Abstract: The pepc gene, which encodes phosphoenolpyruvate carboxylase (PEPC), of the marine cyanobacterium Synechococcus PCC 7002, was isolated and sequenced. PEPC is an anaplerotic enzyme, but it may also contribute to overall CO2 fixation through β-carboxylation reactions. A consensus sequence generated by aligning the pepc genes of Anabaena variabilis, Anacystis nidulans and Synechocystis PCC 6803 was used to design two sets of primers that were used to amplify segments of Synechococcus PCC 7002 pepc. In order to isolate the gene, the sequence of the PCR product was used to search for the pepc nucleotide sequence from the publicly available incomplete genome of Synechococcus PCC 7002. Thus, the major challenge was to find the pepc gene among genomic fragments and to complete gaps as necessary. PCR primers were designed to amplify a DNA fragment using a high fidelity thermostable DNA polymerase. An Open Reading Frame (ORF) consisting of 2988 base pairs coding for 995 amino acids was found in the 3066 bp PCR product. The pepc gene had a GC content of 52% and the deduced protein had a calculated molecular mass of 114,049 Da. The amino acid sequence was closely related to that of PEPC from other cyanobacteria, exhibiting 59-61% identity. The sequence differed significantly from plant and E. coli PEPC with only 30% homology. However, most of the essential amino acids involved in PEPC activity were shared by both proteins. The recombinant Synechococcus PCC 7002 PEPC was expressed in E. coli.
INTRODUCTION
Phosphoenolpyruvate carboxylase (PEPC; EC 4.1.1.31) catalyzes the irreversible β-carboxylation of phosphoenolpyruvate (PEP) to yield oxaloacetate (OAA) and inorganic phosphate (Pi). PEPC is found in higher plants and most types of bacteria including cyanobacteria (Lepiniec et al., 2003; Gonzalez et al., 2002). Several PEPCs have been purified from plants and bacteria, including thermophilic bacteria Nakamura (Nakamura et al., 1995). The enzyme contributes to photosynthetic and anaplerotic CO2 fixation. The best-described bacterial PEPC is that found in Escherichia coli; its physical and chemical properties have been extensively investigated (Smith et al., 1980) and its three-dimensional structure has been determined at 2.8 Å resolution (Kai et al., 1999). Escherichia coli PEPC is a tetrameric protein composed of four identical subunits of approximately 100 kDa each. The enzyme is allosterically activated by acetyl CoA, fatty acids, fructose-1-6 bisphosphate (F-1,6-BP), CDP, GTP and polyanions (Smith et al., 1980). Although the physiologically active E. coli enzyme is a tetramer, it is also catalytically active as a dimer (McAlister et al., 1981). The pepc genes of the freshwater cyanobacteria Anabaena variabilis, Anacystis nidulans and Anabaena PCC 7120 have also been cloned and sequenced (Luinenburg and Coleman, 1992; Harrington et al., 1986; Kodaki et al., 1985).
In many marine eukaryotic microalgae, up to 80% of CO2 assimilated may be attributed to the actions of PEPC and PEPCK. A significant amount of carbon dioxide is fixed through the same route in prokaryotic cyanobacteria. Despite the importance of PEPC in net carbon dioxide fixation, gene expression and regulation of this enzyme have not been extensively studied in cyanobacteria of marine origin. A significant portion of algal carbon metabolism is coupled to nitrogen metabolism, but little is known of the interactions between the enzymes of carbon and nitrogen metabolism. PEPC in marine cyanobacteria has not been cloned and expressed. Thus the opportunity to evaluate those interactions has not existed. As an initial step to obtain enough enzyme to begin the essential characterization, this study focuses on isolation and characterization of the pepc gene of Synechococcus PCC 7002, a halotolerant unicellular naturally transformable marine cyanobacterium (Essich et al., 1990; Stevens and Porter, 1980). The organism can be grown under photoautotrophic conditions in saline medium aerated with air containing CO2 (Lee et al., 1997). Synechococcus PCC 7002 has a genome size of approximately 3x106 base-pairs (Chen and Widger, 1993).
