Abstract: Background and Objective: The banana ranks among the top fruits in the world. Production of bananas is beset with problems of pest and disease infestation. The local Philippine cultivar ‘Saba’ has been reported to possess resistance to major diseases affecting other banana cultivars. This study assessed fungal species present in the soil rhizosphere of ‘Saba’ banana. Materials and Methods: Fungal isolates obtained and purified from the soil and were characterized morphologically in a previous study. These were identified by amplifying the ITS-5.8S rDNA sequences. Prior to amplification, the isolation of fungal DNA was optimized by the freeze-thaw method where mycelia were collected and stored at -80°C for 48 h. Then, a modified CTAB method was used to extract DNA. The PCR fragments were amplified using the primers Forward: ITS1 (5’–TCCGTAGGTGAACCTGCGG–3’) and Reverse: ITS 4 (5’–TCCTCCGCTTATTGATATGC–3). The cycling conditions were as follows: Initial denaturation at 95°C for 2 min, denaturation at 95°C for 1 min, annealing at 60°C for 1 min, 35 cycles, extension at 72°C for 1.5 min and final extension at 95°C for 5 min. Multiple sequence alignment and phylogenetic analyses were performed. Results: Fungal DNA has been successfully isolated. Two out of three fungal species whose morphological characteristics were earlier reported to conform with Aspergillus were validated in this study. Isolate 2, Aspergillus niger strain was deposited and assigned Genbank Accession No. KX093813. Isolate 3 (Genbank Accession No. KX073814) was identified as another strain of Aspergillus . They were shown to belong to a common clade with Aspergillus strains that were derived from rhizospheric soil. Strains of Aspergillus have been reported to possess various roles among which are as causal organisms of fruit rot, agents for bioremediation, antagonists of Fusarium species as well as producers of organic acids, enzymes and nutraceuticals. Conclusion: The amplification of ITS-5.8S rDNA sequences is a powerful tool in the identification of fungal species. Knowledge of fungal communities associated with plants are key to managing their health and future coping mechanism against potential pests.
INTRODUCTION
Banana is one of the most important food crops in the world next to rice, wheat and maize1. The Philippines is the 5th largest producer of bananas in the world having produced an average of 6,188,378.71 million mt per year from 1993-20132. According to the Department of Agriculture, the most commonly grown cultivars are ‘Saba’, ‘Lakatan’, Latundan’, ‘Bungulan’ and Cavendish3. Although cavendish is the major export cultivar grown, it is the least preferred banana. Saba (Musa acuminata×balbisiana), a cooking banana is most favored for its various uses. Saba may be eaten raw when ripe, cooked into desserts or processed as chips.
Problems in the banana industry include huge postharvest losses due to diseases cause by pathogens, thus, chemicals have been widely used in banana industries to reduce postharvest diseases but application of such is discourages due to economic, environment and health concerns4. Susceptibility of many cultivars to a few extremely serious diseases and pests and the continuing spread of "New" diseases into areas not previously infected are the major factors affecting yield and production costs in bananas and plantains worldwide. The major diseases and pests are black sigatoka and black leaf streak caused by Mycospharella fijiensis (Fusarium wilt caused by various races of Fusarium oxysporum f. sp. cubense), root and rhizome rot caused by the nematode Radopholus similis with association with a borer (Cosmopolites), Bunchy-top caused by a virus and Moko disease caused by Pseudomonas solanacearum5. Saba is susceptible to ‘Bugtok’ disease (caused by the bacterium Pseudomonas solanacearum) which hardens the fruit pulp, making the fruit inedible6. However, it is very resistant to diseases that infect other cultivars such as bunchy top.
Researches on banana show that fungicides, along with insecticides and nematicides applied to lessen the impact of soil-borne pests are the main pesticides on dessert banana crops. Application of these synthetic pesticides may eventually cause resistance of the said pathogens and can post a threat in the environment as well as to the health of people7. Research efforts are exerted towards finding alternative methods such as biological control. Hence, more knowledge on the fungal components present in soil samples of banana farms are needed for baseline information regarding the activity of fungal pathogens.
