Abstract: Background and Objective: Osteoarthritis (OA) is a degenerative, debilitative, multifactorial illness affecting the knee joints of millions of people globally. The peptide/polypeptide fraction from Aloe Vera (AV-PP) has shown anti-inflammatory potential by inhibiting inflammatory cytokines. To evaluate the efficacy and potential mechanism of action of AV-PP against bone healing during surgically induced bone damage in a rat model of Adjuvant-Induced Arthritis (AIA). Materials and Methods: A bone fracture was created in adjuvant-induced arthritis rats using a surgical drill in the anterolateral wall of the lateral condyle of the femur. Then rats were treated with either distilled water or alendronate (3.0 mg kg–1) or AV-PP (0.25, 0.5 and 1.0 mg kg–1) for the next 28 days. Results: AIA-induced increased paw volume and spleen weight was effectively (p<0.05) reduced by AV-PP (0.5 and 1.0 mg kg–1) treatment. The elevated levels of synovial TNF-α, IL-1β, IL-6 and IL-17 and diminished levels of IL-4 and IL-10 were distinctly (p<0.05) restored by AV-PP treatment. Bone injury-induced up-regulated synovial RANKL and osteocalcin, whereas down-regulated OPG and Runx2 mRNA expressions were prominently (p<0.05) inhibited by AV-PP treatment. Histopathology findings of the tibiotarsal joint showed administration of AV-PP effectively (p<0.05) reduced bone inflammation and improved bone healing. Conclusion: AV-PP showed efficacy against surgically induced bone damage in a rat model of adjuvant-induced arthritis by inhibiting RANKL/OPG signalling pathway, activating osteocalcin and balancing inflammatory cytokine levels in AIA rats.
INTRODUCTION
Osteoarthritis (OA) is a chronic progressive multifactorial illness that commonly impacts joints, leading to chronic pain, inflammation and damage to tissue which causes limb functional difficulty1-4. The epidemiological study documented that incidence and prevalence of knee OA are directly correlated with the age and highest at the age of 70-79 years1. In the elderly patient, knee OA is a significant cause of disability and in 2020, approximately 654.1 (95% CI, 565.6-745.6) million people age 40 years and older suffering from knee OA worldwide1,5. It has been well documented that the prevalence and incidence of OA are higher in females than males, with a ratio of 1.69 (95% CI, 1.59-1.80) and 1.39 (95% CI, 1.24-1.56), respectively1. A Cost-utility analysis conducted by Gui et al.3 reported that the total cost for hospitalization for Chinese OA was about Ұ57,940.55 ($8987) which significantly (81.59%) contributed to out-of-pocket expenses. Thus, OA is associated with a higher economic and humanistic burden.
Cartilage degradation and bone remodelling are the main pathophysiological features of OA4. Researchers have well documented the role of pro-inflammatory and anti-inflammatory cytokines in bone remodeling4,6. The balance between pro-inflammatory cytokines (ILs (interleukins)-1β, IL-6, IL-17 and Tumour Necrosis Factor (TNF)-α) and anti-inflammatory (IL-4, IL-10, IL-13) has been suggested as an important approach for the management of OA7-10. The altered levels of these cytokines have been reported in synovial fluids of OA patients11. The new emerging treatment targeted the regulators mainly involved in the joint bone erosion and thus maintained osteoclast homeostasis12,13. These regulators include RANKL (receptor activator of nuclear factor kappa-B ligand), OPG (osteoprotegerin), RUNX2 (Runt-related transcription factor-2), Col I (collagen I), BSP (Bone Sialoprotein), Osteocalcin (OCN) and Osteopontin (OPN)14-16. RANKL has been reported as an essential apoptosis regulatory gene for OPG17. Thus, inhibition of these new targets may provide safe and effective treatment options for OA management.
The current first-line treatment medications for the management of OA include acetaminophen, NSAIDs (Nonsteroidal anti-inflammatory drugs including ibuprofen and naproxen), duloxetine which aid in relieving OA pain18,19. However, these agents are associated with adverse events, including cardiovascular and digestive difficulties, bleeding problems and damage to the kidney and liver18. Recently, investigators have established the relationship between the efficacy of bisphosphonate (such as alendronate) and pain modulation20. Alendronate has been reported to protect the cartilage against its degeneration and prevent subchondral bone remodelling, thus helping to protect against OA and decrease knee pain21. However, little evidence reported that alendronate is unable to inhibit long-term joint degeneration22. The available surgical and other optional procedures, including corticosteroid or lubrication (hyaluronic acid) injections or joint replacement are effective with a minimal side effect. However, these therapeutic regimens are associated with significant cost. Thus, OA patients are preferring therapeutic regimens from complementary and alternative medicinal system. Thus, researcher have taken efforts to evaluate emerging safe and effective therapy from natural origin that can be implemented for long-term management of OA.