MATERIALS AND METHODS
Isolation of Synechococcus PCC 7002 DNA: Axenic cultures of wild-type Synechococcus sp. PCC 7002 (formerly Agmenellum quadruplicatum strain PR6) were obtained from the laboratories of Dr. John Paul (The University of South Florida, Saint-Petersburg, FL) and Robert Tabita (The Ohio State University, Columbus, OH). Synechococcus sp. PCC 7002 was grown in ASP-2 medium supplemented with 1 g L-1 NaNO3. The cells were grown under constant stirring and illumination from fluorescent light bulbs at room temperature with air supplemented with 3 to 5% CO2. Genomic DNA from Synechococcus PCC 7002 was isolated according to a procedure by Mazur et al. (1980). Cyanobacterial cells were suspended in buffer A (0.05 M NaCl, 0.05 M Na2EDTA, 0.05 M Tris-Cl; pH 8.0) and lysozyme was added to the suspension to a final concentration of 3.5 mg mL-1. This solution was placed in a water bath at 37°C for 2 h and the cells were treated with 3% sodium dodecylsulfate (SDS). The entire suspension was frozen and thawed three times before being placed at 4°C overnight. Ethanol was added to the clarified lysate in order to precipitate the DNA. The crude solution was treated with RNase A and proteinase K and the digest was extracted twice with phenol/chloroform/isoamylalcohol (25/24/1), pH 8.0. The DNA was kept in TE buffer, pH 8.0.
Amplification of pepc gene fragments by PCR and cloning of the PCR products: PCR was used to generate homologous probes and for the isolation of the pepc gene of Synechococcus PCC 7002. A multiple sequence alignment of the pepc genes for Anabaena variabilis, Anacystis nidulans and Synechocystis sp. PCC 6803 was generated. The gene sequences were taken from the National Center for Biotechnology Information (NCBI) genebank database and the alignment was generated with the alignment software ClustalW†J (Thompson et al., 1994). The resulting consensus sequence was used as an entry in the Primer3†J primer selection software (Rozen and Skaletsky, 2000). The primers were set to generate PCR fragments 200-1200 bps long and they were analyzed with NetPrimer†J for potential primer-dimer formation and secondary structures (Premier Biosoft International Inc., Palo Alto, CA). The PCR experiments were conducted in a Perkin-Elmer Cetus thermal cycler. The PCR mixtures included 0.5 μg chromosomal DNA and 100 pg of each primer. Taq polymerase buffer (100 mM Tris-Cl, pH 8.3, 500 mM KCl, 15 mM MgCl2, 1% Triton X-100) was used and 1.5 U Taq DNA polymerase (Promega, Madison, WI) was added. The chosen amplification sequence was: [Time delay: 2 min/94°C; Thermo-cycling: (94 °C/1 min, 50°C/1 min, 72°C/3 min) x 30; Final extension: 72°C/5 min; Soak: 4°C/∞]. The PCR products were cloned in the TA-cloning vector pGEM-T-Easy (Promega). Positive white transformants were selected and plasmid DNA was isolated from the cell cultures by alkaline lysis. The DNA was digested with EcoRI and SacI and the size of the inserts was determined by agarose gel electrophoresis. The constructs were sequenced by automatic sequencing (Veritas Inc., Rockville, MD). The recombinant plasmids were labeled pRF1 and pRF2.
In silico BLAST search of the pepc gene and amplification of the gene by PCR: The PCR-amplified pepc probe was used to scan the incomplete genome of Synechococcus PCC 7002 with the Basic Local Alignment Search Tool (BLAST) software (Altschul et al., 1990). The incomplete genome is composed of several fragments that are assumed to be uninterrupted. The probe showed significant homology to an 18.8 kb fragment (NCBI sequence ID: gnl|jmarq_320491contig051302_282). In light of the results obtained by the BLAST search, four PCR primers were designed that would amplify DNA fragments of more than 3 kb since pepc genes from other organisms are approximately 3 kb on average. The reverse primer sequence was: TCAACCCCGTGTTTCCACATTCC; the forward primers were:
| A: ATGCCAATCGTTGAACAGTATCTC |
| B: GGGTTATCCAGAATGAAGCTATAGTCA |
| C: GCAGAGGATCAAACCATCCTCACA |
| D: CCAGAATGAAGCTATAGTCACTTATACCA |
The amplification program was: [Time delay: 2 min/94°C; Thermo-cycling: (94°C/1 min, 55°C/1 min, 72°C/4 min) x 30; Final extension: 72°C/10 min; Soak: 4°C/∞]. Long and Accurate PCR experiments (LA-PCR) were repeated using LA-Taq DNA polymerase (Takara.Mirus.Bio, Madison, WI).
