Abstract: Background and Objective: The effects of PDEIs on neuroprotective SIRT1 and SESN2, on the autophagy-related proteins, are unknown but neuroprotective enzymes (sirtuins and sestrins) with autophagy genes are involved in the pathogenesis of Alzheimer's disease. In this study, we aimed to elucidate the effect of three PDE Inhibitors (PDEIs) as autophagy enhancers and provide insights into their neuroprotective effects. Materials and Methods: HT-22 cells were exposed to Aβ25-35 with or without PDEIs for 32 hrs. qRT-PCR was performed for SIRT1, SESN2, ATG5 and BECN1 genes. Western blot analysis was performed for neuroprotective SIRT1, SESN2 proteins and autophagy proteins such as p-mTOR/mTOR, p-AMPK/AMPK and LC3. Results: Aβ25-35 exposure decreased SIRT1, ATG5 and BECN1 expression, while PDEIs prevented these genes from the Aβ25-35 induced decrease. Increased SESN2 gene expression by Aβ25-35 exposure was decreased by PDEIs treatment. Western blot experiment has also shown that SIRT1, p-AMPK and autophagy marker LC3II were decreased, whereas SESN2 and p-mTOR were elevated in the Aβ25-35 exposed HT-22 cells. Co administration of three PDEIs with Aβ25-35 recovered SIRT1, p-AMPK and LC3II decline and compensated SESN2 increase by elevating SIRT1, p-AMPK and LC3II expression and decreasing p-mTOR expression. Conclusion: The present study revealed the significant neuroprotective and autophagy stimulating potential of three PDEIs in Aβ-induced in vitro AD model. SIRT1 is a novel candidate for determining new, safe and effective treatment strategies and PDEI-mediated SIRT1 increase may advocate autophagy activation through different autophagy components.
INTRODUCTION
The accumulation of beta-amyloid peptide (Aβ) plays a major role in the initial pathologic phases of Alzheimer's Disease (AD). Alzheimer’s disease typically destroys neurons and their connections in parts of the brain involved in memory, including the entorhinal cortex and hippocampus and is the most common form of dementia1. Macroautophagy (hereafter, autophagy) is a catabolic process of damaged organelles or protein aggregates such as Aβ and impairment or misregulation in some steps of autophagy along with the neuroprotective pathways that are associated with many neurodegenerative diseases, including AD2.
Changes in PDE mRNA expression were detected in Alzheimer's disease3. Aβ-induced memory deficit and synaptic plasticity are observed in decreased cAMP signalling following Aβ treatment4 and blockage of Aβ oligomerization. Several studies emphasized that some PDEIs are autophagy enhancers and provide insights into the molecular basis of the potential treatment of neurodegenerative disorders including AD5,6.
Up to date, new cellular signalling pathways have been identified in the pathogenesis of AD including sirtuin 1 (SIRT1; Silent Information Regulator Protein-1)7, sestrin-2 (SESN2), 5'Adenosine Monophosphate-activated Protein Kinase (AMPK) and mammalian target of rapamycin (mTOR). These signalling pathways may provide novel therapeutic targets to slow down or prevent the development of Alzheimer’s disease.
Sirtuins have roles in cell viability, induction of autophagy, inhibition of apoptosis, oxidative stress, suppression of inflammation8 and regulation of neuronal signalling. Apart from these SIRT1 also induces AMPK and facilitates mitochondrial function both in vitro and in vivo9,10. SIRT1 also reduces APP amyloidogenic processing and Aβ deposition and exerts protective activity against neurodegeneration7. It has been reported that SIRT1 deficiency or loss leads to the accumulation of Aβ and microtubule-dependent protein tau in the brain cortex of AD patients11.
The autophagy-related genes ATG5, beclin-1 (BECN1) and autophagy marker microtubule-associated protein 1 light chain 3II (LC3II) are involved in the degradations of Aβ2,12,13. SIRT1 can activate autophagy by deacetylating this essential components14,15. BECN1 also plays an initiating role as an essential component of the autophagic pathway16,17.
Increasing evidence has shown that sestrins can protect cells by reducing oxidative stress and apoptosis in neurodegenerative disease models, most of which target mTOR as a downstream factor. SESN2 plays a crucial role in antioxidant defences through regulation of the AMPK/mTOR pathway which controls cell growth and metabolism18,19. We have recently elaborated that SESN2 was activated in human neuroblastoma (SHSY-5Y) cells in response to Aβ1-42. It was also denoted that the expression of SESN2 stimulates and regulates autophagy. Therefore, it was suggested that SESN2 induction plays a protective role against Aβ neurotoxicity through autophagic pathway20,21.