The increasing popularity of complementary and alternative medicines, including herbal remedies, has raised significant awareness in treating various disorders. Aloe vera (A. vera, Aloe barbadensis Mill., Family: Liliaceae) have been reported to possess many pharmacological activities23. Among various active phytoconstituents of A. vera gel, researchers have documented sterols, saccharides, polyphenols, flavonoids and peptide/polypeptides as important bioactive for its therapeutic potential23. In the randomized placebo-controlled trials, polypeptides have been demonstrated their therapeutic potential in the management of osteoarthritis2,24,25. Peptide/polypeptides from A. vera gel have been documented for their anti-inflammatory and anti-diabetic potential26,27. The peptide/polypeptide fraction from Aloe Vera (AV-PP) has shown anti-inflammatory potential by inhibiting pro-inflammatory cytokines (TNF-α and IL-6)26. However, the potential of Aloe vera peptide/polypeptide is still unknown against OA. Hence, the purpose of the present investigation was to evaluate the efficacy and potential mechanism of action of AV-PP against bone healing during surgically induced bone damage in rat models of adjuvant-induced arthritis.
MATERIALS AND METHODS
Study area: The experiment was performed in the Institute’s Tianshui Hand and Foot Surgery Hospital, Tianshui, China, from 17th June-27th August, 2021. All the experiments were carried out between 08:00 and 17:00 hrs in a quiet laboratory environment.
Animals: Wistar rats (Adult female, 150-180 g, n = 140) were procured from the animal house of Tianshui Hand and Foot Surgery Hospital, Tianshui, China. The rats were maintained in-house at 24±1°C, 12:12 hrs dark-light cycle, with standard pellet feed and filtered water during the experimental time of 08:00 and 17:00 hrs in a quiet laboratory environment. The animal ethics committee of Tianshui Hand and Foot Surgery Hospital approved all the experimental research protocols (No. 2021-071201).
Chemicals and reagents: To determine the levels of TNF-α (Tumour Necrosis Factor-α) and ILs (Interleukin-4, IL-1β, IL-6, IL-10 and IL-17) a rat specific ELISA (Enzyme-Linked Immunosorbent Assay) kits were procured from Bethyl Laboratories Inc., Montgomery, TX, USA. To induce AIA, FCA was purchased from Sigma Aldrich, St. Louis, USA. Microliter syringe was purchased from Hamilton, Bonaduz, Switzerland. Laboratory grade chemicals including methanol, ethyl acetate, toluene and formic acid were purchased from Merck Life Science Pvt Ltd, India. The One-step Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) kit and Total RNA Extraction kit were purchased from MP Biomedicals India Private Limited, Mumbai, India.
Aloe vera extract preparation and enrichment of peptide/polypeptide fraction: Aloe vera was obtained from Muzi Agricultural Ltd., Shaanxi Province, China. The Aloe vera extract was prepared according to the previously reported method26. The peptide/ polypeptide fractions from the extract were enriched through 30% Trichloroacetic Acid (TCA) precipitation. In brief, the Aloe vera extract was dissolved in water and kept for shaking for 24 hrs. TCA solution was added to the extract and centrifuged at 5000 rpm. The pellet was added with acetone and washed 3 times under the same condition. The resulting peptide/polypeptide fraction obtained was stored at -80°C for further use. Bradford assay was carried out to estimate the amount of protein in the PPF28.
Induction of adjuvant-induced arthritis (AIA): FCA (0.1 mL, intradermal) was injected into the paw of the rats to induce AIA in female rats (150-180 g, 5 groups, i.e., group III to VII, n = 18 each group)29. Following the injection, 12 days were allowed for the development of arthritis. A separate group of rats (group I and II, n = 18) was maintained as normal and sham and did not receive FCA.
