Abstract: Vibrios are halophilic bacteria and are ubiquitous in marine environments. The diversity of these bacteria in tropical areas is not clearly understood. In this study, Vibrio spp. including Vibrio parahaemolyticus were investigated at the Andaman Tarutao Island, Thailand. Water samples were collected at Son Bay and Ruesri Bay located on opposite sides of the island. The total numbers and the predominance of Vibrio spp. were determined by cultivation on thiosulfate citrate bile- salts sucrose agar. Enumeration of V. parahaemolyticus was performed on CHROMagar Vibrio. There was no correlation between the total numbers of vibrios, V. parahaemolyticus, temperature and salinity detected in both areas. By cultivation, V. parahaemolyticus was regularly observed at Son Bay except in December whereas it was detected only in April and November at Ruesri Bay. The diversity of Vibrio spp. was investigated using the Denaturant Gradient Gel Electrophoresis (DGGE) technique. The diversity of Vibrio spp. detected at Son Bay was homogeneous whereas it was more heterogeneous at Ruesri Bay. Interstingly, in December although V. parahaemolyticus was not detected by cultivation; it was present in this month according to the DGGE technique. Thus, the number of this bacterium was probably low or it was in a non-culturable phase. In this study, V. harveyi was detected in both areas every month by DGGE. This indicates that this bacterium is part of the normal microbiota and is present in the Andaman Sea throughout the year. Correlation between copepods and the numbers of V. parahaemolyticus was not observed in this study.
INTRODUCTION
Marine ecosystems are complex and dynamic. Vibrios are Gram negative bacteria, highly abundant in marine environments and are found as free-living populations and in association with plankton or marine organisms e.g., coral, fish and shellfish (Vandenberghe et al., 1998; Ringo and Birkbeck, 1999; Rosenberg and Ben-Haim, 2002). Vibrios also play a role in aquatic food web by taking up dissolved organic matter and produce essential polyunsaturated fatty acids (Sherr and Sherr, 2002; Nichols, 2003). In addition, vibrios are able to break down chitin which is a large pool of amino sugars in the oceans (Riemann and Azam, 2002). Some Vibrio spp. are able to degrade toxic polycyclic aromatic hydrocarbons contaminated in marine sediments (Hedlund and Staley, 2001). However, some of them are human pathogens such as Vibrio cholerae, the causative agent of cholera, V. parahaemolyticus and V. vulnificus which mostly cause gastroenteritis and septicemia respectively (Chiang and Chuang, 2003; Yeung and Boor, 2004; Shahcheraghi et al., 2009). Recently, V. parahaemolyticus has been reported to cause infections worldwide (Okuda et al., 1997).
The distribution of vibrios has been reported to relate to some environmental factors. A study in Chesapeake Bay indicated that V. parahaemolyticus and related Vibrio spp. were absent in the water column in winter but they reappeared in late spring and early summer when the water temperature increased. In the winter, they were detected in sediments (Kaneko and Colwell, 1973; Wright et al., 1996). Investigation of Vibrio community in Barnegat Bay revealed that abundance of vibrios was associated with increasing temperatures (Thompson et al., 2004). In addition, dynamic of V. vulnificus in this bay was less related to salinity than temperature (Randa et al., 2004). Association of vibrios to the external surface of zooplankton such as copepods has been demonstrated. Attachment of V. cholerae to live copepods made this bacterium survive longer in the water (Huq et al., 1983; Colwell, 1996). In addition, it has been speculated that planktonic blooms is associated with the cholera outbreaks (Lipp et al., 2002).
Most studies in vibrios have focused on temperate environments. However, the dynamics of Vibrio spp. in tropical environments where the water temperature is around 30°C all year round has not been fully investigated. The southern part of Thailand is a peninsula between the Andaman Sea and the Thai Gulf. Tarutao is the biggest Thai national park island off the west coast of Thailand in the Andaman Sea. The aims of this study were to investigate Vibrio spp. including V. parahaemolyticus and their correlation to environmental factors at Tarutao.
