Abstract: Background and Objective: Prevalence of Metabolic Syndrome (MS) is increasing with the passage of time and it cause serious complications on people’s health and affect their quality of life. This study aimed to explore the therapeutic effect of ginsenoside Rb1 on modulating the glycolipid metabolism via PPARs and AMPK-ACC pathway in metabolic syndrome mice. Materials and Methods: Ten male C57BL/6 mice were conducted as a control group. Forty male ob/ob mice were divided into four groups: Model group, ginsenoside Rb1 high-dosage group, medium -dosage group and low-dosage group. Rb1 was intraperitoneally injected into the mice for 21 days with 10, 20 and 30 mg kg–1/day. An equivalent volume of physiological saline was given to the control and model groups. Then, we tested blood lipids, AST, ALT, liver fat, serum insulin, FFA and adiponectin. Moreover, the mRNA levels of PPARs and proteins of AMPK-ACC pathway was also analyzed. Results: The index of HOMA-IR, blood lipids, liver index and liver transaminase in the model group were significantly higher than those in the blank group (p<0.01). Moreover, Pathological sections showed disorder of liver lobules, swelling of liver cells and many lipid droplets. The medium-dose group can significantly reduce the Homeostatic Model Assessment for Insulin Resistance (HOMA-IR) index (p<0.01), the reduction of the liver index and liver TG content was more significant in the high-dose group (p<0.05). Medium and high dosage groups could reduce FFA content and increase ADPN content (p<0.05). The expression levels of PPARs decreased linearly with increasing doses. Ginsenoside Rb1 could increase the protein expression levels of pAMPK and pACC (p<0.05) with no significant difference between groups (p>0.05). Conclusion: Ginsenoside Rb1 could significantly lower blood sugar and reduce lipid accumulation after 3 weeks of administration. The mechanism may be involved in regulating the level of adiponectin to improve IR. Through stimulating AMPK activation, increasing liver FFA oxidation, it thereby removed excess liver lipids.
INTRODUCTION
The prevalence of Metabolic Syndrome (MS) is increasing year by year and its related complications seriously endanger people’s health and affect people’s quality of life, which brings huge challenges to basic medicine and clinical research1. It is a common belief that the interaction between genetic and environmental factors leads to the occurrence of MS2. MS refers to a syndrome caused by disorders of the body's metabolism of fats, carbohydrates and proteins. The pathogenesis of MS involves changes in multiple systems such as heredity, endocrine and immunity. The core is Insulin Resistance (IR)3 and the basic pathological change is glucose and lipid metabolism disorders4. There is no clinically effective drug to improve IR and the application of insulin sensitizers-thiazolidinediones (TZDs) has been limited in the case of abnormal liver and kidney function5. Therefore, the development of new hypoglycemic and lipid-lowering drugs has become a hot spot in current research.
IR is the main feature and sign of MS6 and visceral obesity is the main determinant of MS7, it induces glucose and lipid metabolism disorders and participates in metabolic and cardiovascular complications. Among the organs with visceral fat accumulation, the liver is the first to be affected. When IR promotes the increase of Free Fatty Acids (FFA) in the blood, too much FFA deposition can lead to non-alcoholic fatty liver (NAFLD), leading to increased liver transaminase and even changes in liver structure, leading to fatty hepatitis or liver cirrhosis, this is the famous "second hit" theory8. FFA is a decomposition substance of neutral fat and it is a non-esterified fatty acid carried by serum protein in blood lipids. Blood FFA can react to the body's blood sugar, abnormal blood lipid metabolism and related diseases earlier and more sensitively than other blood lipids, such as obesity, dietary imbalance, etc9. Adiponectin (ADPN) is an adipocyte factor discovered in recent years. It has the effects of reducing IR, promoting glucose and lipid metabolism, anti-atherosclerosis and anti-inflammatory. Peroxisome proliferator-activated receptors (PPARs) is the main regulator of fat cell gene expression and insulin cell signal transmission and are involved in lipid and glucose metabolism regulation10. Insulin can activate the expression of PPARs. When the insulin level in the blood continues to rise (in IR state), the expression level of PPARs increases. Studies have found that Adenylate-activated protein kinase (AMPK) not only plays an important role in regulating glucose and lipid metabolism, blood pressure and immune function but also participates in the occurrence and development of various metabolic diseases as well as the physiological effects of adipocytokines11. AMPK regulates lipid metabolism mainly to inactivate the phosphorylation of acetyl CoA carboxylase (ACC), which is the key enzyme for fatty acid synthesis, the downstream substrate, thereby inhibiting fat synthesis and reducing fat accumulation in peripheral tissues12.
