Protective Role of Monolluma quadrangula Extract Against Hyperammonemia, Oxidative Stress and Inflammation in Ammonium Chloride-induced Rats

Asian Journal of Scientific Research

Year: 2019 | Volume: 12 | Issue: 3 | Page No.: 421-430
DOI: 10.3923/ajsr.2019.421.430

**Protective Role of Monolluma quadrangula Extract Against Hyperammonemia, Oxidative Stress and Inflammation in Ammonium Chloride-induced Rats**

Mousa Osman Germoush

Abstract: Background and Objectives: Excess ammonia results from liver failure can cause serious neuropsychiatric complications. Monolluma quadrangula is a succulent plant with promising antioxidant and anti-inflammatory properties; however, its protective effect against hyperammonemia hasn’t been reported. The present study was aimed to evaluate the effect of M. quadrangula extract on ammonia levels, oxidative stress, inflammation and Na⁺/K⁺-ATPase in ammonium chloride (NH₄Cl)-administered rats. Materials and Methods: Rats received NH₄Cl three times per week and 250 mg kg^–1 b.wt., M. quadrangula extract for 8 weeks. The animals were sacrificed and blood, cerebrum, liver and kidney samples were collected for analyses. Results: The NH₄Cl-administered rats showed a significant increase in blood ammonia and liver and kidney function markers. Lipid peroxidation was increased, superoxide dismutase and catalase were decreased in the brain, liver and kidney of rats. Treatment with M. quadrangular extract ameliorated blood ammonia, liver and kidney function markers, lipid peroxidation, superoxide dismutase and catalase in NH₄Cl-induced rats. Monolluma quadrangular extract prevented inflammation and decreased nitric oxide and glutamine levels in the brain of rats. In addition, M. quadrangula extract decreased the expression and activity of Na⁺/K⁺-ATPase in the brain of rats received NH₄Cl. Conclusion: These results showed the protective effect of M. quadrangula extract against NH₄Cl-induced hyperammonemia. Monolluma quadrangula prevented oxidative stress and inflammation and modulated glutamate-nitric oxide-cGMP pathway and Na⁺/K⁺-ATPase in the brain of rats.

Fulltext PDF Fulltext HTML

How to cite this article

Mousa Osman Germoush , 2019. Protective Role of Monolluma quadrangula Extract Against Hyperammonemia, Oxidative Stress and Inflammation in Ammonium Chloride-induced Rats. Asian Journal of Scientific Research, 12: 421-430.

Keywords: excess ammonia, hyperammonemia, oxidative stress, Monolluma quadrangula, succulent plant and Neuropsychiatric complications

INTRODUCTION

Ammonia is a byproduct of nitrogen metabolism that is detoxified in hepatocytes via the urea cycle¹. Excess ammonia occurs subsequent to liver failure can cause hepatic encephalopathy (HE)² and senescence in astrocytes as well as cognitive impairment^3,4. Although the exact mechanism of ammonia-induced HE is not fully understood, several studies have pointed to different factor including oxidative stress, inflammation and others^5-8. Excess ammonia increased the levels of nitric oxide via reducing glutamate uptake, activation of N-methyl-D-aspartic acid (NMDA) receptors and increased intracellular calcium (Ca²⁺) levels which activates neuronal nitric oxide synthase (nNOS). In addition, excess ammonia and nitric oxide activate soluble guanylate cyclase and increase the levels of cyclic guanosine monophosphate (cGMP)^9,10. It was shown that ammonia can induce nucleic acid oxidation in cultured astrocytes and in the brain¹¹. Therefore, hepatic encephalopathy manifests as oxidative/nitrosative stress along with low-grade cerebral edema¹¹. In this context, studies have demonstrated that excess ammonia is associated with increased lipid peroxidation and nitric oxide in the brain of animals^12-14. Inflammation has also been implicated in hepatic encephalopathy^6-8 and liver failure resulted in increased inflammatory cytokines in the brain¹⁵ and in the circulation^14,16,17.

Given the role of hyperammonemia, oxidative stress and inflammation in the pathogenesis of hepatic encephalopathy, agents with antioxidant and anti-inflammatory effects can provide protection against the deleterious effect of excess ammonia. Monolluma quadrangula (Forssk.) is a plant with irregularly branched and compressed stem¹⁸. This succulent bush has been applied in folk medicine for treating peptic ulcer and diabetes mellitus. Recently, Bin-Jumah^19,20 has reported the antioxidant, anti-inflammatory, glucose-lowering and hepatoprotective properties of M. quadrangula extract in hypercholesterolemic and diabetic rats. In these animal models, M. quadrangula decreased lipid peroxidation and increased the levels of antioxidants. In addition, M. quadrangula extract showed antioxidant and protective effects against gastric ulcer in rodents²¹. Furthermore, different extracts of M. quadrangula have exerted anti-hyperglycemic effect in diabetic rats²². However, the effect of M. quadrangula on oxidative stress and inflammation in hyperammonemia have not been reported. So the present study was investigated the protective effects of M. quadrangula against excess ammonia, oxidative stress, nitric oxide and inflammation in ammonium chloride (NH₄Cl)-administered rats.