MATERIALS AND METHODS
Study areas and sample collection: Tarutao is located in Andaman Sea around 22 km away from the west coast of southern Thailand. Two areas, Son Bay and Ruesri Bay, located at opposite sides of Tarutao were selected for this study (Fig. 1). Samples were collected once a month for 6 months (January to April and November to December) during the pre-southwest monsoon period.
| Fig. 1: | Location of Son Bay and Ruesri Bay for sample collection |
Three liters of water samples was taken 500 m away from the coast and at a depth of 50 cm. Plankton was collected by filtration of 10 L of water through 22 μm plankton net and preserved in 5% formaldehyde before analysis.
Environmental factors: Water temperature and salinity were detected using a thermocouple probe (Anritsu meter Co., Ltd., Japan) and salinometer (N.O.W., Japan), respectively.
Investigation of copepods: Copepods was identified and quantitated using a light microscope and a Sedgwich-Rafter (S-R) counting chamber (Pyser, UK). Each experiment was performed in triplicate.
Number of total vibrios and predominant Vibrio spp.: The number of total vibrios and predominant Vibrio spp. was determined by filtration of 100 mL of water sample through a 0.45 μm cellulose nitrate filter (Sartorious, Germany) and the filter was placed on Thiosulfate Citrate Bile-Salts sucrose agar (TCBS). In addition, 100 μL of water sample was also spreaded on TCBS. The agar plates were incubated at room temperature. The number of all visible colonies on the agar plates is referred as total vibrios.
Restriction Fragment Length Polymorphism technique (RFLP) has been demonstrated to determine genotypes of many bacteria including Vibrio spp. (Urakawa et al., 1997; De Vega et al., 2005). In this study, PCR-RFLP of 16S rDNA region was performed to identify predominant isolates of Vibrio spp. Briefly, colonies on TCBS with different morphological characteristics were selected and 16S rDNA sequences of those isolates were amplified by PCR using primers 27F 5' AGAGTTTGATC(A/C)TGGCTC AG 3' and 1492R 5' TACGG(C/T)TACCTTGTTACGACTT 3' as described previously by Lane et al. (1985) and Vergin et al. (1998). The amplification products were treated with BsaHI, HinfI and RsaI restriction enzymes (Urakawa et al., 1997). After electrophoresis, the predominant isolates that exhibited different DNA fingerprints were selected and their species were confirmed by sequencing of a part of 16S rDNA using the Applied Biosystems 377 genetic analyzer. The search for sequence homology of the 16S rRNA was performed using the Basic Local Alignment Search Tool (BLAST) program. A >99% identity in the 16S rDNA gene sequence was the criterion used to identify an isolate to the species level.
Enumeration and identification of V. parahaemolyticus: A total of 100 mL of water sample was filtered through a 0.45 μm cellulose nitrate filter (Sartorious, Germany) then the filter was placed on CHROMagar Vibrio (CHROMagar Microbiology, Paris). In addition, 100 μL of water sample was also spreaded on CHROMagar Vibrio. The plates were incubated at 37°C overnight. Specific purple colonies of V. parahaemolyticus were counted (Hara-Kudo et al., 2003). Three to five colonies from each plate were selected to confirm them as V. parahaemolyticus by PCR targeted to the toxR gene (Vuddhakul et al., 2000).
Diversity of Vibrio spp.: Under stressful environmental conditions, some Vibrio spp. can enter Viable But Non-Culturable (VBNC) states (Colwell et al., 1985; Bates and Oliver, 2004). In this phase, a decrease in cell volume has been demonstrated (Denner et al., 2002). To identify Vibrio spp. including VBNC cells, 1,000 mL of water sample was filtered through a 0.22 μm membrane filter (Supor, Gelman). The filters were immediately placed in sterile micro centrifuge tubes and stored at -80°C until used.