It should be the best choice to make use of the advantages of traditional Chinese medicine to dig out therapeutic drugs that have small side effects and comprehensive effects such as lowering lipids, lowering glucose and losing weight. Ginsenoside Rb1 is the most abundant and important tetracyclic triterpene saponins in ginseng. It has anti-lipid peroxidation, scavenging free radicals, inhibiting lipid accumulation in 3T3-L1 adipocytes and other pharmacological activities, it can reduce weight loss13, enhance the differentiation of insulin β cells14. Its target and mechanism need to be further explored. This topic intends to further explore its mechanism of action based on verifying the effect of ginsenoside Rb1 in reducing blood sugar and lipid, to make it an ideal drug for the treatment of MS glucose and lipid metabolism disorders.
MATERIAL AND METHODS
Study area: The study was carried out at Laboratory of College of Traditional Chinese Medicine, JINAN University, China from September-December, 2019).
Mouse treatment: All animal experiments were performed according to the Institutional guidance for Care and Use of Laboratory Animals and the experimental protocols were approved by the Ethics Committee for Experimental Research from Jinan University with an ethics number IACUC-20190909-09. Male ob/ob (B6.Cg-Lepob/JNju) and C57BL/6 mice, SPF grade, 5-6 weeks, purchased from Nanjing University-Nanjing Institute of Biomedicine (license number: SCXK Su 2010-0001).They were kept in an SPF enclosed state in the Experimental Animal Center of Jinan University School of Medicine for 4 weeks, at a room temperature of 20°C, a relative humidity of 40-60%, a daily light for 12 hrs with free food and water. Forty ob/ob mice were randomly divided into a model group, ginsenoside Rb1 low, medium and high dose groups, 10 in each group.10 C57BL/6 mice were given intraperitoneal injections of double distilled water as the blank group. The model group was given with intraperitoneal injection of ginsenoside Rb1 aqueous solution every day separate in low, medium and high doses of 10, 20 and 30 mg kg–1 b.wt., respectively. Body weight and food intake were accounted daily.
Material: Ginsenoside Rb1 20 mg (molecular formula C54H92O23, purity 98%), purchased from Guangzhou Qiyun Biotechnology Co., Ltd. All other reagents were of analytical grade. RNAiso plus., SYBR Green Premix qPCR, RT-PCR Kit, RNase Free water were purchased from Japan TAKARA Co., Ltd. (Japan). Insulin ELISA kit (H203-1-2), FFA ELISA kit (H231) and ADPN ELISA kit (H179) were acquired from Nanjing Jiancheng Biotechnology Co., Ltd (Nanjing, China). The PBS buffer, Trionx, TBS and Balsam neutral were acquired in Saiguo Biological Technology Co., Ltd. (Guangzhou, China). Page RμLer Prestained Protein Ladder and Marker were from Thermo (Waltham, US). The PVDF membrane was captured from Millipore (Billerica, US). Phosphatase inhibitor cocktail 1(RBG2012) and a BCA protein content test kit (AAPR161-A30) were got from Nanjing Kaiji Biotechnology Co., Ltd. (Nanjing, China). RIPA (P0013), Primary anti-diluent, secondary antibody dilution, WB transfer solution, WB electrophoresis solution were purchased in Beyotime Biotechnology (Shanghai, China). Polyclonal rat anti-rabbit AMPK (5832), pAMPK (2535), ACC (3676), pACC (11818) and GAPDH (5174) were acquired from Cell Signaling Technology Co. Ltd. (US). All dilutions were 1:1000.
Biochemical Indicators measurement: Collect blood samples by removing the eyeballs in dry EP tubes. Then quickly open the abdomen on ice to remove the liver tissue, rinse it in saline to remove blood, put it on a filter paper to absorb the water and weigh the liver:
After the blood clot shrinks, centrifuge at 4 3500 rpm for 10 min to separate the plasma and take the serum to measure four blood lipids and liver transaminase. HOMA-IR index is calculated based on fasting blood glucose level (mmol L–1)×fasting insulin level (mI UL–1)/22.5. Serum concentrations of alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglycerides (TG), Total Cholesterol (TC), Low Density Lipoprotein Cholesterol (LDLC) and high density lipoprotein cholesterol (HDLC) were determined by Biochemical Laboratory Testing of the First Affiliated Hospital of Jinan University Guangzhou Overseas Chinese hospital.