This study identified fungal isolates associated with ‘Saba’ banana by amplifying the Internal Transcribed Spacer (ITS) sequences. In mycological study, ITS is widely used for species identification. The ITS, a non-coding region has numerous copies and high variability within the fungal genome8. The ITS region is perhaps the most widely sequenced DNA region in fungi. It has typically been most useful for molecular systematics at the species level and even within species (e.g., to identify geographic races). Because of its higher degree of variation than other genic regions of rDNA (small sub-unit and large sub-unit), variation among individual rDNA repeats can sometimes be observed within both the ITS and IGS (intergenic spacer) regions. In addition to the standard ITS1+ITS4 primers used by most laboratories, several taxon-specific primers have been described that allow selective amplification of fungal sequences9. The nuclear-encoded ribosomal DNA genes (rDNA) of fungi exist as a multiple-copy gene family comprised of highly similar DNA sequences (typically from 8-12 kb each) arranged in a head-to-toe manner10. Each repeat unit has coding regions for one major transcript (containing the primary rRNAs for a single ribosome), punctuated by one or more intergenic spacer (IGS) regions. In some groups (mostly basidiomycetes and some ascomycetous yeasts), each repeat also has a separately transcribed coding region for 5S RNA whose position and direction of transcription may vary among groups. Several restriction sites for EcoRI and Bgl II are conserved in the rDNA of fungi. Nearly all basidiomycetes that have been studied share an EcoRI site within the 5.8S RNA gene along with a Bgl II site halfway into the LSU RNA sequence. Primers 5.8SR and LR7 include these restriction sites, which makes them also convenient for cloning10.
MATERIALS AND METHODS
Collection of fungal samples: Samples were collected from the soil of healthy banana banana farms in Davao, Philippines. The protocol for collection of samples described in this study are detailed in our previous work11. It reported that the morphological and biochemical characterization of several micro-organisms from Philippine banana cultivars. For fungi, morphological features of colonies recorded in that study were pigmentation, shape and form. Size and shape of conidia were also determined microscopically. Three fungal isolates from ‘Saba’ that were used here were initially identified as two strains of Aspergillus (Isolates 2 and 3) and one strain of Cylindrocladium (Isolate 1). These fungal isolates were revived and grown in potato dextrose agar, then their morphological characteristics were revalidated microscopically. Mycelia were harvested for DNA isolation.
Fungal DNA isolation: The DNA was isolated using the protocol of Kumar et al.12 with modifications by Al-Samarrai and Schmid13. Two modifications of the CTAB protocol for cell wall disruption were employed prior to DNA isolation: treatment of mycelia with liquid nitrogen and freeze-thaw method where mycelia collected were stored at -80°C for 48 h and isopropanol precipitation was made overnight. Collected mycelia were freeze-dried and kept at -20°C. Freeze-dried mycelia (50-100 mg) were ground using mortar and pestle. Ground mycelium of each fungal isolate was transferred to a 1.5 mL sterile microcentrifuge tube. Five hundred microliters of cetyltrimethylammonium bromide (CTAB) buffer was added to the ground mycelium followed by 10 μL of β-mercaptoethanol. The mixture was shaken well and incubated at 65°C for 1 h in a water bath. After incubation, the mixture was centrifuged at 15,100xg for 15 min. Supernatant was decanted into a new 1.5 mL Eppendorf tube and was added with equal amount of choloform: isoamylalcohol (24:1). The upper layer was collected into a fresh microcentrifuge tube and was added with an equal volume of chilled isopropanol. The solution was incubated at 20°C to facilitate DNA precipitation. The sample was centrifuged at 15,100xg for 15 min. After centrifugation, supernatant was discarded and the pellet was added with 500 μL 70% ethanol for washing. The mixture was mixed well and centrifuged at 5,700xg for 5 min. Supernatant was discarded and pellet was re-suspended in 70 μL of TE buffer.