Additional PCR experiments were performed with primers A, D and the standard reverse primer using PfuTurbo DNA polymerase (Stratagene, La Jolla, CA). The amplification program was: [Time delay: 1 min/95°C; Thermo-cycling: (94°C/30 sec, 55°C/30 sec, 72°C/4 min) x30; Final extension: 72°C/10 min; Soak: 4°C/∞]. Fragments of the expected size were obtained in PCR experiments with PfuTurbo using dimethylsulfoxide (DMSO) as an additive and performed using forward primers A and D. The A-tailed product was cloned into the TA cloning vector pGEM-T-Easy (Promega). Positive clones were confirmed by restriction enzyme digestion and by PCR screening with the RF1 and RF2 primers. The inserts were sequenced by automated sequencing at Bioserve Biotechnologies (Laurel, MD).
Expression of recombinant cyanobacterial phosphoenolpyruvate carboxylase: New PCR primers were designed based on the sequence information obtained from the sequencing of the pGEM-T-Easy recombinants. The primer sequences were (FP-S7002-PEPC-nde1) ATTCCATATGAACCAAGTCATGCATCCC and (RP-S7002-PEPC-xho1) CCGCTCGAGTCAACCCGTG TTCCGCATT. The primers were synthesized with NdeI and XhoI adapters for directional cloning into the pET-15b expression vector (Novagen, San Diego, CA). The PCR experiment was performed with PfuUltra High Fidelity polymerase (Stratagene) and the amplification program was: [Time delay: 2 min/94°C; Thermo-cycling: (94°C/1 min, 55°C/1 min, 72°C/4 min) x 30; Final extension: 72°C/10 min; Soak: 4°C/∞]. The 3 kb pepc insert was ligated to the pET-15b vector. Recombinants were screened by restriction enzyme digestion and PCR. The pepc coding sequence was also subcloned into the pET- 30 Xa/LIC expression vector. PCR primers were designed with special adapters for ligation-independent cloning. The primer sequences were: (FP-PEPC-LIC) GGT ATTGAGGGTCGCATGAACCAAGTCATGCATCCC and (RP-PEPC-LIC) AGAGGAGAGTTAGAGGCAACCCGTGT TCGCGATT. The amplification program was: [Time delay: 2 min/94°C; Thermo-cycling: (94°C/1 min, 55°C/1 min, 72°C/4 min) x 30; Final extension: 72°C/10 min; Soak: 4°C/∞]. An aliquot of the annealing reactions was used to transform Novablue competent cells (Novagen). Positive correctly-oriented clones were identified by agarose gel electrophoresis, restriction mapping, PCR and sequencing. Recombinant plasmids were used to transform expression hosts BL21(DE3) pLysS and Rosetta(DE3) pLysS (Novagen). The expression hosts were grown in LB medium supplemented with antibiotics and protein expression was induced with isopropyl β-D-1-thiogalactopyranoside (IPTG). The cells were harvested from liquid culture by centrifugation and the cell pellet was resuspended in lysis buffer (50 mM Tris-Cl, pH 7.5, 5% glycerol, 50 mM NaCl). The extract was centrifuged in order to recover soluble proteins. The pellet was used to prepare the insoluble cytoplasmic fraction.
The insoluble pellet was washed in buffer and resuspended in 1.5 mL of 1% SDS with heating and mixing in the Minibeadbeater†7 (BioSpec Inc., Bartlesville, OK) at 50,000 rpm for 30 seconds. SDS-PAGE samples were prepared from the soluble and insoluble fractions by combining equal amounts of lysate and SDS-PAGE sample buffer. The samples were immediately heated at 90°C for 5 min prior to sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis. The electrophoretic buffer was Tris-glycine SDS-running buffer (25 mM Tris-Cl, pH 8.3, 98 mM glycine, 0.1% SDS). The gel was electrophoresed at 200 V for 45 min.