AIA rat model combined with bone injury model: After developing AIA (13 days) in groups III to VII, a critical size femur defect was performed in AIA rats as previously described30,31. Briefly, knees were shaved and disinfected and then an incision was made in the skin and muscles surrounding the right femur were retracted. After lateral knee arthrotomy, a cylindrical defect (FD, 3×4 mm, diameter×depth) was created using a surgical drill in the anterolateral wall of the lateral condyle of the femur. Sham (group II) animals underwent surgery but did not receive any injury to the femur. Surgeries were performed under general anaesthesia with volatile isoflurane. After surgery, the joint was irrigated with sterile saline solution and both capsule and skin were closed with 4-0 nylon sutures. For the sham-operated group, the wounds were sutured after exposing the knee joint cartilage surface. The animals were injected intramuscularly with antibiotics (1.0-1.3 mg/cefotiam hydrochloride) for 3 days after surgery and allowed to recover.
Drug treatment: After 24 hrs of surgery, animals received either Distilled Water (DW) (1.0 mg kg–1, p.o. in groups I, II and III, i.e., normal, sham and Arthritic Control [AC]) or alendronate (Ale, 3.0 mg kg–1 as a standard in group IV) or aloe vera peptide/polypeptide fraction (AV-PP, 0.25, 0.5 and 1.0 mg kg–1 in group V to VII) for the next 28 days. The dosage of AV-PP was selected based on previously reported study26.
During the experimental period, the paw volume was determined at different days using Plethysmometer (UGO Basile Italy)32. On the last day of the study (day 43), rats were sacrificed by cervical dislocation. Immediately synovial tissues and spleen were isolated and stored at -70°C.
Determination of synovial inflammatory cytokines (TNF-α and ILs) levels: The synovial level (n = 6) of inflammatory cytokine including ILs and TNF-α were determined using ELISA and presented as pg Ml–1.
Determination of synovial mRNA expressions of RANKL, OPG, Osteocalcin and Runx2: The levels of mRNA were analyzed in synovial tissues (n = 6) using RT-PCR as described previously33. Single-stranded cDNA was synthesized from 5 μg of total cellular RNA using a reverse transcriptase kit (MP Biomedicals India Private Limited, India) as described previously. The primer sequence for receptor activator of nuclear factor-kappa-Β ligand (RANKL), Osteoprotegerin (OPG), Osteocalcin (OCN), Runt-related transcription factor 2 (Runx2) and β-actin are presented in Table 1. Amplification of β-actin served as a control for sample loading and integrity. The intensity of mRNAs was standardized against that of the β-actin mRNA from each sample and the results were expressed as the PCR-product/β-actin mRNA ratio.
Histopathology of tibiotarsal joint: To assess the potential of AV-PP on tibiotarsal histology, ankle joints (n = 3/group) were isolated and stored in formaldehyde solution (10%).
| Table 1: | Primer sequence for RANKL, OPG, OCN, runx2 and β-actin | ||
| Gene | Sequence forward primer | Reverse primer | Size (bp) |
| RANKL | GGGAATTACAAAGTGCACCAG | GCCATCCTTCTCAAAGTTGT | 69 |
| OPG | TCAAGTGCTTGAGGGCATAC | TGGAGATCGAATTCTGCTTG | 119 |
| OCN | AAGCAGGAGGGCAATAAGGT | CAAGCAGGGTTAAGCTCACA | 240 |
| Runx2 | TGTTCTCTGATCGCCTCAGTG | CCTGGGATCTGTAATCTGACTCT | 146 |
| β-actin | GTCACCCACACTGTGCCCATCT | ACAGAGTACTTGCGCTCAGGAG | 764 |
| OCN: Osteocalcin, OPG: Osteoprotegerin, RANKL: Receptor activator of nuclear-factor kappa-β ligand and Runx2: Runt-related transcription factor 2 | |||
Then, microtomes were used to cut these sections into the thickness of 5 μm followed by deparaffinated and H and E (hematoxylin and eosin) staining. An impression of histopathological features was evaluated using a light microscope. A previously reported method was used to determine histological aberrations intensity in the tibiotarsal joint34.
Statistical analysis: GraphPad Prism 5.0 software (GraphPad, San Diego, CA) was used to perform data analysis. Data are expressed as Mean±Standard Error mean (SEM) and analyzed using Two-Way ANOVA followed by Tukey’s multiple range post hoc analysis (for body weight and paw volume) and One-Way ANOVA followed by Tukey’s multiple range post hoc analysis (for spleen weight, cytokines levels and mRNA expressions (RANKL, OPG, Osteocalcin and Runx2)) and Kruskal-Wallis test for post hoc analysis (non-parametric tests, i.e., histopathology score). A value of p<0.05 was considered to be statistically significant.