Histopathological examination: Liver tissue samples fixed in 10% formalin were embedded with paraffin for histological analysis. H and E staining was performed according to the manufacturer's protocol. Frozen liver tissues were sectioned (5 μm thick) using a freezing microtome (Leica Microsystems, Buffalo Grove, IL). In addition, Sections were stained with Oil Red O and counterstained with haematoxylin to detect hepatic lipid accumulation.
Insulin, FFA and ADPN level detection: Serum concentrations were determined by sandwich ELISA. Mice were anesthetized and blood was taken through the abdominal aorta, got nearly 8 mL blood from every rat. The blood collection was centrifuged at 3000 rpm for 15 min at 4°C. The obtained supernatant was 800 μL, which was used to detect the levels of Insulin, FFA and ADPN using the Insulin Assay Kit, Free Fatty Acid Assay Kit and Adiponectin Assay Kit according to the manufacturer's instructions. A microplate reader was used to analyze the optical density value.
Quantitative real-time PCR: The total RNA of mice liver was isolated using RNAiso plus. RT qPCR was performed with an ABI 7900HT system using SYBR Premix according to the manufacturer's instructions. Glyceraldehyde 3 phosphate dehydrogenase (GAPDH) was used as an internal control. Micronucleic acid spectrophotometer was used to conduct RNA concentration. Then, wesynthesized RNA into cDNA following the instructions of T-PCR Kit. Lastly, QPCR was carried out on Applied Biosystems 7900 real-time PCR systems with SYBR GreenPremix qPCR and the primers were as following:
| Gene | Forward primer (5'->3') | Reverse primer (5'->3') |
| PPARα | CTGTCGGGATGTCACACAATGC | TCTTTCAGGTCGTGTTCACAGGTAA |
| PPARγ | TCATCTCAGAGGGCCAAGGATTC | TGCATTGAACTTCACAGCAAACTCA |
| GAPDH | AGAAGGTGGTGAAGCAGGCATC | CGAAGGTGGAAGAGTGGGAGTTG |
Western blot analysis: The expressions of AMPK, ACC, pAMPK and pACC on mice liver tissue were checked via western blot. Protein from each liver sample was extracted with lysis buffer at 4°C. Then, the extracts were centrifuged at 12,000 r min–1 and 4°C for 15 min and the supernatants of these tissues were used for Western blotting analysis. Protein concentration was committed using the BCA assay. After electrophoresis, the protein was taken to PVDF membranes and blocked with 5% skimmed milk powder for 1 hr at room temperature. Membranes were incubated with primary antibody (diluted according to the manufacturer’s instructions)overnight at 4°C. The next day, the membranes were incubated with 1:5000 dilution of horseradish peroxidase conjugated secondary antibody for 1 hr at room temperature. After washing three times with TBST, the blots were hybridized with secondary antibodies conjugated to horseradish peroxidase. The proteins were visualized by enhanced chemiluminescence. Western blotting had to be carried out using Image Lab software for grey value analysis.
Statistical analysis: All data are presented as Mean±Standard Error (SE). In vitro experiments were carried out in triplicate and performed on three to five separate occasions. After testing for homogeneity of variance, LSD method was used for homogeneous variance and Tamhane's T2 method was used for uneven variance to test the significance of the differences between groups.
RESULTS
Body weight and food intake of mice in each group: As shown in Table 1, the initial body weight of the model group mice was significantly higher than that of the blank group mice (p<0.01), There was no significant difference in initial body weight (p>0.05). After intervention, compared with the blank group, the weight gain and food intake of mice in the model group were significantly increased (p<0.01), Compared with the model group, the weight gain and food intake of mice in each drug intervention group were not statistically significant (p>0.05) but it can be seen that as the dose increases, its increasing trend gradually slows down (Fig. 1).
