover, It was recorded that veterinary personnel can be infected with L. interrogans via contact by the urine or tissues from an infected animal with mucous membranes or skin lesions (Tan, 1997). This organism may cause human disease ranging from mild and self-limiting to fatal. Brucellosis is among zoonotic diseases which is associated with chronic serious sequel in humans. It is one of the most common occupational health hazard (Robichaud et al., 2004). Veterinary gynecologists may be infected during vaginal delivery, a cesarean delivery and a necropsy on a stillborn calf (Corbel, 1997).
A lot of microorganisms were isolated from the genital tract of buffalo-cows during the different reproductive stages including enterohemorrhagic E. coli, Y. enterocolitica, Salmonella sp., Klebsiella sp., Micrococcus sp., C. diversus, P. vulgaris, P. mirabilis, P. multocida, S. aureus, S. bovis, C. bovis and E. faecalis (Abd El Moez, 2007). Most of these microorganisms have zoonotic importance.
There is a shortage in data concerning zoonotic diseases that can be transmitted to veterinarians dealing with buffalo's reproduction; therefore in this study light will be thrown on those diseases that may cause a risk for veterinarians carried out gynaecological examination for this species.
MATERIALS AND METHODS
The current research was carried out on 916 female buffaloes reared in form of small holder farms at Lower Egypt. Field trips were weekly carried out during the period from July 2004 to March 2007 as a part of the National Research Center Project No. 7120106. Animal's case history and general health status were recorded. Gynaecological examination was carried out by rectal palpation, vaginal inspection and udder examination. Blood (916 cases), milk (318 cases) and vaginal swab (916 cases) samples were collected.
Serum Examination
Serum samples were harvested from blood samples by centrifugation (1500
x g, for 15 min at 4°C). Samples were checked for brucella antibodies using
Rose Bengal plate test (Alton et al., 1988) and progesterone level was
assayed by micro ELISA method (Hubl et al., 1982) to confirm the results
of the gynaecological examination.
Bacteriological Examination of Vaginal Swabs
Vagina was dry cleaned and vaginal swabs were collected under possible aseptic
conditions from the anterior vagina using the rectovaginal technique (Youngquist,
1997). Swabs were inoculated into tryptic soy broth and incubated at 37°C
for 24 h. Suspected colonies appearing on the different media were identified
biochemically (Holt et al., 1994).
Bacteriological Examination of Milk Samples
Milk samples were aseptically collected from all lactating animals, either
they are apparently healthy or suffering from clinical mastitis. Ten milliliter
of each milk sample was centrifugated for 20 min at 3000 rpm. Sediment was seeded
onto plates of nutrient agar, MacConkey agar and blood agar which were incubated
at 37°C for 48 h. Suspected colonies appearing on the different media were
identified (Holt et al., 1994). The recovered Salmonella isolates
were serologically identified using the diagnostic polyvalent and monovalent
antisera (Kauffmann, 1972).
Further Studies on E. coli Isolates
E. coli isolates were subjected to serological identification by
the slide agglutination test (Edwards and Ewing, 1972) using standard polyvalent
and monovalent E. coli antisera. DNA from E. coli isolates was
extracted (Sritharan and Barker, 1991). Detection of Shiga toxin type 2 (stx2
encoded by stx2) and intimin gene (encoded by eae-A) in the extracted
DNA of E. coli (serotypes O28, O126, O157, O119 and O78) was carried
out by multiplex PCR (Paton and Paton, 1998). The following primers were used;
stx2F (GGCACTGTCTGAAACTGCTCC), tx2R (TCGCCAGTTATCTGACATTCT),
eaeAF (GACCCGGC-ACAAGCATAAGC) and eaeAR (CCACCTGCAACAA-GAGG).
Also, PCR amplification of the Verotoxin-II from the E. coli isolates
was done (Ramotar et al., 1995) using the forward and reverse primers
(VT-IIF-TTAACCACACCCACGGCAGT and VT-IIR-GCTCTGGATGCATCTCT-GGT).
Agarose gel electrophoresis was carried out according to Sambrook et al.
(1989).
Statistical Analysis
Statistical analysis was carried out using Student t-test and Analysis of
Variance as outlined by Snedecor and Cochran (1980).