RESULTS
Bodyweight and hind paw volume: There was a significant decrease (p<0.05) in body weight (Fig. 1a), whereas hind paw volume decidedly increased (p<0.05, Fig. 1b) in the AC group as compared to the normal and sham groups. However, the administration of alendronate effectively (p<0.05) increased body weight and lessened paw volume compared to the AC group. Treatment with AV-PP (0.5 and 1.0 mg kg–1) markedly amplified (p<0.05) body weight and hind paw volume was suggestively decreased (p<0.05) when compared to the AC group. However, the administration of alendronate showed more momentous inhibition in AIA-induced alteration in body weight and hind paw volume compared to the AV-PP treated group (Fig. 1a, b).
Spleen weight and spleen index: Spleen weight (Fig. 1c) and spleen index (Fig. 1d) amplified markedly (p<0.05) in the AC group after FCA administration compared to the normal and sham groups. Administration of alendronate effectively (p<0.05) reduce spleen weight and spleen index compared to the AC group. Additionally, AV-PP (0.5 and 1.0 mg kg–1) treatment meaningfully decreased (p<0.05) spleen weight and spleen index compared with the AC group. The elevated spleen weight and spleen index were more effectively (p<0.05) decreased after treatment with alendronate than AV-PP (Fig. 1c-d).
Synovial ILs and TNF-α protein levels: When compared with the normal and sham group, synovial TNF-α, IL-1β, IL-6 and IL-17 levels were distinctly increased (p<0.05), whereas IL-4 and IL-10 levels were markedly lessened (p<0.05) in the AC group. Alendronate treatment blatantly (p<0.05) inhibited AIA-induced alterations in TNF-α and ILs in synovial tissue compared to the AC group. Administration of AV-PP (0.5 and 1.0 mg kg–1) also noticeably enhanced (p<0.05) synovial IL-4 and IL-10 levels, whereas synovial TNF-α, IL-1β, IL-6 and IL-17 levels were markedly reduced (p<0.05) when compared with the AC group. Alendronate treatment was more effective in inhibiting AIA-induced alterations in TNF-α and ILs in synovial tissue than in the AV-PP treatment (Table 2).
Synovial RANKL, OPG, Osteocalcin and Runx2 mRNA expressions: Induction of bone injury in AIA-induced arthritic rats caused significant alterations (p<0.05) in synovial RANKL, OPG, osteocalcin and Runx2 mRNA expressions (Fig. 2a). The mRNA expressions of synovial RANKL (Fig.2b) were strikingly up-regulated (p<0.05), synovial OPG (Fig. 2c) effectively (p<0.05) down-regulated, osteocalcin (Fig. 2d) were strikingly up-regulated (p<0.05) and Runx2 (Fig. 2e) mRNA expressions were effectively (p<0.05) down-regulated in the AC group compared with the normal and sham groups. Treatment with alendronate effectively (p<0.05) down-regulated AIA-induced raised RANKL and osteocalcin mRNA expressions in synovial tissue whereas up-regulated synovial OPG and Runx2 mRNA expressions as compared to AC group. AV-PP (0.5 and 1.0 mg kg–1) administration flagrantly attenuated (p<0.05) RANKL and osteocalcin mRNA expressions whereas prominently (p<0.05) up-regulated synovial OPG and Runx2 mRNA expressions as compared to the AC group.