RESULTS AND DISCUSSION
Probe synthesis: In order to synthesize homologous probes for the purpose of gene cloning, an alignment of pepc gene from the fresh water cyanobacteria Anabaena variabilis, Anacystis nidulans and Synechocystis PCC 6803 was generated to design PCR primers for the amplification of segments of the phosphoenolpyruvate carboxylase gene of Synechococcus PCC 7002. The alignments were generated with the ClustalW software (Thompson et al., 1994). Two sets of primers were chosen FP1: CTGTTACTTTGGCTCTTGGGT and RP1: CAGATAGGGTTACTTGGCGATA and FP2: TATCGCCAAGTAACCCTATCGT and RP2: CACTTCC CCTTGTTCGGTAATTT. The FP1/RP1 primers, derived from highly conserved regions of the genes, were expected to generate a 266 bp fragment while the FP2/RP2 primers were expected to generate a 992 bp fragment based on the numbering of the consensus sequence. The PCR experiments with the FP1/RP1 and FP2/RP2 primers were successful and the sizes of the products were determined to be approximately 276 bp for the product of the FP1 and FP2 primers (RF1) and 1042 bp for the product of the FP2 and RP2 primers (RF2). These sizes are in agreement with expected values based on the alignment of cyanobacterial pepc genes. Since the RF1 and RF2 fragment represent adjacent parts of the gene, the sequences were juxtaposed and renamed Syn7002pepcΔ (or SpepcΔ). The degree of identity between SpepcΔ and corresponding regions of other cyanobacterial pepc is approximately 65%.
Isolation of pepc from Synechococcus PCC 7002 from the unfinished genome: In order to isolate the gene, the sequence of the probe (SpepcΔ) was used to search for the pepc nucleotide sequence from the publicly available unfinished shotgun genome of Synechococcus PCC 7002 (Accession No. NC 003488) with the Basic Local Alignment Search Tool (BLAST) software (Altschul et al., 1990). The BLAST search resulted in the identification of an 18.8 kb fragment that was renamed UF18. It was assumed that UF18 was a continuous DNA fragment and that it may contain a number of Open Reading Frames (ORF). Furthermore, SpepcΔ hybridized to a central position on UF18, thus, pepc was thought to be contained within that fragment. When aligned against the pepc genes of Anacystis nidulans, Anabaena variabilis and Synechocystis PCC 6803 it was found that the UF18 fragment included the 3` end of the gene that is highly conserved in all species. The UF18 sequence upstream from SpepcΔ showed a high degree of divergence from other known cyanobacterial pepcs; many PEPCsshare low homology at their N-termini. An ORF search of UF18 did not find a 3 kb ORF as expected from earlier knowledge of pepc genes; thus, it was evident that the sequence upstream of the probe was possibly erroneous. Nevertheless four forward primers were designed from the UF18 sequence so that the PCR experiment would yield progressively longer products slightly larger than 3 kb. The products were not expected to contain any of the UF18 sequence immediately preceding the probe sequence, but the amplification of the entire pepc coding sequence was anticipated. A reverse primer was also designed from UF18 that represented the highly conserved 3` end of the gene. This approach to isolating the gene represents an unconventional strategy to obtain the 5` end of the coding sequence that can be compared to genome walking with only partial genomic information. The products of all four reactions using the reverse primer and each of the four forward primers separately were approximately 3 kb when visualized on an agarose gel (Fig. 1). It seemed from the first round of sequencing that the reverse primer also acted as the forward primer in the PCR experiments. This assumption was strengthened by analyzing the sequence of