RESULTS
Serum Examination
Results showed that 10 out of 916 (1.09%) serum samples were positive for
brucella antibodies. Regarding serum progesterone; the level (ng mL-1)
was significantly (p<0.01) higher during the luteal phase (4.62±0.95)
as compared to the follicular phase (0.52±0.15) in normal cyclic animals.
In pregnant buffalo-cows, the level was significantly varied (p<0.01) with
the highest value during mid stages (7.36±0.31) and the lowest value
during late stages (1.29±0.64). After calving, the level was the lowest
during 2-4th week and the highest during 5-12th week post-partum. The level
was undetectable in animals suffering from bilateral smooth inactive ovaries.
Bacteriological Examination of Vaginal Swabs
Zoonotic bacteria isolated from the vaginal swabs of 916 female buffaloes
during normal estrous cycles, pregnancy, post partum periods and ovarian inactivity
are shown in Table 1. It was evident that the most predominant
isolates were E. coli, Y. enterocolitica, Micrococcus sp.
and E. faecalis (normal estrous cycles and pregnancy), E. coli,
S. aureus and S. pyogenes (post partum) and E. coli, S.
aureus, S. pyogenes and Klebsiella sp. (ovarian inactivity).
The rate of isolation in animals with ovarian inactivity was significantly (p<0.001)
higher (3.48±0.25) as compared to the normal cyclic animals (2.70±0.33).
Bacteriological Examination of Milk Samples
One hundred and ninety-seven out of the examined 318 milk samples (61.95%)
were positive for bacterial isolation. Table 2 shows the isolated
bacteria from milk samples of apparently normal and mastitic buffalo-cows. The
incidence of isolation was clearly high in the first (38.99%) as compared to
the later (22.96%) group. E. coli, K. pneumoniae, S. typhimurium
and Serratia marescens were isolated from apparently normal animals,
while, E. coli, K. pneumoniae, S. typhimurium, Serratia
marescens, S. aureus and S. agalactiae were isolated from
mastitic animals.
| Table 1: | Bacteria isolated from the genital tract of buffalo-cows during the different reproductive stages (%) |
| N = Number | |
| Table 2: | Bacteria isolated from milk samples obtained from apparently healthy and clinical mastitic buffalo-cows (%) |
| N = Number | |
| Table 3: | Serotyping and toxigenic genes of E. coli strains isolated from the genital tract of buffalo-cows |
| VT-II = Verotoxin-II, Stx-2 = Shiga toxin type 2, eae-A = Intimin gene, + = Positive, - = Negative | |
| Fig. 1: | Agarose gel electrophoresis showing amplification of 346 bp of VT-II gene lanes 2, 3, 7 and 10 while lanes 4, 5, 6, 8, 9 and 11 are negative. Lane 1 is DNA marker and lane 12 is a control positive |
Further Studies on E. coli Isolates
Serotyping of E. coli isolates recovered from the vaginal swabs of
buffalo-cows using antisera against pathogenic strains indicated that serotypes
O28 were prevailed in normal animals during luteal phase and pregnancy, O126
in normal animals during luteal phase and O78, O119 and O157 in animals suffering
from ovarian inactivity (Table 3). PCR (Verotoxin II) and
multiplex PCR (Shiga toxin-2 and intimin) revealed that E. coli of serotypes
O157 and O119 were positive for the tested toxigenic genes (VT-II, stx-2
and eae-A); while serotype O78 was negative for all the tested toxigenic
genes, as shown in Table 3 and Fig. 1-2.
| Fig. 2: | Agarose gel electrophoresis showing multiplex PCR amplification of 384 and 255 bp of Intimin (eae-A) and shiga toxin-2 (stx-2) genes in lanes 3, 5, 6 and 10 while lanes 1, 2, 4, 7, 8 and 9 are negative. Lane 12 is 100 bp ladders and lane 11 is a control positive |
DISCUSSION
The world population of buffaloes stands at approximately 160 millions and about 80% of these animals are located in India, China and Pakistan (FAO, 2005). There is also considerable number of buffaloes in Southeast Asian countries, Australia, North Africa and the Mediterranean countries, Italy and Bulgaria. Also, a sizeable population exists in South America, mainly in Brazil (Beg and Totey, 1999). Buffaloes contributes 10% of the world's total milk production, virtually all of which (>99%) is produced in developing countries (Shah, 1988). Regarding meat production, an estimated 1.6 million metric tons of buffalo meat is produced annually (Agarwal and Tomer, 1998). So there is an increasing worldwide interest for buffalo breeding, however, this species is reputed for high frequency of genital disorders and continuous genital intervention and there is an urgent need to know the zoonotic risk that might affect buffalo gynecologist.