Changes of insulin sensitivity index in each group: As shown in Fig. 2a-c, compared with the blank group, the fasting blood glucose, insulin and HOMA-IR index of the model group mice were significantly increased (p<0.01), Compared with the model group, the fasting blood glucose, insulin and HOMA-IR index of the mice in each drug intervention group were significantly decreased (p<0.01), while the fasting blood glucose and HOMA-IR index of the mice in the middle-dose group were lower than those in the low-dose group (p<0.01). It was suggested that ginsenoside Rb1 can reduce fasting blood glucose and insulin levels in ob/ob mice and improve IR. The effect of medium dose ginsenoside Rb1 is more obvious.
| Table 1: Body weight and food intake of mice in each group (g, x̄±s) | |||||
| Groups | N |
Initial body weight g |
Final body weight (g) |
Weight gain (g) |
Food intake (g) |
| Blank group | 10 |
19.61±0.55 |
21.55±0.99 |
1.94±0.72 |
2.73±0.19 |
| Model group | 10 |
36.79±3.05** |
44.60±2.26** |
7.81±1.37** |
5.81±0.35** |
| Low doseRb1 | 10 |
34.43±3.47 |
41.31±2.87* |
6.88±1.05 |
5.77±0.20 |
| Medium dose Rb1 | 10 |
33.02±2.13 |
39.55±1.84* |
6.54±1.38 |
5.65±0.28 |
| High dose Rb1 | 10 |
35.34±2.86 |
41.28±2.88* |
5.94±1.93 |
5.56±0.44 |
| Initial body weight of the model group mice was significantly higher than that of the blank group mice **(p<0.01), the final body weight of the Rb1 group mice was significantly lower than that of the model group mice*(p<0.05) | |||||
| Fig. 1: | Body weight changes of mice in each group |
| Fig. 2(a-c): | Comparison of insulin sensitivity indexes of mice in each group |
Changes in blood lipids of mice in each group: As shown in Fig. 3a-d compared with the blank group, the four items of blood lipids in the model group were significantly increased (p<0.01), Compared with the model group, the four blood lipids of the mice in the middle dose group were significantly decreased (p<0.05), the serum TC, TG and LDL-C levels of the mice in the high-dose group were significantly lower than those in the model group (p<0.05), while the serum HDL-C There was no significant difference (p>0.05). Compared with the low-dose group, the middle and high-dose groups were not statistically significant (p>0.05). Prompt: Human body Ginsenoside Rb1 can effectively improve hyperlipidemia in ob/ob mice.
Changes of related indicators of mouse liver in each group
Changes in liver wet weight and liver index: As shown in Table 2, compared with the blank group, the wet liver weight and liver index of mice in the model group were significantly increased (p<0.01). Compared with the model group, each intervention group decreased significantly (p<0.05). Compared with the low-dose group, the liver index of the middle and high-dose groups decreased significantly (p<0.01). Medium and high doses of ginsenoside Rb1 can effectively reduce liver index.
Changes in liver TG and TC content: As shown in Fig. 4a-b, compared with the blank group, the liver TG content of the model group was significantly increased (p<0.01). Compared with the model group and the low-dose group, the liver TG content of mice in the high-dose group decreased significantly (p<0.05). Compared with the normal group, the liver TC content of the model group was not statistically significant (p>0.05). Ob/ob mice mainly show liver TG deposition. High dose ginsenoside Rb1 can effectively improve liver TG deposition in mice.
| Fig. 3(a-d): | Comparison of the four items of blood lipids in each group of mice |
| Table 2: Liver wet weight and liver index of mice in each group (x̄±s) | |||||
| Groups | N |
Liver wet weight (g) |
Liver index (%) |
||
| Blank | 10 |
0.86±0.12 |
3.99±0.39 |
||
| Model | 10 |
2.94±0.42** |
6.41±0.51** |
||
| Low dose Rb1 | 10 |
2.31±0.17ΔΔ |
6.02±0.66 |
||
| Medium dose Rb1 | 10 |
2.24±0.17ΔΔ |
5.02±0.42ΔΔ▲▲ |
||
| High dose Rb1 | 10 |
1.92±0.22ΔΔ▲ |
4.34±0.46ΔΔ▲▲ |
||
| Wet liver weight and liver index of mice in the model group were significantly increased, compared with the blank group**. Compared with the model groupΔΔ, each intervention group decreased significantly. Compared with the low-dose group▲▲, the liver index of the middle and high-dose groups decreased significantly | |||||
ALT and AST changes: As shown in Fig. 5a-b, compared with the blank group, the serum ALT and AST levels of the model group were significantly increased (p<0.01), compared with the model group, there was no statistical significance in the medication group (p>0.05). Tip: Ob/ob mice have severe liver damage but ginsenoside Rb1 cannot improve liver damage in ob/ob mice.