The effects of PDEIs on neuroprotective SIRT1 and SESN2, on the autophagy-related proteins AMPK/mTOR, ATG5 and BECN1 and the autophagy marker LC3-II are unknown. Therefore, we have associated the neuroprotective enzymes (sirtuins and sestrins) with autophagy genes in an attempt to understand how autophagy is involved in the pathogenesis of AD and how therapeutic approaches for AD could exploit autophagic pathways.
In the present study, we investigated the effect of three PDEIs on the neuroprotective SIRT1 and SESN2, via activation of AMPK and subsequent inhibition of mTOR signalling pathway and autophagy proteins (ATG5, BECN1 and LC3II) in the Aβ25-35-stimulated mouse hippocampal neuronal cells (HT-22).
MATERIALS AND METHODS
Study area: This research was conducted at Hacettepe University and Atlas Biotechnology between 16.11.2018-12.08.2020. This study does not require Animal Ethic Community Permission because the cell cultures purchase commercially.
Cell culture and treatment: Mouse hippocampal neurons (HT-22) were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS), 1% L-glutamine and penicillin/streptomycin (10000 U mL–1) in an incubator at 37°C and 5% CO2. To evaluate the direct effect of PDEIs in neuronal cells, PDEIs were used at 25, 50 and 100 μM (ibudilast; IB); 30, 100 and 300 μM (levosimendan LEV and vinpocetine; VIN) concentrations for 32 hrs. We continued PDEIs at 50 μM (ibudilast; IB), at 30 μM (levosimendan LEV) and 100 μM (vinpocetine; VIN) concentrations together with Aβ25-35 treatment (5 μM; 32 hrs) according to the literature. Aβ25-35 and PDEIs were administered when the confluency reached 70% and cells were analyzed 32 hrs later. After controlling cell morphology and confluency, cells were analyzed in ProteinEx Total Protein Extraction Solution (GeneAll, Seoul, Korea) including a Complete Protease Inhibitor Cocktail (Roche, Basel, Switzerland), DTT (Amresco Inc., OH, USA) and PMSF (Santa Cruz, Santa Cruz, CA USA) on ice. Cells were centrifuged at 14.000×g for 20 min at 4°C in a microcentrifuge. Protein contents of the supernatants were detected spectrophotometrically by Qubit® Protein Assay Kits (Thermo Fisher Scientific, Waltham, MA, USA). Cell lysates were stored at -80°C until the Western blot experiments could be performed.
Antibodies and pharmacological agents: The following primary antibodies and pharmacological agents were used in the present study: SIRT1, SESN2 antibodies (Bioassay Technology Laboratory, Shanghai, China), AMPK α1/2, phospho-AMPK α1/2 (Thr183/172), LC3B, mTOR, phosphor-mTOR (Ser2448), beta-actin antibody (Elabscience, Hubei, China). NuPAGE LDS Sample Buffer, NuPAGE Sample Reducing Agent, MES Running Buffer, Novex™ ECL Chemiluminescent Substrate Reagent Kit (ThermoFisher, Fisher Scientific, Waltham, MA, USA); Colour Protein Marker II, non-fat dry milk (Nzytech, Lisboa, Portugal), Iblot transfer stack Nitrocellulose kit, NuPAGE 4-12% Bis-Tris Gel, Western Breeze Kit (Invitrogen; Carlsbad, CA, USA); ibudilast nonspecific PDE 3,4,10,11, levosimendan PDE3I, vinpocetine PDE1I (Sigma Aldrich, St. Louis, MO, USA), Aβ25-35 human peptide (>97% HPLC) (Sigma-Aldrich, St. Louis, MO, USA). Treatments were performed in the normal cell medium; DMEM, L-glutamine, Trypsin EDTA, FBS heat-inactivated, PBS (Capricorn Scientific, Ebsdorfergrund Germany), penicillin/streptomycin (Biochrom AG, Germany), BSA, EDTA, Tris base, Tris HCl, SDS (Sigma Aldrich, St. Louis, MO, USA); glycine (AppliChem, Germany); protease inhibitor cocktail tablets (Roche, Basel, Switzerland); DTT (Amresco Inc., OH, USA); NaCl, Tween-20 (Merck, NJ, USA); methanol (Kimetsan, Ankara, Turkey); MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) was dissolved in dimethyl sulfoxide (Sigma Aldrich, St. Louis, MO, USA).