MATERIALS AND METHODS

Preparation of M. quadrangula extract: The collection of M. quadrangula and preparation of its ethanolic extract were conducted as previously reported by Bin-Jumah¹⁹. In brief, the plant was collected from Abha (Saudi Arabia), dried and powdered using an electric grinder. The powder was soaked in ethanol/water (1:1 vol/vol) for 24 h, filtered and dried using rotary evaporator.

Animals and experimental design: Male Wistar rats weighing 180-200 g obtained from the animal house of King Saud University, were used in the present study. The rats were housed in standard cages at normal atmospheric temperature and 12 h dark/light cycle and were supplied a standard pellet diet and water ad libitum. All animal procedures were approved by the Institutional Animal Ethics Committee of Jouf University (Approval number, 219/34).

Twenty-four rats were divided into four groups (N = 6) as following:

•	Group I (Control): Rats received normal saline (3 times/week) and 0.5% carboxymethyl cellulose (CMC) daily for 8 weeks
•	*Group II (M. quadrangula):* Rats received saline (3 times/week) and 250 mg kg^–¹ b.wt., M. quadrangular extract¹⁹ dissolved in 0.5% CMC daily for 8 weeks
•	Group III (NH₄Cl): Rats received 100 mg kg^–¹ NH₄Cl (Sigma, USA) dissolved in saline (3 times/week; ip.)¹² and 0.5% CMC daily for 8 weeks
•	*Group IV (NH₄Cl+M. quadrangula):* Rats received NH₄Cl (3 times/week, ip.) and 250 mg kg^–¹ b.wt., M. quadrangular extract¹⁹ daily for 8 weeks

Both saline and NH₄Cl were administered intraperitoneally, whereas, CMC and M. quadrangula extract were administered via oral gavage.

At the end of the experiment, overnight fasted rats were sacrificed and blood, brain, liver and kidney were collected for analysis. The brain was dissected and cerebrum was isolated. The cerebrum, liver and kidney were homogenized in cold phosphate buffered saline (10% w/v) and the homogenates were centrifuged and the clear supernatant collected for the analysis of lipid peroxidation, superoxide dismutase (SOD) and catalase. In addition, nitric oxide, Na⁺/K⁺-ATPase, glutamine, tumor necrosis factor alpha (TNF-α) and interleukin-1beta (IL-1β) were assayed in the cerebral homogenate. Other samples from the cerebrum were kept frozen for the gene expression analysis.

Assay of blood ammonia, liver and kidney function markers: Ammonia was assayed in whole blood samples using a reagent kit purchased from Spinreact (Spain)²³, where as alanine aminotransferase (ALT)²⁴, aspartate aminotransferase (AST)²⁴, alkaline phosphatase (ALP)²⁵ and creatinine²⁶ were determined in serum using Spinreact (Spain) reagent kits.

Assay of lipid peroxidation, SOD and catalase: Lipid peroxidation, SOD and catalase were assayed in the cerebrum, liver and kidney of rats according to the methods of Preuss et al.²⁷, Marklund and Marklund²⁸ and Cohen et al.²⁹, respectively.

Assay of nitric oxide, glutamine, TNF-α and IL-1β: Nitric oxide and glutamine levels were measured the cerebrum of rats following the method of Grisham et al.³⁰ and Lund³¹, respectively. The TNF-α and IL-1β were determined using ELISA kits (R and D Systems, USA), according to the manufacturer’s instructions.

Assay of cerebral Na⁺/K⁺-ATPase activity: The activity of Na⁺/K⁺-ATPase was determined in the cerebrum of rats through the assessment of the levels of inorganic phosphate (Pi) liberated from ATP³². The liberated Pi was determined using Spinreact kits³³.

Assay of Na⁺/K⁺-ATPase gene expression: Total RNA, isolated from the cerebrum samples using Trizol (Invitrogen, USA) was treated with DNAse I and quantified at 260 nm using a nanodrop. The RNA with A260/280 nm ratio of 1.8 or more was selected and 2 μg was reverse transcribed into cDNA using RT kit (Thermo Scientific, USA). The cDNA was then amplified by SYBR Green master mix (Fermentas, USA)³⁴ and the following primers: Na⁺/K⁺-ATPase, F:TGGCATCCGAA GTGCTACAG and R: CCAGATCACCAACGACGACA; and β-actin, F: CCGCGAGTACAACCTTCTTG and R: CAGTTGGTGACAA TGCCGTG. The amplification data were analyzed using the 2^–^ΔΔCt method³⁵.