| Fig. 1(a-d): | Effects of AV-PP on alteration in (a) Body weight, (b) Paw volume, (c) Spleen weight and (d) Spleen index in AIA rats Values in parentheses indicate a dose in mg kg-1 (n = 6). Two-way ANOVA analyzed data for body weight and paw volume, whereas data for spleen weight and spleen index was analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. For comparison with AIA-control (AC) group: *p<0.05, comparison with normal group: #p<0.05 and comparison with one another: $p<0.05. AC: Adjuvant-induced arthritis control, Ale: Alendronate and AV-PP: Aloe vera peptide/polypeptide fraction |
| Table 2: | Effects of AV-PP on FCA-induced alterations in inflammatory cytokine levels in synovial tissues | |||||
| Treatments |
TNF-α (pg mL–1) |
IL-1β (pg mL–1) |
IL-4 (pg mL–1) |
IL-6 (pg mL–1) |
IL-10 (pg mL–1) |
IL-17 (pg mL–1) |
| Normal |
1.68±0.07 |
60.31±4.04 |
349.60±12.59 |
99.27±4.12 |
75.18±2.75 |
100.20±13.15 |
| Sham |
1.92±0.05 |
65.41±4.39 |
342.20±13.38 |
122.00±3.97 |
67.03±2.64 |
126.20±14.41 |
| AC |
3.33±0.06# |
231.40±3.37# |
42.51±13.86# |
298.40±3.67# |
7.72±1.75# |
335.10±13.52# |
| Ale (3.0) |
2.15±0.06*,$ |
87.93±3.35*,$ |
302.30±13.86*,$ |
141.60±6.15*,$ |
60.68±2.88*,$ |
157.10±11.88*,$ |
| AV-PP (0.25) |
3.20±0.07 |
206.10±4.15 |
67.95±12.16 |
286.00±3.95 |
9.27±1.53 |
335.30±11.55 |
| AV-PP (0.5) |
2.68±0.05*,$ |
157.70±3.43*,$ |
169.10±13.32*,$ |
235.80±2.31*,$ |
25.36±2.74*,$ |
276.60±11.85*,$ |
| AV-PP (1.0) |
2.50±0.04*,$ |
115.70±3.69*,$ |
222.60±12.38*,$ |
186.00±5.50*,$ |
43.94±2.87*,$ |
205.30±11.38*,$ |
| Values in parentheses indicate a dose in mg kg–1 (n = 6). Data were analyzed by one-way ANOVA followed by Tukey’s multiple comparisons test. For comparison with AIA-control (AC) group: *p<0.05, comparison with normal group: #p<0.05 and comparison with one another: $p<0.05. AC: Adjuvant-induced arthritis control, Ale: Alendronate, AV-PP: Aloe vera Peptide/Polypeptide fraction, ILs: Interleukins, and TNF-α: Tumour Necrosis Factor-α | ||||||
Histopathology of the tibiotarsal joint: Histological analysis of tibiotarsal joints from normal and sham groups portrayed normal architecture of tibiotarsal joints with evidence of mild synovial proliferation, cartilage erosion and inflammation (Fig. 3a, b). AIA followed by bone injury cases marked destruction in the tibiotarsal joints reflected by elevated cellular infiltration, synovial proliferation, cartilage erosion and inflammation, which were evident in the synovial tissue from the AC group (Fig. 3c).
| Fig. 2(a-e): | Effects of AV-PP on FCA-induced alterations in mRNA expressions of RANKL, OPG, Osteocalcin and Runx2 in synovial tissues, (a) Qualitative, (b) quantitative representation of the mRNA expression of RANKL, (c) OPG, (d) Osteocalcin and (e) Runx2 Data are expressed as Mean±SEM (n = 6) and analyzed by one-way ANOVA followed by Tukey’s multiple range test. For comparison with AIA-control (AC) group: *p<0.05, comparison with normal group: #p<0.05 and comparison with one another: $p<0.05. 1000 base pair (bp) ladder (lane 1), normal group mRNA expression (lane 2); sham group mRNA expression (lane 3); AC control group mRNA expression (lane 4); Alendronate group mRNA expression (lane 5) and AV-PP (0.25, 0.5 and 1.0 mg kg–1) group mRNA expression (lane 6-8). AC: Adjuvant-induced arthritis control, Ale: Alendronate, AV-PP: Aloe vera peptide/polypeptide fraction, OCN: Osteocalcin, OPG: Osteoprotegerin, RANKL: Receptor activator of nuclear factor kappa-B ligand and Runx2: Runt-related transcription factor 2 |
Conversely, alendronate treatment effectively (p<0.05) inhibited AIA-induced destruction of tibiotarsal joints imitated by reduced cellular infiltration, synovial proliferation, cartilage erosion and inflammation as compared to the AC group (Fig. 3d). Administration of AV-PP (0.5 and 1.0 mg kg–1) also noticeably decreased (p<0.05) AIA-induced histological modifications in tibiotarsal joints when compared with the AC group (Fig. 3e-g).