Liver pathological changes: The liver of the blank group was ruddy, soft, with sharp edges and smooth cut surfaces (Fig. 6a), the liver of the model group was yellowish-brown, enlarged in size, tough in texture, blunt edges and greasy in cut surfaces (Fig. 6b), in the Ginsenoside Rb1 group, the scattered fat spots were significantly reduced and the texture became soft (Fig. 6c).
| Fig. 4(a-b): | Comparison of liver lipid content of mice in each group (a): Compared with the blank group**, the liver TG content of the model group was significantly increased; compared with the model group and the low-dose group, the liver TG content of mice in the high-dose group decreased significantly. (b): Compared with the normal group, the liver TC content of the model group was not statistically significant |
| Fig. 5(a-b): | Comparison of serum ALT and AST levels of mice in each group (a): Serum ALT level of the model group was significantly increased, compared with the blank group**. (b): The serum AST level of the model group was significantly increased, compared with the blank group**. Compared with the model group, there was no statistical significance in the medication group |
HE staining: We may observe that the liver lobule structure of mice liver tissue in the blank group is normal, the outline is clear, the cell cords are neatly arranged, the liver sinusoids are normal, the liver cells are polygonal, the boundary is clear and the nucleus structure is clear (Fig. 7a). While liver lobules of mice liver tissue in the model group are difficult to identify, liver cells are swollen, nucleus is squeezed to the edge showing balloon-like or watery degeneration. There are also vacuoles of varying sizes in the cytoplasm which are caused by the dissolution of lipid droplets. Fat cells can also be seen, some of the nuclei are lysed (Fig. 7b). Compared with the model group, Ginsenoside Rb1 intervention group only shows mild steatosis and hepatocyte cords of liver tissue are arranged neatly. Most liver cells are basically intact and swell is not obvious. Some small lipid droplets and a small amount of inflammatory cell infiltration can be seen in some cells, occasionally bullous steatosis (Fig. 7c-e).
| Fig. 6(a-e): | Comparison of liver tissue appearance of mice in each group Liver of the (a) Blank group was ruddy, soft, with sharp edges and smooth cut surfaces; the liver of the (b) Model group was yellowish-brown, enlarged in size, tough in texture, blunt edges and greasy in cut surfaces; in the Ginsenoside Rb1 group (c-e), the scattered fat spots were significantly reduced, and the texture became soft |
| Fig. 7(a-e): | HE Staining Liver lobule structure of mice liver tissue in the blank group (a) is normal, the outline is clear, the cell cords are neatly arranged, the liver sinusoids are normal, the liver cells are polygonal, the boundary is clear, and the nucleus structure is clear. While liver lobules of mice liver tissue in the model group (b) are difficult to identify, liver cells are swollen, nucleus is squeezed to the edge showing balloon-like or watery degeneration. There are also vacuoles caused by the dissolution of lipid droplets. Fat cells can also be seen, some of the nuclei are lysed. Compared with the model group, Ginsenoside Rb1 intervention groups (c-e) only show mild steatosis and hepatocyte cords of liver tissue are arranged neatly. Most liver cells are basically intact and swell is not obvious. Some small lipid droplets and a small amount of inflammatory cell infiltration can be seen in some cells, occasionally bullous steatosis. Liver tissues of Ginsenoside Rb1 groups present better conditions compared with the model group |
| Fig. 8(a-e): | Oil red O staining In the blank group (a) a small amount of orange-red lipid droplets was seen. The model group (b) presents a large amount of red lipid droplets while the Ginsenoside Rb1 groups (c-e) were significantly reduced |
Oil red O staining: In the blank group, a small amount of orange-red lipid droplets was seen (Fig. 8a), in the model group, the red lipid droplets were significantly increased and some of the lipid droplets were fused into chains (Fig. 8b), the red lipid droplets of the drug intervention group was significantly reduced and decreased compared with the model group (Fig. 8c-e).
FFA and ADPN: Compared with the blank group, the serum liver FFA content of the model group was significantly increased and the ADPN content was significantly reduced (p<0.01). Compared with the model group, the FFA content of mice in the middle and high dose groups was significantly reduced (p<0.05, Fig. 9a), the ADPN content of mice in the middle and high dose groups was significantly increased (p<0.01 or p<0.05), compared with the low dose Compared with the groups, the content of ADPN in the middle-dose group increased significantly (p<0.01, Fig. 9b). Medium dose ginsenoside Rb1 can effectively increase the ADPN content of ob/ob mice and enhance insulin sensitivity.