PCR amplification of ITS-5.8S ribosomal DNA regions: These regions were amplified from the fungal isolates using the universal primers14 were used for amplification: Forward: ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) and Reverse: ITS 4 (5’–TCCTCCGCTTATTGATATGC–3). The following components of the GoTaq Green Mastermix kit (Promega, USA) were added into a sterile sterile 1.5 mL microcentrifuge tubes: 5 μL Green GoTaq Buffer, 200 μM dNTP, 0.2 μM for each of the 2 primers, 2 μL DNA sample and 1.25 U GoTaq polymerase. Optimized MgCl2 concentration was 2 mM while the primer concentration was 0.2 uM. Sufficient amount of molecular grade water to reach 25 μL was added. A thermocycler (Veriti Dx 96-well 16 Thermal Cycler, Applied Biosystems, USA) was used for PCR. For amplification of ITS, the cycling conditions were: Initial denaturation at 95°C for 2 min, denaturation at 95°C for 1 min, annealing at 60°C for 1 min, 35 cycles, extension at 72°C for 1.5 min and final extension at 95°C for 5 min. The PCR products were sent for sequencing to the Philippine Genome Center, University of the Philippines, Quezon. The DNA sequences were analyzed using BLASTn in NCBI. Multiple sequence alignment and phylogenetic analysis was performed using Clustal-Omega (EMBL-EBI). The software employs the Neighbour-Joining Method to construct a phylogenetic tree.
RESULTS
Three fungal isolates as reported in our earlier study11 when revived were found to conform with the published descriptions. Isolate 1 (morphological identification, Cylindrocladium, Fig. 1) had conidiophores which were hyaline, branched and erect. They were mainly penicillate, bearing spore masses at phialides on the corresponding branches with stipes and terminal vesicles.
| Fig. 1(a-c): | Isolate 1, (a) Cylindrocladium, (b) Arrangement of branched conidiophore and (c) Septated hypha (red arrow), spread out condiospores. Bar = 10 μm |
| Fig. 2(a-c): | Isolate 2, (a) Aspergillus, (b) Conidiophore and (c) Septated hypha (red arrow), spread out conidiospores. Blue bar = 20 μm, Green bar = 10 μm |
| Fig. 3(a-c): | Isolate 3, (a) Aspergillus, (b) Conidiophore and (c) Septated hypha (red arrow), spread out conidiospores. Blue bar = 20 μm, Green bar = 10 μm |
Conidia were hyaline, cylindrical and phialosporous. Conidia (phialospores) were born singly but held together in bundles. Isolates 2 and 3 (morphological identification, Aspergillus, Fig. 2, 3) had simple conidiophore and septated hyphae. Conidiophores were erect, hyaline to pale brown. Conidia were oriented in chains which are originating from a globular fruiting body. Spores were green to pale brown in color and are globular in shape.
Fungal DNA was successfully extracted using the CTAB protocol (Fig. 4). The freeze-dry method at -800°C for 48 h as an additional produced optimal DNA yield. Revival of colonies and DNA isolation were not successful for Isolate 1. The ITS fragments which were about 1,000 bp in size (Fig. 5) were successfully amplified in PCR. The BLAST analysis showed that their molecular identities were consistent with previously reported morphological identities, those of ITS sequences of various Aspergillus strains. Table 1 shows the summary of results for Isolate 2, which was assigned the Accession No. KX093813 when deposited in Genbank. Isolate 2 shared 99% sequence identity with A. niger strains A228, A223, 209 and ZSF16. Table 2 shows the sequence similarity search results for Isolate 3 (Genbank Accession No. KX073814). Isolate 3 also shared 99% identity with A. niger strains Z09, HRN004, PFS08 and clone WT-1-5. Figure 6 and 7 shows the deduced gene sequences of the two isolates. Phylogenetic analysis revealed that both Isolates 2 and 3 belong to one clade with a common ancestor with Aspergillus niger strain ZSF16 which was also obtained in rhizospheric soil (Fig. 8).