Statistical analysis: Statistical analysis was performed using GraphPad Prism 5 software (GraphPad Software, San Diego, CA) and all results were expressed as mean±standard error of the mean (SEM). The statistical comparisons were made by means of the one-way ANOVA test followed by Tukey’s test post hoc analysis. A p<0.05 was considered significant.

RESULTS

Effect of M. quadrangula on blood ammonia levels: Oral administration of M. quadrangula didn’t cause significant changes in blood ammonia of control rats as shown in Fig. 1. NH₄Cl-administered rats showed significant increase in blood ammonia (p<0.001). The NH₄Cl-administered rats treated with M. quadrangula showed reduced blood ammonia (p<0.001, Fig. 1).

Effect of M. quadrangula on liver and kidney function: Rats administered with NH₄Cl showed liver injury evidenced by the significant increase in serum ALT (Fig. 2a), AST (Fig. 2b) and ALP (Fig. 2c) as compared to the control rats. Kidney function has also been altered in NH₄Cl-administered rats as showed by increased serum creatinine (p<0.001, Fig. 2d). On the other hand, NH₄Cl-administered rats treated with M. quadrangula showed improved (p<0.001) liver and kidney function, whereas, control rats received M. quadrangula didn’t show changes in liver and kidney function (Fig. 2d).

Monolluma quadrangula ameliorates lipid peroxidation and enhances antioxidants: The brain of rats received NH₄Cl showed a significant increase (p<0.001) in lipid peroxidation as compared to the control group (Fig. 3a). On the other hand, the activity of SOD (Fig. 3b) and catalase (Fig. 3c) was decreased significantly (p<0.01) in the brain of NH₄Cl-administered rats. Treatment with M. quadrangula extract decreased lipid peroxidation (p<0.001) and increased SOD (p<0.001) and catalase (p<0.01) in the brain of the NH₄Cl-administered rats (Fig. 3c).


Fig. 1:	Effect of M. quadrangula ameliorates blood on ammonia levels in NH₄Cl-administered rats
	^{Data are expressed as Mean±SEM (N = 6). ***p<0.001 vs. control and ^###p<0.001 vs. NH₄Cl}


Fig. 2(a-d):	Effect of M. quadrangular on serum levels of (a) ALT, (b) AST, (c) ALP and (d) Creatinine in NH₄Cl-administered rats
	^{Data are expressed as Mean±SEM (N = 6). ***p<0.001 vs. control and ^###p<0.001 vs. NH₄Cl}

Similarly, lipid peroxidation was significantly increased in the liver of rats received NH₄Cl (p<0.001) as represented in Fig. 4a. Hepatic SOD (Fig. 4b) and catalase (Fig. 4c) were decreased significantly (p<0.01) in NH₄Cl-administered rats. The supplementation of M. quadrangula decreased lipid peroxidation and increased SOD and catalase in the liver of NH₄Cl-administered rats, whereas, no effect has showed in the control rats.

The NH₄Cl administration increased lipid peroxidation (Fig. 5a), decreased the activity of SOD (Fig. 5b) and catalase (Fig. 5c) significantly (p<0.001) in the kidney of rats when compared with the control group (Fig. 5c). Oral supplementation of M. quadrangula extract decreased kidney lipid peroxidation and increased SOD and catalase in NH₄Cl-administered rats, whereas, no effect has showed in the control rats (Fig. 5c).

Monolluma quadrangula attenuates inflammation in the brain of rats: The NH₄Cl-administered rats showed a significant (p<0.001) increase in cerebral TNF-α (Fig. 6a) and IL-1β (Fig. 6b) as compared to the control group. The NH₄Cl-administered rats treated with M. quadrangula extract showed a significant (p<0.001) decrease in the cerebral levels of TNF-α and IL-1β. Oral supplementation of M. quadrangula extract didn’t cause significant changes in pro-inflammatory cytokines in the cerebrum of control rats.

Monolluma quadrangula on alleviates nitric oxide, glutamine and Na⁺/K⁺ ATPase activity in the brain of rats: The NH₄Cl-induced hyperammonemia resulted in a significant increase in cerebral nitric oxide (p<0.01, Fig. 7a) and glutamine levels (p<0.001, Fig. 7b) as compared to the control rats. NH₄Cl-administered rats treated with M. quadrangula showed a significant decrease in cerebral nitric oxide (p<0.01) and glutamine levels (p<0.001). On the other hand, rats received M. quadrangula extract showed non-significant changes in cerebral nitric oxide and glutamine levels.