Preparations of Aβs: Aβ25-35 human peptide is regarded as the toxic fragment of full-length Aβ1-42. It was dissolved at 1 mg mL–1 in sterile distilled water. The unaggregated peptide was incubated at 37°C for 72 hrs and gently mixed to promote aggregation22. It was freshly prepared 72 hrs before the treatment23.
MTT reduction assay: Cell viability of HT-22 cells was evaluated by MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) reduction assay, MTT was dissolved in dimethyl sulfoxide (DMSO) at 50 mg mL–1 as a 100-fold stock solution. The cells were cultured in 96-well flat-bottom plates for 12 hrs and treated with various concentrations of PDEIs with or without Aβ25-35 for 32 hrs. At the end of the drug treatment, HT-22 cells were incubated in a culture medium with 0.5 mg mL–1 MTT in the dark at 37°C for 4 hrs for living cells to form insoluble.
| Table 1: Primer sequences of the neuroprotective and autophagy genes | ||
| Gene | Primer sequence | |
| SIRT1 | Forward |
5': TAGACACGCTGGAACAGGTTGC |
Reverse |
5': CTCCTCGTACAGCTTCACAGTC | |
| SESN2 | Forward |
5': AGATGGAGAGCCGCTTTGAGCT |
Reverse |
5': CCGAGTGAAGTCCTCATATCCG | |
| ATG5 | Forward |
5': GCAGATGGACAGTTGCACACAC |
Reverse |
5': GAGGTGTTTCCAACATTGGCTCA | |
| BECN1 | Forward |
5': CTGGACACTCAGCTCAACGTCA |
Reverse |
5': CTCTAGTGCCAGCTCCTTTAGC | |
| ACTB | Forward |
5': CACCATTGGCAATGAGCGGTTC |
Reverse |
5': AGGTCTTTGCGGATGTCCACGT | |
At the end of 4 hrs incubation, 150 μL of isopropyl alcohol was added to each well and plates agitated for 5 min to solubilize the crystals. The optical density was immediately determined at a wavelength of 570 nm with a microplate spectrophotometer (Biotek Instruments Inc, Winooski, VT, USA).
Determination of SIRT1, SESN2, ATG5 and BECN1 expression
by qRT-PCR: Using quantitative real-time PCR (qRT-PCR), SIRT1, SESN2, ATG5 and BECN1 gene expressions were assessed. Total RNA was extracted from the cells using the Total RNA Isolation System (Nzytech, Lisboa, Portugal) and the purity of obtained RNA was verified spectrophotometrically at 260/280 nm. The extracted RNA was then reverse-transcribed into complementary DNA using an RT-PCR kit (Strata Gene, La Jolla, CA, USA). Quantitative RT-PCR was performed using SYBR Green JumpStart Taq Read yMix (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s recommended thermal cycling protocol. β-actin (ACTB) was used as the internal reference control mRNA. Results are represented as the fold change in expression of target genes over control calculated using the 2^-ΔΔCT method24. The genes selected for qRT-PCR analysis and the sequence of the primers used are provided in Table 1.
Western blot analysis: Preparations of cellular protein extracts for Western blot analysis were performed as described in details in our recent study25. Protein samples were diluted with 4X Sample Buffer (5 μL), 10X NuPAGE Sample Reducing Agent (Thermo Fisher Scientific, Waltham, MA, USA) (2 μL), boiled and equal amounts of protein (50 μg) per lane were loaded onto 4-12% bis-Tris gradient gel, separated by electrophoresis and subsequently transferred to Iblot Transfer Stack Nitrocellulose Kit (Thermo Fisher Scientific, Waltham, MA, USA). Nonspecific protein binding was blocked by incubating the membranes in 5% non-fat dry milk in Tris-buffered saline (TBS, pH 7.4) for 2 hrs and then membranes were left overnight, incubating with rabbit primary antibodies at 4°C. All the primary and secondary antibodies were diluted in the fresh TBS-T buffer (0.05% Tween-20, 0.2 M NaCl in 20 mM Tris-HCl, pH 7.5) containing 5% non-fat milk or 5% BSA. The next day, after washing with TBS-T, membranes were incubated with the appropriate HRP-conjugated secondary antibodies in 5% non-fat dry milk or 5% BSA in Tris-buffered saline (TBS, pH 7.4) for 1 hr at room temperature. The immunoreactive bands were visualized using an enhanced chemiluminescence system and images were captured by the GEN-BOX Imager CFX (Ankara, Turkey). Blots were quantified by optical density using ImageJ 1.47 software and protein expression were normalized to β-actin (1:7500).