| Fig. 3(a-g): | Effects of AV-PP on the histopathology of tibiotarsal joints, representative histological images from (a) Normal, (b) Sham, (c) AIA control, (d) Alendronate (3.0 mg kg–1), (e) AV-PP (0.5 mg kg–1), (f) AV-PP (1.0 mg kg–1) treated rats. Images stained with H and E (X 40). The quantitative representation of (g) Histological score Data were expressed as Mean±SEM (n = 3) and one-way ANOVA followed by the Kruskal-Wallis test was applied for post hoc analysis. For comparison with AIA-control group: *p<0.05, comparison with normal group: #p<0.05 and comparison with one another and $p<0.05 |
DISCUSSION
Osteoarthritis (OA) is a degenerative, debilitative, painful and the most common type of arthritis, affecting knee joints of almost 100 million people globally1. Surgically induced open fracture in the femur of Adjuvant-Induced Arthritic (AIA) rats is an experimental model which determined its bone healing characteristics during arthritis. This experimental model resemblance with the clinical characteristic of OA reflected by systemic bone loss, focal bone erosion at the joint and osteoporosis in a patient with OA35. The present investigation evaluated the potential of peptide/polypeptide fraction from Aloe vera (AV-PP) against surgically induced bone damage in a rat model of adjuvant-induced arthritis. Findings suggest that AV-PP improve bone repair and attenuate cartilage degeneration via inhibition of the RANKL/OPG signalling pathway, activating osteocalcin and balancing inflammatory cytokines levels in AIA rats.
A decline in the body weight and halting of growth has been observed in the AIA control rats indicated induction of disease, which is following earlier report36,37. Body weight is considered an indirect index of health status, thus, it can evaluate the recovery from illness and maintain a healthy weight37. Effects of body weight on the development and restoration of health were during immune-inflammatory conditions, including arthritis, have been well studied by the previous investigator36-38. In addition, the severity of arthritis is characterized by various macroscopic signs, including swelling of the hind paw and ankle joints. In the present study, AIA control rats showed the swelling of hind paw suggested by increased paw volume during Plethysmometer analysis. Furthermore, splenic enlargement is a hallmark for the association of various inflammatory conditions during immune response30,39. AIA-induced arthritis has been well linked with increased spleen weight which was observed with increased spleen index in AIA-control rats. However, administration of AA-PP showed inhibition in AIA-induced decreased bodyweight, suggesting the restoration of health and halting of disease progression. Moreover, attenuation of increased hind paw swelling and spleen weight by AA-PP reflects its anti-inflammatory, which might be exerted via inhibition of inflammatory release.
In the current study, diminished IL-4 and IL-10, whereas elevated levels of TNF-α, IL-1β, IL-6 and IL-17 have been observed in the synovial fluid of AIA-control rats. Noteworthy, AA-PP treatment inhibited AIA-induced alteration in pro-inflammatory and anti-inflammatory cytokine levels. Previous investigators also documented polypeptide’s anti-inflammatory potential from aloe vera via down-regulation of TNF-α and IL-6 levels26. The results of the present investigation were following the findings of the previous researcher26. Although the exact mechanism of pathogenesis of OA remains unclear, however, it has been reported that pro-inflammatory cytokines produced via activated synovial cells play a crucial role in the pathogenesis of this illness8. Thus, researchers have considered these cytokines as a potential target for treating OA39-41. The activation of the inflammatory response by polynuclear neutrophils in the joint space is initiated by the production of inflammatory cytokines and their effects on the joint surface. This process can trigger the onset of joint damage and decrease the functionality of the cartilage membrane. The presence of cytokines, such as ILs and TNF-α in the synovial membrane contributes to the development of joint destruction and the proliferation of the joint. Furthermore, a researcher reported that elevated expressions of TNF-α induce IL-1β production8,26,40. IL-6 is another important pro-inflammatory cytokine that served as a hallmark for the systemic activation of pro-inflammatory cytokines37. Participation of IL-17 has been documented during the establishment of several inflammatory diseases such as inflammatory OA41,42. Moreover, patients with OA reported elevated levels of IL-6 and Il-17 in synovial fluid41,43. Conversely, IL-4 and IL-10 are vital anti-inflammatory cytokines reported to down-regulate the expressions of pro-inflammatory cytokines44,45. Recently, IL-10 has been reported to inhibit the production of TNF-α and its mediated events during the development of OA44.