The NH₄Cl-administered rats showed a significant (p<0.001) increase in the activity (Fig. 7c) as well as the gene expression (Fig. 7d) of cerebral Na⁺/K⁺ ATPase. Treatment of the NH₄Cl-administered rats with M. quadrangula extract significantly (p<0.001) ameliorated the expression and activity of cerebral Na⁺/K⁺ ATPase. Monolluma quadrangula extract caused non-significant changes in the expression and activity of cerebral Na⁺/K⁺ ATPase in normal rats (Fig. 7c, d).


Fig. 3(a-c):	Effect of M. quadrangula on (a) Lipid peroxidation, (b) SOD and (c) Catalase in the cerebrum of NH₄Cl-administered rats
	^{Data are expressed as Mean±SEM (N = 6). p<0.01, *p<0.001 vs. control and ^##p<0.01, ^###p<0.001 vs. NH₄Cl}

DISCUSSION

Monolluma quadrangula extract has been recently reported to protect against oxidative stress and inflammation in hypercholesterolemic and diabetic rats^19,20. The present study showed that the M. quadrangula extract prevents oxidative damage and inflammation and modulates glutamate-NO-cGMP signaling in the cerebrum of NH₄Cl-induced hyperammonemia in rats.

The NH₄Cl-induced rats in the present investigation showed a significant increase in blood ammonia levels, liver and kidney injury manifested by the increased levels of serum ALT, AST, ALP and creatinine.


Fig. 4(a-c):	Effect of M. quadrangula on (a) Lipid peroxidation, (b) SOD and (c) Catalase in the liver of NH₄Cl-administered rats
	^{Data are expressed as Mean±SEM (N = 6). p<0.01, *p<0.001 vs. control and ^##p<0.01, ^###p<0.001 vs. NH₄Cl}

The administration of NH₄Cl for 8 weeks has been demonstrated to increase the blood ammonia levels as a consequence of liver injury^12-14,36. It was studied that the hyperammonemia is a direct consequence of liver injury³⁷ and hepatoprotective effects can prevent hyperammonemia and its associated deleterious effects. In the present study, treatment of the NH₄Cl-administered rats with M. quadrangula extract prevented both liver and kidney injury as showed by the ameliorated levels of ALT, AST, ALP and creatinine. In addition, M. quadrangula extract prevented NH₄Cl-induced hyperammonemia in rats which is a direct result of its hepatoprotective and renoprotective effects.


Fig. 5(a-c):	Effect of M. quadrangular on (a) Lipid peroxidation, (b) SOD and (c) Catalase in the kidney of NH₄Cl-administered rats
	^{Data are expressed as Mean±SEM (N = 6). ***p<0.001 vs. control and ^###p<0.001 vs. NH₄Cl}

Previous studies have demonstrated that oxidative stress is implicated in the deleterious effects of excess ammonia^5,38. The brain is vulnerable to damage by oxidative stress because of its low content of antioxidant and high content of polyunsaturated fatty acids^39,40. In the present study, NH₄Cl-administered rats showed oxidative stress in the brain, liver and kidney evidenced by the increased levels of lipid peroxidation, declined antioxidant enzymes SOD and catalase. In agreement with these findings, recent work from Mahmoud’s lab showed increased lipid peroxidation and decreased antioxidant enzymes in the brain, liver and kidney of hyperammonemic rats^12-14,36. Interestingly, treatment of the NH₄Cl-administered rats with M. quadrangula extract prevented lipid peroxidation and alleviated SOD and catalase in the brain, liver and kidney.


Fig. 6(a-b):	Effect of M. quadrangular on (a) TNF-α and (b) IL-1β in the cerebrum of NH₄Cl-administered rats
	^{Data are expressed as Mean±SEM (N = 6). ***p<0.001 vs. control and ^###p<0.001 v.s NH₄Cl}

Therefore, the antioxidant efficacy of M. quadrangula extract seems to play an important role in its protective effect against hyperammonemia. In agreement with the observed antioxidant effects of M. quadrangula extract, Bin-Jmah^19,20 has recently reported decreased in oxidative stress and increased in levels of enzymatic and non-enzymatic antioxidants in the liver of hypercholesterolemic and diabetic rats. In addition, M. quadrangula extract prevented lipid peroxidation in the stomach of a rat model of peptic ulcer²¹. The rich content of glycosides and phenolics have been reported to be the main contributor of the antioxidant effect of M. quadrangula extract^41-43.