Statistical analysis: Data were expressed as the mean±SEM. Statistical analyses were performed using GraphPad Prism software (GraphPad 5.0; San Diego, CA 92108). One-way ANOVA and Tukey post hoc tests were used to compare multiple groups.
RESULTS
In this study, we have investigated the effects of PDEs on cell viability and the concentration of their correlation with the literature. Increasing concentrations of ibudilast (IB) at 25, 50, 100 μM, Levosimendan (LEV) and Vinpocetine (VIN) at 30, 100 and 300 μM for 32 hrs were used in the 50% confluent cells. We have observed that PDEIs increase cell viability in HT-22 cells compare to the Negative Control (NC) (Fig. 1; n = 4; *p<0.01). Aβ25-35 (5 μM) administration or the co-administration of Aβ25-35 together with PDEIs of the cells did not cause a significant alteration in cell viability (Fig. 2; n = 4; p>0.05, #p<0.05).
PDEIs did not harm cell viability at the concentrations applied and the cells continued normal growth for 32 hrs. Therefore, IB (25 and 50 μM) and LEV (30 μ) increased cell viability in the numerical and logarithmic ranges respectively (Fig. 1a-b).
A significant decrease in SIRT1 expression was observed with Aβ25-35 (5 μM; 32 hrs) in HT-22 cells. To determine whether PDEIs can prevent Aβ25-35-induced neurotoxicity by induction of neuroprotective SIRT1, we conducted the experiments which evaluated the expression level of SIRT1 in PDEIs treated Aβ25-35-exposed cells. PDEIs alone did not affect SIRT1 expression. IB (50 μM) significantly increased the SIRT1 expression in Aβ25-35-exposed cells. The co-administration of Aβ25-35 and LEV (30μM) prevented the Aβ25-35-induced decrease in the levels of SIRT1 and reversed SIRT1 back to the control levels. The co-administration of Aβ25-35 and VIN (100 μM) did not affect the decrease in SIRT1 expression (Fig. 2a).
Aβ25-35 (5 μM; 32 hrs) caused a significant boost in SESN2 10-fold, as compared to the control group. On the contrary, co-administration of Aβ25-35 and PDEIs decreased SESN2 levels when compared to the Aβ25-35 group (Fig. 2b). Therefore, PDEIs managed to reverse Aβ25-35-induced increase of SESN2 expression back to the control group (Fig. 2b).
Incubation of cells with 5 μM Aβ25-35 for 32 h resulted in a decrease in autophagy-related ATG5 gene expression. While IB (50 μM), LEV (30μM) and VIN (100 μM) alone did not alter ATG5 expression compared to the control, administration of LEV (30 μM) with Aβ25-35 managed to spike up the ATG5 expression by 6-fold as compared to the Aβ25 -35 group (Fig. 2c). Co-administration of Aβ25-35 and IB (50 μM) and/or VIN (100 μM) did not cause a significant change in ATG5 level (Fig. 2c).
Incubation of cells with 5 μM Aβ25-35 for 32 hrs resulted in a decrease in autophagy-associated BECN1 gene expression. IB (50 μM), LEV (30 μM) and VIN (100 μM) alone did not alter BECN1 expression compared to the control, whereas administration of IB (50 μM) with Aβ25-35 increased BECN1 gene expression by 2-fold as compared to the Aβ25-35 group. Concomitant administration of Aβ25-35 and LEV (30 μM) and VIN (100 μM) did not significantly change BECN1 expression compared to the Aβ25-35 group (Fig. 2d).