In the present investigation, elevated synovial RANKL/OPG ratio suggested the bone loss in AIA control rats, however, administration of AA-PP showed bone protection via inhibition of the RANKL/OPG pathway and thus halted the disease progression and improved the bone healing process. RANKL is a member of the TNF superfamily mainly involved in regulating osteoclast formation and bone resorption46. Studies in knock-out mice suggested that up-regulated expression of RANKL and TNF expedited the disease onset thus, increasing the severity of OA47. Additionally, elevated expression of RANKL has been reported in the cartilage samples from OA patients48. Therefore, the crucial role of RANKL has been well reported during bone loss and inflammation. On the other hand, OPG is another member of the TNF receptor family that acts as a decoy receptor to oppose the binding of RANKL49. A decreased expression of OPG has been reported in the serum of patients with knee osteoarthritis49. OPG is responsible for the inhibition of the physiological function of RANKL, thus preventing the process of osteoclastogenesis. The researcher documented the importance of the RANKL: OPG ratio during the pathogenesis of OA48,49. Evidence suggested that processes such as postmenopausal osteoporosis, bone fracture and bone loss are associated with the imbalance in the ratio of RANKL: OPG46,50. The abnormal RANKL: OPG ratio is known to cause osteoclast-induced bone destruction in OA. This process is triggered by the interactions between RANKL and OPG, limiting the formation of osteoclasts. The increased expression of the RANKL and the low levels of the antagonist OPG increase the risk of joint osteoblastosis. Moreover, osteoblasts and osteoclasts are the important regulators of bone metabolism and osteoclast homeostasis51. The increased activity of these two regulators leads to dynamic changes in bone turnover and loss.
Elevated osteocalcin and diminished RUNX2 expressions in AIA control rats suggested their importance during the bone healing process, which is in line with the previous investigators52-54. Conversely, AA-PP treatment attenuated bone fracture-induced alterations in osteocalcin and RUNX2 mRNA expressions depicting its bone healing property. Numerous pieces of evidence documented the association of bone GLA protein, osteocalcin with bone development and cartilage regeneration53,55. Osteocalcin is a non-collagenous protein of the bone matrix thus, it is a sensitive marker of bone metabolism and plays a role in the formation of bone. A recent study by Bihlet et al.54 documented a significant association of osteocalcin levels with the severity of female patients with knee OA. Furthermore, RUNX2 (also known as Core-binding factor-alpha-[CBFA1]) protein is a crucial component of chondrocyte and osteoblast differentiation52. In chondrocyte-specific Runx2 knock-out mice, elevated expression of RUNX2 prevented DMM-induced cartilage degradation suggesting its importance during the cross-talk between the subchondral bone and cartilage52. It is an important transcription factor that plays a crucial role in the induction of proliferative chondrocyte hypertrophy and the development of osteoblast differentiation. Thus, Runx2 is well known for its role in the development and maintenance of OA. A previous study showed that when cartilage tissue was damaged after knee joint instability, global Runx2 expression levels decreased56. Studies have shown the postnatal role of RUNX2, evidenced by its minimal expression in articular cartilage52,53. The decrease in RUNX2 expression was also evidenced by the accelerated rate of cartilage degeneration and delayed bone healing57.
Recently it has been well understood that drug development for managing complex and relapsing disorders, including OA, has more relevance by using a multitarget approach for better clinical benefits. Single molecule-target-based management of chronic diseases may result in drug resistance or disease progression may occur quickly. Thus, in the present investigation, we have observed that administration of peptide/polypeptide fraction from Aloe vera improved bone repair in AIA rats via inhibition of RANKL/OPG signalling pathway, activating osteocalcin and balancing inflammatory cytokines levels.
CONCLUSION
The present study demonstrated that a peptide/ polypeptide fraction from Aloe vera showed the potential efficacy against surgically induced bone damage in a rat model of adjuvant-induced arthritis. AV-PP improves bone repair and attenuates cartilage degeneration by inhibiting the RANKL/OPG signalling pathway, activating osteocalcin and balancing inflammatory cytokines levels in experimental arthritic rats.
SIGNIFICANCE STATEMENT
This study discovered that the peptide/polypeptide fraction from Aloe vera has repair potential against osteoporotic fractures among osteoarthritis patients. Additionally, findings revealed putative mechanisms of bone repair by inhibiting the RANKL/OPG signalling pathway, activating osteocalcin and balancing inflammatory cytokines. This study will help the researcher to find new complementary and alternative medicine for managing bone repair during osteoarthritis.