PPARs mRNA expression level: Compared with the blank group, the expression levels of PPARα and PPARγ mRNA in the model group were significantly increased (p<0.01). Compared with the model group, the expression levels of PPARα and PPARγ mRNA at medium and high doses were significantly reduced (p<0.05 or p<0.01). Middle and high doses of ginsenoside Rb1 can effectively regulate the expression of PPARs mRNA in ob/ob mice (Fig. 10).
Western blot: The protein expression levels of AMPK, pAMPK, ACC, pACC, pAMPK/AMPK, pACC/ACC in the liver tissues of the model group were significantly lower than those in the normal group (p<0.01, Fig. 11a), compared with the model group, Rb1 significantly upregulated pAMPK, pACC and pAMPK/AMPK, pACC/ACC protein expression levels (p<0.01 or p<0.05, Fig. 11b-c) and there was no significant change between the high, medium and low dose groups. In ob/ob mice, AMPK and pAMPK are low expressed, which may be closely related to the occurrence and development of MS. Ginsenoside Rb1 can effectively up-regulate the phosphorylation level of AMPK, activate AMPK and then stimulate the inactivation of phosphorylation of ACC.
| Fig. 9(a-b): | Serum FFA and ADPN content of mice in each group Serum FFA content of the model group significantly increased compared with the blank group**; Compared with the model groupΔΔ, the FFA content of mice in the middle and high dose groups were significantly reduced (a), Medium dose ginsenoside Rb1 can increase the ADPN content compared with the low dose Rb1group▲▲, compared with the groups, the content of ADPN in the middle-dose group increased significantly |
| Fig. 10: | Expression levels of PPARα and PPARγ mRNA in each group of mice Compared with the blank group**, the expression levels of PPARα and PPARγ mRNA in the model group were significantly increased, Compared with the model groupΔΔ, the expression levels of PPARα and PPARγ mRNA at medium and high doses were significantly reduced |
DISCUSSION
The research confirmed that after the intervention of ginsenoside Rb1 for 3 weeks, the fasting blood glucose, insulin and HOMA-IR index of ob/ob mice decreased significantly, with the most significant decrease in the middle dose (p<0.01) (Fig. 2). Ginsenoside Rb1 can significantly improve IR and reduce lipid accumulation in the liver. ADPN activates AMPK activity through AMPK phosphorylation in peripheral tissues, enhances PPARα transcriptional activity and target gene expression (Fig. 10), reduces FFA to entry into the liver (Fig. 9), improves liver IR and reduces the production and polarity of liver glycogen and synthesis of low-density lipoprotein (Fig. 4-8, Table 2). Ingalls15 discovered an inbred mouse who overate, gained weight rapidly and suffered from infertility and diabetes. This strain of home mouse was named ob/ob mouse, which opened a new era. Ob/ob mice (full name of the strain: B6.Cg-Lepob/JNju) are homozygous mice with spontaneous mutations.
| Fig. 11(a-c): | Expression of AMPK, pAMPK, ACC and pACC in liver tissues of mice in each group Characters A, B, C, D, E in (a) respectively represent the blank group, the model group, low dose Rb1 group, medium dose Rb1 group and high dose Rb1 group. Compared with the model group, Rb1 significantly up regulated pAMPK, pACC and pAMPK/ AMPK, pACC/ACC protein expression levels (b-c) |
They are defective in the leptin gene encoded by the OB gene, which triggers the syndrome of metabolic and endocrine disorders and manifests as excessive obesity. Currently, there are three types of animal models used to study MS: Feeding type, manual intervention type and congenital genetic type. The method using feeding type has a high replication rate and is simple and easy to implement but the modeling time generally requires a cycle of 3 to 4 months16. Also, it has not developed in the direction of non-insulin-dependent diabetes, which is contrary to the pathogenesis of human MS17. The manual intervention type mainly including surgical intervention and drug induction has large artificial interference factors. And drug induction has tissue toxicity to animals. At present, the genetic mouse model commonly used to study MS in ob/ob mice, which are mainly manifested as obesity, hyperglycemia, hyperinsulinemia, liver lipid accumulation and IR18-21. Because ob/ob mice have the particularity of "leptin deficiency", it avoids the influence of leptin on ADPN, PPARs and AMPK-ACC signal pathway and can more objectively reflect the influence of ginsenoside Rb1 on the signal pathway. In addition, we chose male ob/ob mice to avoid the interference of periodic hormone changes in female mice on the readings of various indicators22-24. The experimental results showed that ob/ob mice were fat and their weight increased by 187.6% compared with mice in the blank group and their weight gain was significantly faster by 212.8% (Table1). Mattews25 and others pioneered the use of the HOMA-IR index to assess insulin sensitivity and it was widely used by future generations. The HOMA-IR index is significantly correlated with the insulin clamp technique. It is simple and easy to implement and highly reliable. Therefore, it is feasible to use this method to assess the IR degree of MS mice.