Aβ25-35 (5 μM; 32hrs) applied in the cell cultures and, a statistically significant reduction in SIRT1 protein level was determined. The co-administration of PDEIs with Aβ25-35 significantly prevented the Aβ25-35-induced decrease in the levels of SIRT1 and SIRT1 was reversed back to the control levels by LEV and VIN administration. IB significantly increased SIRT1 protein expression in Aβ25-35 exposed cells compared to the control (Fig. 3a-c; n = 3, *p<0.05 was significant compared to the control group, # and p<0.05 10 μM is significant compared to Aβ25-35 group). The bands were normalized with the internal standard β-actin (Fig. 3a-d).
Aβ25-35 (5 μM; 32 hrs) caused a significant increase in SESN2 protein level compared to the control group. The co-administration of LEV (30 μM) or VIN (100 μM) with Aβ25-35 significantly prevented the Aβ25-35-induced increase in SESN2 protein expression, while IB is unaffected. (Fig. 3b, 3d; n = 4; *p<0.05 was significant compared to the control group; #p<0.05 10 μM is significant compared to Aβ25-35 group and p<0.05 is significant compared to other Aβ25-35+PDEI groups). The bands were normalized with the internal standard β-actin (Fig. 3a-d).
| Fig. 1(a-b): | MTT graph showing the effects of PDEIs and/or Aβ25-35 on cell viability administration on cell viability in mouse hippocampal neurons (HT-22) (a) Cells were treated with PDEIs at increasing concentrations (IB; 25, 50, 100 μM; LEV; 30, 100, 300 μM and VIN; 30, 100, 300 μM) for 32 hrs (n = 5) and (b) Cells were treated with Aβ25-35 (5 μM) and/or PDEIs at optimum concentrations (IB; 50 μM, LEV; 30 μM or VIN; 100 μM) for 32 hrs (n = 6). The control groups (C) were incubated with 0.1% DMSO. Data were expressed as mean±SH of four independent experiments (V: Vehicle, NC: Negative control, PC: Positive control, *p<0.01 compared to the negative control group, #p<0.01 compared to the positive control group). V: Vehicle, NC: Negative control, PC: Positive control |
Aβ25-35 (5 μM; 32 hrs) caused a significant decrease in activated AMPK (p-AMPK) level compared to the control group. IB (50 μM) alone significantly increased p-AMPK level compared to the control. The co-administration of VIN (100 μM) with Aβ25-35 increased p-AMPK level compared to the Aβ25-35 group. The co-administration IB (50 μM) or LEV (30 μM) with Aβ25-35 did not change p-AMPK level compared to the Aβ25-35 group.
| Fig. 2(a-d): | Bar graph demonstrating the effects of Aβ25-35 (5 μM) administration and/or concomitant IB (50 μM), LEV (30 μM) and VIN (100 μM) treatment (a) SIRT1, (b) SESN2, (c) ATG5 and (d) BECN1 gene expressions in mouse hippocampal neuron cells (HT-22) by q(RT)-PCR. Quantitation of mRNA expressions was normalized using the ACTB transcript as a reference. Cells were exposed to Aβ25-35 (5 μM) for 32 hrs and/or Aβ25-35 (5 μM) and PDEIs; IB (50 μM), LEV (30 μM) or VIN (100 μM). The control groups (C) were incubated with 0.1% DMSO. Data were expressed as mean±SH of three independent experiments (n = 3, *p<0.05 is significant compared to the control group, #p<0.05 is significant compared to Aβ25-35 group and p<0.05 is significant compared to other Aβ25-35+PDEI groups) |
The total AMPK expression did not change in the PDEIs and/or Aβ25-35 groups (Fig. 4a-c). The bands were normalized with the internal standard β-actin (Fig. 4a-d).
Aβ25-35 (5 μM; 32 hrs) caused a significant increase in activated mTOR (p-mTOR) expression compared to the control group. PDEIs alone did not affect p-mTOR expression. PDEIs decreased Aβ25-35-induced increase of p-mTOR levels compared to the Aβ25-35 group The total mTOR expression did not change in the PDEIs and/or Aβ25-35 group (Fig. 4b, 4d). The bands were normalized with the internal standard β-actin (Fig. 4a-d).