In addition to mitigating oxidative stress, M. quadrangula extract showed a potent anti-inflammatory activity in the brain of NH₄Cl-administered rats. Treatment of the rats with M. quadrangula extract alleviated the levels of TNF-α and IL-1β in the brain of hyperammonemic rats. In hyperammonemia, inflammation has been associated with neuropsychological alterations⁴⁴ and studies have shown the role of inflammation in the pathogenesis of hepatic encephalopathy^6-8.


Fig. 7(a-d):	Effect of M. quadrangula (a) Nitric oxide, (b) Glutamine, (c) Na⁺/K⁺-ATPase activity and (d) Na⁺/K⁺-ATPase gene expression in the cerebrum of NH₄Cl-administered rats
	^{Data are expressed as Mean±SEM (N = 6). p<0.01, *p<0.001 vs. control and ^##p<0.01, ^###p<0.001 vs. NH₄Cl}

Pro-inflammatory cytokines have been demonstrated to increase in NH₄Cl-administered rats^13,14 and in patients with hepatic cirrhosis^16,17. Due to the implication of inflammation in excess ammonia-induced neuropsychological alterations, agents with anti-inflammatory effects can prevent these alterations^14,45. In agreement with current results, recent studies showed the anti-inflammatory effect of M. quadrangula extract in hypercholesterolemic and diabetic rats^19,20.

To further explore the protective mechanism of M. quadrangula extract against hyperammonemia, the cerebral levels of nitric oxide, glutamine, activity and expression of Na⁺/K⁺ ATPase were determined. Nitric oxide was increased in the brain of rats received NH₄Cl which is in agreement with previous reports^12-14,36. The increased nitric oxide is a direct result of increased in nNOS expression^14,46. Excess ammonia activates NMDA glutamate receptors resulting in opening of the Ca²⁺ channels, activation of nNOS and increased production of nitric oxide which increases the formation of cGMP^9,10. Previously, the increased expression of nNOS in the cerebrum of rats was reported by different researchers^14,46. In addition to the increased nitric oxide, NH₄Cl-administered rats showed the increased levels of the amino acid glutamine which is a result of the condensation of glutamate and ammonia⁴⁷. The synthesis of glutamine by glutamine synthetase in astrocytosis increased in hyperammonemia and excess levels of glutamine can alter the cerebral blood flow and cause oxidative stress, osmotic imbalance and cerebral edema^48,49. Previous studies have demonstrated the increased glutamine levels in the cerebrum of rats received NH₄Cl^14,36. Treatment of the NH₄Cl-administered rats with M. quadrangula extract reduced the cerebral levels of nitric oxide and glutamine which could be attributed to the decreased ammonia levels. Therefore, the modulatory effect of M. quadrangula extract on the ammonia-induced glutamate-nitric oxide-cGMP pathway plays a role in its protective effect against hyperammonemia.

Furthermore, M. quadrangula extract ameliorated the expression and activity of Na⁺/K⁺-ATPase in the cerebrum of NH₄Cl-administered rats. Several studies showed previously that the activity of Na⁺/K⁺-ATPase increases in the brain of hyperammonemic animals^46,50,51. Along with the in vivo studies, in vitro experiments showed increased Na⁺/K⁺-ATPase activity in murine astrocytes exposed to ammonia⁵². The neurotoxic effect of ammonia is associated with compromise K⁺ buffering in astrocytes⁵³. Therefore, M. quadrangula extract maintained K⁺ buffering through modulating Na⁺/K⁺-ATPase and prevent the deleterious effects of excess ammonia on the astrocytes.

CONCLUSION

The results of this study showed for the first time that M. quadrangula extract protected against excess ammonia in rats. Monolluma quadrangula prevented oxidative stress, inflammation and decreased the glutamate-nitric oxide-cGMP pathway and activity of the Na⁺/K⁺-ATPase. Hence, M. quadrangula can provide protection against hyperammonemia and its associated neuronal alterations.

SIGNIFICANCE STATEMENT

Treatment of the hyperammonemic rats with Monolluma quadrangula ameliorated blood ammonia levels and prevented ammonium chloride-induced liver and kidney dysfunction. This study shows for the first time that Monolluma quadrangula protects against excess ammonia associated oxidative stress in the brain, liver and kidney of rats. In addition, the results show that modulation of inflammation, glutamate-nitric oxide-cGMP pathway and Na⁺/K⁺-ATPase activity in the brain is the main mechanism of the protective effect of Monolluma quadrangula against hyperammonemia.