the reverse primer. The 5` end of the target sequence was TCAACCCCGGTTCCACTG. This differs from the reverse primer at the underlined nucleotides. When the concentration of the reverse primer was doubled and the forward primers were omitted, the PCR experiments yielded the same 3 kb product. The nucleotide sequence of the insert revealed that the open reading frame of Synechococcus PCC 7002 consisted of 2988 base pairs and encoded a polypeptide of 995 amino acid residues with a molecular mass of 114,046 Da (Fig. 2). The sequence was assembled with the Contig Assembly Program (CAP) (Huang and Madan, 1999). None of the forward primer sequences used in this study was found in the sequenced gene. The sizes of the pepc gene and the predicted PEPC amino acid sequence were close to other phosphoenolpyruvate carboxylase genes and proteins isolated thus far by others. The GC content of the coding region was 52%. There were no obvious -10 and -35 sequences in the region upstream of the ATG start site. A multiple sequence alignment of pepc genes from Synechococcus PCC 7002, Anabaena variabilis, Synechococcus WH 8102, Synechococcus PCC 6803, Anacystis nidulans, Prochlorococcus marinus CCMP 1378, Prochlorococcus marinus CCMP 1375 and Prochlorococcus marinus MIT9313was performed with ClustalW (Thompson et al., 1994). The alignment indicated that Synechococcus PCC 7002 PEPC shared the most identity with Synechococcus PCC 6803 PEPC (63%) and only 30% identity with E. coli PEPC. Generally, Synechococcus PCC 7002 is most similar to PEPC from fresh water cyanobacteria than PEPC from marine strains (Table 1, Fig. 3). The alignment of cyanobacterial enzymes revealed that there are conserved amino acid substitutions between the marine and fresh water strains (Table 2). Synechococcus PCC 7002 PEPC shows substitutions associated with the enzyme from the fresh water strains. Alignment of the deduced amino acid sequence of Synechococcus PCC 7002 PEPC and E. coli PEPC was further analyzed for the presence of amino acids that have been found in PEPC from E. coli to be involved in catalysis and regulation. In spite of the low sequence homology between PEPC from the allosterically regulated E. coli PEPC and that of Synechococcus PCC 7002, most of the essential domains and amino acids involved in PEPC activity are present in both proteins (Fig. 4). As is also the case for various cyanobacterial sequences, Synechococcus PCC 7002 PEPC and E. coli PEPC have a higher degree of homology at the C-terminal than at the N-terminal. The sequences shared 37% identity at the C-terminal and 23% identity at the N-terminal. The sequences contributing to the active site are TAHPT, DXRQES, GYSDSYKDAG and FHGRGGXXGRGG; residues conserved between E. coli and cyanobacterial PEPCs are underlined (Lee et al., 1997). Replacement of the invariant arginine in the GRGG repeats was associated with a loss in catalytic activity (Yano et al., 1995). In the E. coli enzyme, it had been proposed that the glycine-rich loop (FHGRGGXXGRGG) helps to position substrate molecules at the active site and forms a lid that protects the reaction intermediates from attack by surrounding water molecules. Moreover, R587 of E. coli PEPC G-rich loop, which corresponds to R683 on the Synechococcus PCC 7002 PEPC, plays a role in inhibition by aspartate. Aspartate binding to this residue traps the loop and prevents it from contributing to the active site (Kai et al., 1999). Furthermore, E. coli and Synechococcus PCC 7002 contain the aspartate-binding site homology, which is composed of three domains: EM(T/V)(L/F)(S/A)K, LRN(G/I)(T/Y) and MRNTG. This site is also found in PEPC from Anacystis nidulans even though that enzyme is not inhibited by aspartate (Ishijima et al., 1985).