Based on the fact that the autophagy marker LC3II plays an important role in the autophagy mechanisms of neurodegeneration, in particular Aβ-induced neurotoxicity, we investigated whether LC3II is involved in the neuroprotective effects provided by PDEIs. In the course of autophagosome maturation, a cytosolic form of LC3 (LC3 I) is conjugated to phosphatidylethanolamine to form LC3 phosphatidylethanolamine conjugate (LC3 II), which is recruited to autophagosomal membranes. LC3B antibody detects LC3 as a single band (LC3II) according to the producers’ instruction and we directly normalized it to β-actin without evaluation of LC3-II/I ratio. Aβ25-35 (5 μM; 32 hrs) significantly decreased LC3II levels, whereas co-administration of Aβ25-35 (5 μM; 32hrs) and PDEIs were significantly increased LC3II protein expression.
| Fig. 3(a-d): | Effect of PDEIs and Aβ25-35 on SIRT1 and SESN2 protein expression (a-b) Western blot bands, (c) Relative SIRT1 and (d) SESN2 densities showing the effects of Aβ25-35 (5 μM) in mouse hippocampal neuron cells (HT-22) and/or concomitant PDEIs treatment on SIRT1 and SESN2 protein expression. The bands were normalized with the internal standard β-actin. Cells were exposed to Aβ25-35 (5 μM) for 32 hrs and/or Aβ25-35 (5 μM) and PDEIs; IB (50 μM), LEV (30μM) or VIN (100 μM). The control groups (C) were incubated with 0.1% DMSO. The data were expressed as mean±SH of three independent experiments (n = 4, *p<0.05 compared to the control group, **p<0.01 was significant compared to the control group, #p<0.05 compared to 5 μM Aβ25-35 group) |
In addition, PDEIs treatment alone did not causes a significant change in the basal expression of LC3II in HT-22 cells. (Fig. 5a-b; n = 4; *p<0.05 compared to the control is significant. #p<0.01 compared to the 5 μM Aβ25-35 group is significant). The bands were normalized with the internal standard β-actin (Fig. 5a-b).
DISCUSSION
The significant neuroprotective and autophagy stimulating potential of three PDEIs in the Aβ-induced in vitro AD model has been denoted and SIRT1 has been found as a novel candidate for determining new, safe and effective treatment strategy. PDEI-mediated SIRT1 increase observed in this study may advocate autophagy activation through different autophagy components.
Cyclic nucleotide signalling increases the autophagic activities reported in various cells in the past few years. Notably, using SIRT1 activators proved to upregulate the autophagy process in the AD animal model and suppress Aβ aggregate formation6. It was showed that SIRT1 deficiency or loss leads to the accumulation of Aβ and microtubule-dependent protein tau in the brain cortex of patients with Alzheimer's disease26. A decrease in SIRT1 protein expression was also observed in astrocytes located around the region where Aβ25-35 accumulated in AD27. It was suggested that autophagy could be regulated through SIRT128 and SIRT1 is involved in the regulation of autophagosome formation29. SIRT/AMPK pathway activation prolongs cell life through autophagy-mediated mechanisms30. Activation of SIRT1 in AD can inhibit tau aggregation by autophagy-mediated mechanisms31. Pharmacological activation of SIRT1 also prevents neuronal death by causing down-regulation of acetylated p53 and other proapoptotic factors32.
| Fig. 4(a-d): | Effect of PDEIs and Aβ25-35 on (p-) AMPK and (p-) mTOR protein expression (a-b) Western blot bands and (c-d) Relative p-AMPK and p-mTOR densities showing the effects of Aβ25-35 (5 μM) in mouse hippocampal neuron cells (HT-22) and/or concomitant PDEIs treatment on (p-) AMPK and (p-) mTOR protein expression. The bands were normalized with the internal standard β-actin. Cells were exposed to Aβ25-35 (5 μM) for 32 hrs and/or Aβ25-35 (5 μM) and PDEIs; IB (50 μM), LEV (30μM) or VIN (100 μM). The control groups (C) were incubated with 0.1% DMSO. The data were expressed as mean±SH of three independent experiments (n = 4, *p<0.05 compared to the control group, #p<0.05 compared to 5 μM Aβ25-35 group) |
Activation of AMPK suppresses the mTOR complex which is the main negative regulator of autophagy and increases neural energy status through autophagy-related mechanisms in the cell. Inhibition of mTOR by AMPK activation stimulates autophagy and protects neuronal functions12. Studies have shown that the mTOR signalling is hyperactive in selected brain areas of Alzheimer's patients33,34. However, we can conclude that SESN2 induction is not strong enough to cause an increase in AMPK activity and a decrease in mTOR activity. Therefore, it can be suggested that SIRT1 plays a more active role in AMPK/mTOR activity in these cell lines. PDEIs alone increase neuroprotective SESN2 expression. We suggested that the cell elevates endogenous neuroprotective defence mechanisms such as SESN2 against neurotoxic insult (Aβ25-35), while PDEIs prevents SESN2 increase induced by Aβ25-35 and therefore decreases SESN2 expression by their compensatory protective effect in the HT-22 cells.