According to research results, after the intervention of ginsenoside Rb1, there was no significant difference in weight gain and food intake (Table 1), which is consistent with the research result of Ling N et al.26 that "Ginsenoside Rb1 interfering with 2 weeks can effectively reduce the food intake and body weight of obese mice induced by high-fat diet (p<0.01). "There is a deviation, which may be caused by animal species. Ling N et al. used high-fat diet to model. In normal rodents ginsenoside Rb1 can significantly reduce the level of leptin, improve leptin resistance, reduce the level of hypothalamus NPY and mRNA expression, thereby inhibiting the appetite of obese mice and reducing weight26. However, ob/ob mice are models of spontaneous mutations of leptin deficiency, which deviate from Ning L's research. Although in ob/ob mice, after the intervention of ginsenoside Rb1, the weight gain and food intake of ob/ob mice were not statistically significant but it can be seen from Fig.1 that with the increase in the dose of ginsenoside Rb1, the growth trend of the two gradually slowed down. It is speculated that the mechanism of ginsenoside Rb1 exerting weight loss is various. Although ob/ob mice lack leptin's regulation of the central nervous system, long-term intervention can also reduce body weight.
Studies have shown that the level of FFA is closely related to the occurrence of IR and is the key to linking IR, NAFLD, T2DM and MS. Exogenous fats ingested by healthy people are stored in adipose tissue in the form of TG, which can prevent fat spills from causing damage to organs such as muscles, liver and pancreas. The ability of adipose tissue to store TG in patients with T2DM, obesity and IR decreases and lipolysis is enhanced. Lipolysis, also known as fat mobilization, refers to the decomposition of fat into glycerol and fatty acids under the action of related lipolytic enzymes, which are released into blood supply tissues for oxidation and provide energy. Decreased lipolysis can promote the accumulation of TG in adipose tissue. Excessive intake of exogenous fat will increase the circulating FFA and TG concentration. Excessive fat deposition in tissues induces IR, leading to T2DM and obesity27-28. The results suggest that ginsenoside Rb1 can effectively reduce FFA excessive spillover and reduce circulating FFA concentration, thereby improving IR and glucose and lipid metabolism (Fig. 9). In addition to the large accumulation of FFA in the body, the occurrence of IR is also related to the abnormal expression of a series of adipokines. ADPN is a protein secreted specifically by fat cells, which has the effect of increasing insulin sensitivity and antagonizing IR, so it is called "insulin sensitizing factor"29. Studies have shown that the level of ADPN is negatively correlated with body mass index and positively correlated with insulin sensitivity. The expression and content of ADPN increase after weight loss30. The results show that after the intervention of ginsenoside Rb1, the content of ADPN increased significantly, with the middle-dose group having the most significant effect (p<0.05) (Fig. 9). It was suggested that ginsenoside Rb1 can accelerate the secretion of ADPN from adipocytes, thereby enhancing insulin sensitivity, improving glucose tolerance and IR.
The oxidative metabolism of FFA in the liver is mainly related to the expression and transcriptional activity of PPARα31. Reddy32 discovered that mice with PPARα-deficient genes would have severe NAFLD and abnormal energy metabolism. Studies have found that the continuous activation of PPARγ can accelerate the differentiation of adipocytes and cause significant obesity in individuals. In this project, we have observed that ob/ob mice have PPARα and PPARγ mRNA over expression, which is in line with the research results of Perfield33, "ob/ob mice are caused by the excessive activation of PPARs leading to obesity and severe IR. "It is suggested that ginsenoside Rb1 may slow down the differentiation of adipocytes, reduce the release and overflow of FFA and improve metabolic disorders by down regulating the over expressed PPARα and PPARγ (Fig. 10). AMPK can maintain the balance of energy supply and demand, regulate the body's energy metabolism and improve MS34. It is the core of the study of MS and other metabolic related diseases. Acetyl-CoA carboxylase (ACC) ,the target molecule of AMPK, is the rate-limiting enzyme of fatty acid synthesis and plays an important role in the metabolic process of fatty acids35. AMPK controls the activity of ACC by promoting the phosphorylation of ACC and inhibits the synthesis of FFA and TG. Current study showed that ginsenoside Rb1 can increase the phosphorylation level of AMPK and ACC in ob/ob mice liver and stimulate AMPK activation (Table 3). Ginsenoside Rb1 may phosphorylate AMPK, activate AMPK, inactivate ACC phosphorylation, promote fatty acid oxidation, reduce serum FFA levels and remove excess liver lipids (Fig. 11).