In the present study, 1.09% of the examined serum samples were positive for brucella. In high risk occupations, living in Lebanon, Araj and Azzam (1996) recorded seroprevalence of Brucella- specific antibodies based on ELISA IgG, IgM and IgA in 57, 61 and 26%, respectively. Corbel (1997) reported nine persons participated in an attempted vaginal delivery, a cesarean delivery and a necropsy on a stillborn calf that died because of Brucella abortus infection. Omer et al. (2002) found that the highest prevalence of brucellosis among high risk occupational groups using Rose Bengal and complement fixation tests is among dairy farm workers and owners (7.1%), followed by veterinary personnel (4.5%). Mudaliar et al. (2003) recorded prevalence of brucellosis of 5.33% in animal handlers and advised that the clinician should keep in mind the possibility of an occupational or environmental exposure in cases of fever of unknown origin. Progesterone level is assayed in this study to confirm the present status of ovarian activity since it is secreted mainly from corpora lutea in buffaloes (Ahmed et al., 2006).
Microbiological examination of the vaginal swabs and milk samples of buffalo cows in this study indicated that most of the isolated bacteria have zoonotic importance. These included E. coli, Y. enterocolitica, Klebsiella sp., Micrococcus sp., E. faecalis, S. aureus and Bacillus sp. (vaginal isolates) and E. coli, Klebsiella pneumoniae, Salmonella typhimurium, Serratia marescens, S. aureus and Streptococcus agalactiae (milk samples). These microorganisms may cause serious diseases in buffalo's veterinary gynecologists particularly immunosuppressed personnel. In the same time, the incidence of isolation of these zoonotic pathogens is higher in animals suffering from genital disorders; represented by inactive ovaries which is the highest disorder that influence buffalo productivity and needs more gynaecological intervention. Moreover, animals with inactive ovaries have great affinity for infection due to their lower immune response (Ahmed et al., 1993, 2006; Subandrio et al., 2000).
E. coli isolates were subjected to serotyping and PCR for diagnosis of toxigenic genes for three reasons. Firstly, E. coli was the most predominant organism among all the isolated and identified microorganisms. Secondly, human infection with shiga toxin-producing E. coli (STEC) is potentially fatal and may be associated with serious complications such as Hemolytic-Uremic Syndrome (HUS) and hemorrhagic colitis (Griffin, 1995). Thirdly, cattle have been implicated as a principle reservoir of STEC (Blanco et al., 1997).
PCR (Verotoxin II) and multiplex PCR (Shiga toxin-2 and intimin) revealed that E. coli isolated from animals with ovarian inactivity (serotypes O157 and O119) were positive for the tested toxigenic genes (VT-II, stx-2 and eae-A). Wells et al. (1991) stated that the majority of outbreaks and/or sporadic cases of hemorrhagic colitis and HUS have been caused by members of only a few serogroups, such as O26, O111 and O157. The ability of STEC strains to cause serious disease in human is related to their ability to produce one or more shiga toxins (stx1, stx2 and variants of stx2) (Boerlin et al., 1999).
It could be concluded that potential exposure to zoonotic diseases is an inherent risk in veterinary gynecologists. While, it is virtually impossible to completely prevent exposure to zoonotic agents, measures can be taken to protect veterinarians and staff from acquiring infections. If attention is paid to awareness of disease with zoonotic potential, early identification of infected animals, proper handling and housing and personal hygiene, the risks to veterinary personnel can be greatly reduced. Moreover, animals that appear healthy must not be dismissed as possible sources of zoonotic pathogens, as some animals may be asymptomatic carriers.