REFERENCES

Damink, S.W.O., N.E. Deutz, C.H. Dejong, P.B. Soeters and R. Jalan, 2002. Interorgan ammonia metabolism in liver failure. Neurochem. Int., 41: 177-188.
CrossRef Direct Link

Butterworth, R.F., 2013. The liver-brain axis in liver failure: Neuroinflammation and encephalopathy. Nat. Rev. Gastroenterol. Hepatol., 10: 522-528.
CrossRef Direct Link

Gorg, B., A. Karababa, A. Shafigullina, H.J. Bidmon and D. Haussinger, 2015. Ammonia-induced senescence in cultured rat astrocytes and in human cerebral cortex in hepatic encephalopathy. Glia, 63: 37-50.
CrossRef Direct Link

Hadjihambi, A., V. Khetan and R. Jalan, 2014. Pharmacotherapy for hyperammonemia. Expert Opin. Pharmacother., 15: 1685-1695.
CrossRef Direct Link

Bosoi, C.R., X. Yang, J. Huynh, C. Parent-Robitaille, W. Jiang, M. Tremblay and C.F. Rose, 2012. Systemic oxidative stress is implicated in the pathogenesis of brain edema in rats with chronic liver failure. Free Radic. Biol. Med., 52: 1228-1235.
CrossRef Direct Link

Shawcross, D. and R. Jalan, 2005. The pathophysiologic basis of hepatic encephalopathy: Central role for ammonia and inflammation. Cell. Mol. Life Sci., 62: 2295-2304.
CrossRef Direct Link

Shawcross, D.L., G. Wright, S.W.M.O. Damink and R. Jalan, 2007. Role of ammonia and inflammation in minimal hepatic encephalopathy. Metab. Brain Dis., 22: 125-138.
CrossRef Direct Link

Shawcross, D.L., G.A.K. Wright, V. Stadlbauer, S.J. Hodges and N.A. Davies et al., 2008. Ammonia impairs neutrophil phagocytic function in liver disease. Hepatology, 48: 1202-1212.
CrossRef Direct Link

Hermenegildo, C., P. Monfort and V. Felipo, 2000. Activation of N-methyl-D-aspartate receptors in rat brain in vivo following acute ammonia intoxication: Characterization by in vivo brain microdialysis. Hepatology, 31: 709-715.
CrossRef Direct Link

Montoliu, C., M. Llansola, P. Monfort, R. Corbalan, I. Fernandez-Marticorena, M.L. Hernandez-Viadel and V. Felipo, 2001. Role of nitric oxide and cyclic GMP in glutamate-induced neuronal death. Neurotoxicity Res., 3: 179-188.
CrossRef Direct Link

Gorg, B., N. Qvartskhava, V. Keitel, H.J. Bidmon, O. Selbach, F. Schliess and D. Haussinger, 2008. Ammonia induces RNA oxidation in cultured astrocytes and brain in vivo. Hepatology, 48: 567-579.
CrossRef Direct Link

Mahmoud, A.M., 2012. Influence of rutin on biochemical alterations in hyperammonemia in rats. Exp. Toxicol. Pathol., 64: 783-789.
CrossRef Direct Link

Mahmoud, A.M., M.O. Germoush and A.S. Soliman, 2014. Ruta graveolens mitigates ammonium chloride-induced hyperammonemia by modulating antioxidant status and pro-inflammatory cytokines. Life Sci. J., 11: 269-275.
Direct Link

Mahmoud, A.M., S. Alqahtani, S.I. Othman, M.O. Germoush and O.E. Hussein et al., 2017. Commiphora molmol modulates glutamate-nitric oxide-cGMP and Nrf2/ARE/HO-1 pathways and attenuates oxidative stress and hematological alterations in hyperammonemic rats. Oxid. Med. Cell. Longevity, Vol. 2017.
CrossRef

Bemeur, C., H. Qu, P. Desjardins and R.F. Butterworth, 2010. IL-1 or TNF receptor gene deletion delays onset of encephalopathy and attenuates brain edema in experimental acute liver failure. Neurochem. Int., 56: 213-215.
CrossRef Direct Link

Odeh, M., E. Sabo, I. Srugo and A. Oliven, 2004. Serum levels of tumor necrosis factor-α correlate with severity of hepatic encephalopathy due to chronic liver failure. Liver Int., 24: 110-116.
CrossRef Direct Link

Odeh, M., E. Sabo, I. Srugo and A. Oliven, 2005. Relationship between tumor necrosis factor-alpha and ammonia in patients with hepatic encephalopathy due to chronic liver failure. Ann. Med., 37: 603-612.
CrossRef Direct Link