The results of this study show that the optimal doses for lowering blood sugar and lipids are not the same, considering that ginsenoside Rb1 exerts different mechanisms for lowering blood sugar and lipids (Fig. 3). In this project, we found that ginsenoside Rb1 has a two-way regulating effect on sugar metabolism and the best effect is achieved with a medium dose (20 mg kg–1/day). It is considered that the regulation of ginsenoside Rb1 on the balance of glucose metabolism may be by increasing ADPN levels, improving insulin sensitivity, improving IR, inhibiting excessive gluconeogenesis and glycogen output, reducing endogenous glucose production and thereby reducing blood sugar. As a hormone secreted by adipose tissue, ADPN can not only enhance insulin sensitivity but also promote fatty acid oxidation and reduce visceral fat accumulation. Studies have shown that ADPN plays a role by binding to its receptor, which has two subtypes AdipoR1 and AdipoR236. AdipoR2 can up regulate the transcriptional activity of PPARα and the expression of target genes37 and enhance insulin sensitivity. At the same time, PPARs can induce the expression of AdipoR2 and play a positive regulatory effect on it38. In this study, ginsenoside Rb1 can effectively down-regulate the level of over-expressed PPARs mRNA. As the dose increases, the down-regulation trend decreases linearly.
| Table 3: Comparison of pathway expression levels (x̄±s) | |||||
| Groups | AMPK/GAPDH |
pAMPK/GAPDH |
ACC/GAPDH |
pACC/GADPH |
|
| Blank | 0.287±0.054 |
0.905±0.141 |
0.448±0.070 |
0.432±0.090 |
|
| Model | 0.029±0.011** |
0.340±0.092** |
0.031±0.004** |
0.024±0.005** |
|
| Low dose Rb1 | 0.305±0.060 |
0.837±0.151ΔΔ |
0.400±0.038 |
0.371±0.046ΔΔ |
|
| Medium dose Rb1 | 0.322±0.070 |
0.893±0.221ΔΔ |
0.457±0.055 |
0.415±0.061ΔΔ |
|
| High dose Rb1 | 0.342±0.949 |
0.941±0.158ΔΔ |
0.461±0.060 |
0.466±0.072ΔΔ |
|
| Protein expression levels of AMPK, pAMPK, ACC, pACC, pAMPK/AMPK, pACC/ACC in the liver tissues of the model group were significantly lower than those in the blank group** | |||||
High-dose ginsenoside Rb1 excessively down-regulates the expression level of PPARs and reduces the activity of PPARs, thereby affecting the expression of AdipoR2 and reducing insulin sensitivity. In addition, ADPN can mediate the enhancement of AMPK activity through its receptor AdipoR1, promote fatty acid β oxidation and reduce TG accumulation39. The regulation of ginsenoside Rb1 on lipid metabolism balance may be through AdipoR1 activation of AMPK, which makes downstream ACC phosphorylation inactive, thereby inhibiting fat synthesis, reducing ectopic deposition of TG in the liver and correcting lipid metabolism disorders.
CONCLUSION
Ginsenoside Rb1 could significantly lower blood sugar and reduce lipid accumulation after 3 weeks of administration. The mechanism may be involved in regulating the level of adiponectin to improve IR. Through stimulating AMPK activation, increasing liver FFA oxidation, it thereby removing excess liver lipids.
SIGNIFICANCE STATEMENT
Current article studied the effect of ginsenoside Rb1 in reducing the blood sugar and lipid and make it an ideal drug for the treatment of MS glucose and lipid metabolism disorders. Ginsenoside Rb1 could significantly modulate glucose and lipid metabolism. The mechanism may be involved in regulating the level of adiponectin to improve IR by stimulating AMPK activation, increasing liver FFA oxidation, it thereby could be an ideal drug for the treatment of Metabolic Syndrome.
ACKNOWLEDGMENT
Thanks for the supporting work of Institute Of Laboratory Animal Science, Jinan University. This work was supported by the National Natural Science Foundation of China (No.81874404).