| Fig. 4: | DNA extracted from saba fungal isolates 2 and 3 |
| Fig. 5: | Putative ITS fragments amplified from Isolates 2 and 3 |
| Table 1: | Sequence similarity search results for isolate 2, Aspergillus sp. from ‘saba’ banana (Genbank Accession No. KX093813) |
DISCUSSION
Fungi contain metabolites that were shown to have antimicrobial properties against human and plant pathogens and therefore, it can be used in modern medicine, agriculture and industry16. The higher the diversity of soil-borne microorganisms is the greater the possibility of finding antagonistic microbes that can help in biological control of plant pathogens18.
| Fig. 6: | Isolate 2 identified as Aspergillus niger 18S ribosomal RNA gene, partial sequence, internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence, GenBank Accession no. KX093813 |
| Fig. 7: | Isolate identified as Aspergillus niger 18S ribosomal RNA gene, partial sequence, internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence, GenBank Accession no. KX073814 |
| Table 2: | Sequence similarity search results for Isolate 3, Aspergillus sp. from ‘saba’ banana (Genbank Accession No. KX073814) |
| Fig. 8: | Phylogenetic relationships of Isolate 2 and Isolate 3 with published Aspergillus strains |
Studies on the fungal components of soil along banana plantations are critical in order to attain knowledge on their biological roles and activities and to know if they serve as biological control against plant pathogens. In this study, there was a low turn-out of fungal isolates due to the active application of herbicides containing glyphosates. According to study, glyphosate is a broad-spectrum herbicide that is toxic to a wide array of organisms including lichens19, nitrogen-fixing bacteria20-23 and beneficial mycorrhizal fungi24.
Although, there are numerous published protocols for fungal DNA extraction, this step remains a bottleneck in molecular methods involving fungi. When cell lysis of microbes are not successful, additional steps such as freeze-thawing or application of liquid nitrogen are employed. Liquid nitrogen application requires many intermediate steps to be efficient and sometimes not practical nor available. Fredricks et al.25 reported that liquid nitrogen works well when obtaining large-scale DNA samples from culture. In our study, DNA extraction was only small scale (50 mg mycelia) and so liquid nitrogen addition might have created a harsh condition, thus, producing poor quality DNA. Gonzalez-Mendoza et al.26 also used liquid nitrogen in extracting DNA from filamentous fungi and showed poor results.
Cell disruption is efficient using freezing and thawing. This method allows the formation and successive melting of ice crystals in cell surface. Larger crystals are formed through gradual freezing and thus can disrupt cells more extensively. Compared to other methods, freeze-thaw method is gentle and causes no significant effects on the overall cell integrity27. Jin et al.28 froze mycelia of Aspergillus fumigatus at 70°C for DNA extraction. They reported that freezing mycelia and bead beating worked well in DNA isolation of more unknown fungi. Freezing and thawing led to successful isolation of DNA in this study.
Identification of the species and strains of both fungal isolates is of high importance in the study of banana and biological control of its pests. Aspergillus has been reported to cause fruit rot in various crops29. This fungus has also been reported to have played a role in bioremediation due to its ability to degrade organophosphates30. Sudarma and Suprapta16 identified A. niger as a potential antagonist of Fusarium oxysporum f. sp. cubense. Aspergillus also produces various organic acid, enzyme, nutraceuticals and other compounds31. Hence, antimicrobial assay and isolation and profiling of metabolites unique to both strains reported here are the next steps in determining their future practical applications and utilize their benefits in both agricultural and medical industries.
CONCLUSION
The characterization and molecular identification of micro-organisms associated with a plant is an important step towards the understanding of its health staus as well as its overall ecological balance. This study confirmed two Aspergillus strains in the ‘Saba’ banana rhizosphere. An optimized protocol for fungal DNA isolation which involved a modified CTAB method followed by an additional lysis step (freeze-drying at -800°C for 48 h) was also established.
ACKNOWLEDGMENT
We acknowledge financial support from the University of the Philippines Mindanao.