| Fig. 1: | (a) Digest of recombinant plasmid with SalI; Lane 1: λ DNA/HindIII; Lane 2: pGEM-T-Easy (vector)/SalI; Lane 4: pEZA1 (recombinant)/SalI. The band in lane 4 is approximately 6 kb which is consistent with an insert of 3 kb. (b) Digest of recombinant plasmid with NotI; Lane 1: λ DNA/HindIII; Lane 2: pGEM-T-Easy/NotI; Lane 4: pEZA1/NotI. The band in lane 4 is approximately 3 kb since there are two NotI sites on each side of the pepc insert |
| Fig. 2: | Nucleotide sequence of Synechococcus PCC 7002 pepc and deduced primary structure. The gene consists of 2988 bp and encodes a polypeptide of 955 amino acids residues with a calculated molecular mass of 114,049 Da. The GC content of the Synechococcus PCC 7002 pepc coding region is 52%. (Genebank ID number AY830136) |
| Fig. 3: | Cladogram of various cyanobacterial PEPC sequences. Synechococcus PCC 7002 PEPC seems to share a higher degree of homology with PEPC from fresh water cyanobacteria than oceanic organisms |
| Table 1: | Percent amino acid identity to Synechococcus PCC 7002 phosphoenolpyruvate carboxylase of other cyanobacterial PEPC sequences |
| Table 2: | Conserved amino acid substitutions between fresh water and oceanic cyanobacterial PEPC sequences. The PEPC sequences used for the comparisons were from Anabaena variabilis, Synechococcus WH 8102, Synechococcus PCC 6803, Anacystis nidulans, Prochlorococcus marinus CCMP 1378, Prochlorococcus marinus CCMP 1375 and Prochlorococcus marinus MIT 9313 |
| Fig. 4: | Alignment of Synechococcus PCC 7002 PEPC and E. coli PEPC. The sequences were aligned with ClustalW and shaded with Boxshade. The deduced amino acid sequence of Sycechococcus PCC 7002 phosphoenolpyruvate carboxylase and E. coli PEPC share 30% homology compared to 51-63% for cyanobacterial PEPCs. The amino acids that are involved in catalysis are highlighted in yellow boxes and those that are involved in aspartate binding are in red boxes |
Expression of recombinant Synechococcus PCC 7002 PEPC: While the induction the β-galactosidase control produced a strong band, expression of the recombinant PEPC was weak and the band could only be seen by Western blotting using and antibody to the His-tag. Considering the possibility that the low expression was due to differences in codon usage between Synechococcus PCC 7002 and E. coli, an optimized pepc sequence for expression in E. coli was synthesized and cloned into the pET-15b vector (Geneart, Regensburg, Germany). Induction of this recombinant resulted in an intense band at the correct size (114 kDa), however the protein was insoluble. Attempts to resolubilize the inclusion bodies were unsuccessful.
CONCLUSIONS
In summary, the gene encoding the phosphoenolpyruvate carboxylase of Synechococcus PCC 7002 was isolated using PCR techniques. The 1 kb RF2 riboprobe which is derived from the amplification product of a segment of the pepc gene of the cyanobacterium was generated. The successful strategy for the isolation of the phosphoenolpyruvate carboxylase gene of Synechococcus PCC 7002 was to utilize the probe as well as sequence information from the recently published incomplete genome of the cyanobacterium. The PCR experiments in this study effectively filled in existing gaps in the incomplete putative pepc gene from the unfinished genomic sequence while essentially using a single primer. The deduced amino acid sequence was more homologous to that of fresh water cyanobacteria than oceanic strains. For the first time, the identity of single amino acid substitutions that appear to distinguish PEPC from marine organisms and those from fresh water organisms have been revealed. The alignment of the deduced amino acid sequence of Synechococcus PCC 7002 PEPC and E. coli PEPC was further analyzed for the presence of amino acids involved in catalysis and regulation. In spite of the low sequence homology between PEPC from the two species, comparing the Synechococcus PCC 7002 sequence to the allosterically regulated E. coli PEPC revealed that the essential domains and amino acids involved in PEPC activity are shared by both proteins. The isolation and sequencing of the gene is an important first step that will permit obtaining a sufficient amount of protein for studies of the kinetics and mechanism of action and regulation of this enzyme. Complementation experiments using pepc- mutants are now feasible with constructs containing Synechococcus PCC 7002 pepc (Coomes et al., 1985; Harrington et al., 1986). Furthermore, the elucidation of the sequence provides sufficient information that will allow for the design and synthesis of probes for environmental studies.
ACKNOWLEDGMENTS
The authors are grateful to Dr. Malcolm W. Byrnes and to Dr. Meseret Ashenafi for their technical assistance. This research was supported by the BIOMP 633255 grant from the US Department of Energy.