Cyclic nucleotide signalling also increases the autophagic activities reported in various cells in the past few years. Notably, using SIRT1 activators proved to upregulate the autophagy process in the AD animal model and suppress Aβ aggregate formation6. It was showed that SIRT1 deficiency or loss leads to the accumulation of Aβ and microtubule-dependent protein tau in the brain cortex of patients with Alzheimer's disease26. A decrease in SIRT1 protein expression was also observed in astrocytes located around the region where Aβ25-35 accumulated in AD27.
| Fig. 5(a-b): | Effect of PDEIs and Aβ25-35 on autophagy marker LC3II protein expression (a) Western blot bands and (b) Relative LC3II densities showing the effects of Aβ25-35 (5 μM) in mouse hippocampal neuron cells (HT-22) and/or concomitant PDEIs treatment on LC3II protein expression. The bands were normalized with the internal standard β-actin. Cells were exposed to Aβ25-35 (5 μM) for 32 hrs and/or Aβ25-35 (5 μM) and PDEIs; IB (50 μM), LEV (30 μM) or VIN (100 μM). The control groups (C) were incubated with 0.1% DMSO. The data were expressed as mean±SH of three independent experiments (*p<0.05 compared to the control group, **p<0.01 was significant compared to the control group, #p<0.05 compared to 5 μM Aβ25-35 group) |
SIRT1 is closely associated with AMPK, which acts as a sensor for the energy balance of the eukaryotic cells and they work synergistically. In neurodegenerative diseases, the inhibition of the SIRT1/AMPK axis of damaged mitochondria is emphasized. AMPK is defined both as the upregulation and down regulation of SIRT1. In both cases, the SIRT/AMPK interaction is especially important in Aβ accumulation and cognitive functions in AD35. SIRT/AMPK pathway activation prolongs cell life through autophagy-mediated mechanisms36.
We suggest that the PDEI-mediated SIRT1 increase observed may advocate autophagy activation. In line with these findings, we can conclude that the three PDEIs perform the pharmacological effects in Aβ25-35 exposed cells via SIRT1, protective AMPK activation and autophagy regulating protein mTOR inhibition. PDEIs supported cell mainly by alteration the expression levels of SIRT1/AMPK/mTOR activity, autophagy proteins beclin-1, Atg5, LC3II and partly neuroprotective SESN2 in Aβ25-35 exposed HT-22 cells.
In the present study, the effect of three PDEIs on the neuroprotective SIRT1 and SESN2, via activation of AMPK and subsequent inhibition of mTOR signalling pathway and autophagy proteins (ATG5, BECN1 and LC3II) in the Aβ25-35-stimulated mouse hippocampal neuronal cells (HT-22) should be confirmed via immunocytochemistry staining. Demonstrating the effects of the three PDEIs on neuroprotective and autophagy proteins acts through different components is the strength of the study.
CONCLUSION
The present study revealed the significant neuroprotective and autophagy stimulating potential of three PDEIs in Aβ-induced in vitro AD model. Therefore, this study demonstrates the effect of selected PDEIs on the neuroprotective SIRT1 and SESN2 and on the autophagy genes ATG5, BECN1 and the autophagy marker LC3II in the Aβ25-35-exposed HT-22 cells. SIRT1 is a novel candidate for determining new, safe and effective treatment strategies. We suggest that the PDEI-mediated SIRT1 increase observed may advocate autophagy activation through different autophagy components.
SIGNIFICANCE STATEMENT
This study discovers the possible neuroprotective and autophagy stimulating potential of three PDEIs in Aβ-induced in vitro AD model that can be beneficial for dementia types including Alzheimer’s Disease. This study will help the researcher to uncover the critical area of the effect of selected PDEIs on the neuroprotective SIRT1 and SESN2 and the autophagy genes. Current treatment options of dementia and Alzheimer’s Disease are rather symptomatic and neurotransmitter oriented rather than the most important aspect: protecting the neuronal structure. Thus, a new class of neuroprotective molecules may be arrived at.