Albers, F. and U. Meve, 2013. Illustrated Handbook of Succulent Plants: Asclepiadaceae. Springer-Verlag, Berlin, Germany, ISBN-13: 9783642626289, Pages: 321

Bin-Jumah, M.N., 2018. Monolluma quadrangula protects against oxidative stress and modulates LDL receptor and fatty acid synthase gene expression in hypercholesterolemic rats. Oxid. Med. Cell. Longevity, Vol. 2018.
CrossRef

Bin-Jumah, M.N., 2019. Antidiabetic effect of monolluma quadrangula is mediated via modulation of glucose metabolizing enzymes, antioxidant defenses and adiponectin in type 2 diabetic rats. Oxid. Med. Cell. Longevity, Vol. 2019.
CrossRef

Ibrahim, I.A.A., M.A. Abdulla, M. Hajrezaie, A. Bader and N. Shahzad et al., 2016. The gastroprotective effects of hydroalcoholic extract of Monolluma quadrangula against ethanol-induced gastric mucosal injuries in Sprague Dawley rats. Drug Des. Dev. Ther., 10: 93-105.
CrossRef PubMed Direct Link

Abdel-Sattar, E., S.A. El-Maraghy, R.S. El-Dine and S.M. Rizk, 2017. Antihyperglycemic activity of Caralluma quadrangula in streptozotocin-induced diabetic rats. Bull. Fac. Pharm. Cairo Univ., 55: 269-272.
CrossRef Direct Link

Da Fonseca-Wollheim, F., 1990. Preanalytical increase of ammonia in blood specimens from healthy subjects. Clin Chem., 36: 1483-1487.
PubMed Direct Link

Schumann, G. and R. Klauke, 2003. New IFCC reference procedures for the determination of catalytic activity concentrations of five enzymes in serum: Preliminary upper reference limits obtained in hospitalized subjects. Clin. Chim. Acta, 327: 69-79.
CrossRef PubMed Direct Link

Wenger, C., A. Kaplan, F.F. Rubaltelli and C. Hammerman, 1984. Alkaline Phosphatase. In: Clinical Chemistry: Theory, Analysis and Correlation, Kaplan, L.A. and A.J. Pesce (Eds.). 1st Edn., The C.V. Mosby Co., St. Louis, MO., USA., ISBN-13: 9780801627057, pp: 1094-1098

Lausen, K., 1972. Creatinine assay in the presence of protein with LKB 8600 reaction rate analyser. Clin. Chim. Acta, 38: 475-476.
CrossRef PubMed Direct Link

Preuss, H.G., S.T. Jarrell, R. Scheckenbach, S. Lieberman and R.A. Anderson, 1998. Comparative effects of chromium, vanadium and gymnema sylvestre on sugar-induced blood pressure elevations in SHR. J. Am. Coll. Nutr., 17: 116-123.
CrossRef Direct Link

Marklund, S. and G. Marklund, 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem., 47: 469-474.
CrossRef PubMed Direct Link

Cohen, G., D. Dembiec and J. Marcus, 1970. Measurement of catalase activity in tissue extracts. Ann. Biochem., 34: 30-38.
CrossRef PubMed Direct Link

Grisham, M.B., G.G. Johnson and J.R. Lancaster Jr., 1996. Quantitation of nitrate and nitrite in extracellular fluids. Methods Enzymol., 268: 237-246.
CrossRef PubMed Direct Link

Lund, P., 1985. L-Glutamine and L-Glutamate: UV-Method with Glutaminase and Glutamate Dehydrogenase. In: Methods of Enzymatic Analysis, Volume 8: Metabolites 3: Lipids, Amino Acids and Related Compounds, Bergmeyer, H.U. (Ed.). 3rd Edn., Wiley-VCH, Weinheim, Germany, ISBN-13: 9783527260485, pp: 357-363

Rauchova, H., Z. Drahota and J. Koudelova, 1999. The role of membrane fluidity changes and thiobarbituric acid-reactive substances production in the inhibition of cerebral cortex Na⁺,K⁺-ATPase activity. Physiol. Res., 48: 73-78.
PubMed Direct Link

Fiske, C.H. and Y. Subbarow, 1925. The colorimetric determination of phosphorus. J. Biol. Chem., 66: 375-400.
CrossRef Direct Link

Mahmoud, A.M., 2013. Hematological alterations in diabetic rats-role of adipocytokines and effect of citrus flavonoids. Excli J., 12: 647-657.
Direct Link

Livak, K.J. and T.D. Schmittgen, 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2^-ΔΔCT method. Methods, 25: 402-408.
CrossRef Direct Link

Germoush, M.O., S.I. Othman, M.A. Al-Qaraawi, H.M. Al-Harbi and O.E. Hussein et al., 2018. Umbelliferone prevents oxidative stress, inflammation and hematological alterations and modulates glutamate-nitric oxide-cGMP signaling in hyperammonemic rats. Biomed. Pharmacother., 102: 392-402.
CrossRef Direct Link

Machado, M.C. and F.P. da Silva, 2014. Hyperammonemia due to urea cycle disorders: A potentially fatal condition in the intensive care setting. J. Intensive Care, Vol. 2.
CrossRef

Lopez-Alarcon, C. and A. Denicola, 2013. Evaluating the antioxidant capacity of natural products: A review on chemical and cellular-based assays. Anal. Chim. Acta, 763: 1-10.
CrossRef Direct Link

Gotz, M.E., G. Kunig, P. Riederer and M.B.H. Youdim, 1994. Oxidative stress: Free radical production in neural degeneration. Pharmacol. Therapeut., 63: 37-122.
CrossRef Direct Link

Barnham, K.J., C.L. Masters and A.I. Bush, 2004. Neurodegenerative diseases and oxidative stress. Nat. Rev. Drug Discov., 3: 205-214.
CrossRef PubMed Direct Link

Naik, S.R. and V.S. Panda, 2007. Antioxidant and hepatoprotective effects of Ginkgo biloba phytosomes in carbon tetrachloride-induced liver injury in rodents. Liver Int., 27: 393-399.
CrossRef PubMed Direct Link

Bader, A., A. Braca, N. De Tommasi and I. Morelli, 2003. Further constituents from Caralluma negevensis. Phytochemistry, 62: 1277-1281.
CrossRef Direct Link

Abdallah, H.M., A.M.M. Osman, H. Almehdar and E. Abdel-Sattar, 2013. Acylated pregnane glycosides from Caralluma quadrangula. Phytochemistry, 88: 54-60.
CrossRef Direct Link

Shawcross, D.L., N.A. Davies, R. Williams and R. Jalan, 2004. Systemic inflammatory response exacerbates the neuropsychological effects of induced hyperammonemia in cirrhosis. J. Hepatol., 40: 247-254.
CrossRef Direct Link

Chung, C., J. Gottstein and A.T. Blei, 2001. Indomethacin prevents the development of experimental ammonia-induced brain edema in rats after portacaval anastomosis. Hepatology, 34: 249-254.
CrossRef Direct Link

Ramakrishnan, A., N. Vijayakumar and M. Renuka, 2016. Naringin regulates glutamate-nitric oxide cGMP pathway in ammonium chloride induced neurotoxicity. Biomed. Pharmacother., 84: 1717-1726.
CrossRef Direct Link

Hakvoort, T., Y. He, W. Kulik, J.L. Vermeulen and S. Duijst et al., 2017. Pivotal role of glutamine synthetase in ammonia detoxification. Hepatology, 65: 281-293.
CrossRef Direct Link

Dejong, C.H.C., N.E.P. Deutz and P.B. Soeters, 1996. Ammonia and glutamine metabolism during liver insufficiency: The role of kidney and brain in interorgan nitrogen exchange. Scand. J. Gastroenterol., 31: 61-77.
CrossRef Direct Link

Vaquero, J. and R.F. Butterworth, 2007. Mechanisms of brain edema in acute liver failure and impact of novel therapeutic interventions. Neurol. Res., 29: 683-690.
CrossRef Direct Link

Ribeiro, C.A.J., F.H. Hickmann and M. Wajner, 2011. Neurochemical evidence that 3-methylglutaric acid inhibits synaptic Na⁺,K⁺-ATPase activity probably through oxidative damage in brain cortex of young rats. Int. J. Dev. Neurosci., 29: 1-7.
CrossRef Direct Link

Renuka, M., N. Vijayakumar and A. Ramakrishnan, 2016. Chrysin, a flavonoid attenuates histological changes of hyperammonemic rats: A dose dependent study. Biomed. Pharmacother., 82: 345-354.
CrossRef Direct Link

Kala, G., R. Kumarathasan, L. Peng, F.H. Leenen and L. Hertz, 2000. Stimulation of Na⁺, K⁺-ATPase activity, increase in potassium uptake and enhanced production of ouabain-like compounds in ammonia-treated mouse astrocytes. Neurochem. Int., 36: 203-211.
CrossRef Direct Link

Thrane, V.R., A.S. Thrane, F. Wang, M.L. Cotrina and N.A. Smith et al., 2013. Ammonia triggers neuronal disinhibition and seizures by impairing astrocyte potassium buffering. Nat. Med., 19: 1643-1648.
CrossRef Direct Link

HOME JOURNALS CONTACT