DNA from these filters was extracted by a SDS-based DNA extraction method (Zhou et al., 1996) and was purified by a QIAquick Gel Extraction kit (QIAGEN, Germany). Nested PCR was performed to amplify 16S rDNA of Vibrio spp. using the universal primer pair 27F and 1492R for the first round as described above. The second round PCR analysis was performed using a reaction mixture containing 1 μL of the first-round PCR product, 2 μL of 10 x PCR buffer (Promega, USA), 2 mM MgCl2, 1.25 μM of each GC567F (5’CGCCCGCCGCGCCCCGCGCCCGTCC CGCCGCCCCCGCCCGGGCGTAAAGCGCATGCAGGT3’) and 680R (5’GAATTCTACCCCCCTCTACAG3’) primers (Thompson et al., 2004), 0.025 U of Taq polymerase (Promega, USA) and 0.2 mM dNTPs in a total volume of 20 μL. The PCR reaction involved 95°C for 8 min, 35 cycles of 95°C for 1 min, 64°C for 3 min, and 72°C for 1 min, followed by a final extension at 72°C for 4 min. Amplified products were subjected to Denaturant Gradient Gel Electrophoresis (DGGE) (Eiler and Bertilsson, 2006).
RESULTS AND DISCUSSION
Number of vibrios and environmental factors: There is no single selective medium that can support growth of all species within the genus Vibrio. In this study, TCBS was used for enumeration of total numbers of vibrios because it is a selective medium and supports the growth of most environmental and clinical Vibrio isolates (Gharibi et al., 2010; Adeleye et al., 2011). The largest number of total vibrios at Son Bay and Ruesri Bay were detected (3.65x107 and 1.04x 107 cfu 100 mL-1, respectively) in April (Fig. 2a, b). Although the temperature at that time was high, there were no significant correlations observed between temperature and the number of vibrios over the full period of this study (Fig. 3a, b). The salinity at that time was 32.5 and 33.0 ppt at Son Bay and Ruesri Bay, respectively. Salinity did not change significantly during the full testing period but a combination of the salinity and high temperature at that time might support growth of the bacteria and resulted in the abundance of the Vibrio population detected in this month. This result supports the study of Eiler et al. (2007) who demonstrated that temperature alone did not significantly affect the abundance of total bacterioplankton, total Vibrio spp. or individual Vibrio.
| Fig. 2(a-b): | Total vibrios and V. parahaemolyticus determined at (a) Son Bay and (b) Ruesri Bay |
| Fig. 3(a-b): | Temperature and salinity investigated at (a) Son Bay and (b) Ruesri Bay |
Dynamics of V. parahaemolyticus: CHROMagar is a selective and differential medium that has been widely used for detection many pathogenic bacteria (Rahbar et al., 2008; Taha et al., 2010). In this study, CHROMagar Vibrio was used for enumeration of V. parahaemolyticus. At Son Bay, V. parahaemolyticus was detected in every month except December (Fig. 2a) whereas at Ruesri Bay, it was detected only in April and November (Fig. 2b). The largest populations of V. parahaemolyticus were detected in those months that also had an abundance of Vibrio spp. in both areas. Son Bay is an open wide bay located at about the middle of the West Coast Shore of Tarutao Island thus water has a regular exchange and probably reflects the situation in the open sea. In this situation, the dynamics of V. parahaemolyticus does not significantly change. However, Ruesri Bay is a sheltered island bay at the top of the North East corner of Tarutao Island; a low exchange of water may affect the biological activity which influences the number of V. parahaemolyticus.
Predominant Vibrio spp.: In this study, we investigated only the variations of the predominant Vibrio spp. in each month by cultivation on TCBS. V. harveyi was the predominant isolate at Son Bay in 4 out of the 6 months (Table 1) whereas V. harveyi and V. alginolyticus were the predominant isolates at Ruesri Bay in 2 out of the 6 months. V. brasiliensis, a novel sp. of Vibrio was detected predominantly in April and March at Son Bay and Ruesri Bay, respectively. This bacterium was first isolated in Brazil which is in a tropical region (Thompson et al., 2003). Thus, its presence in these areas is not unpredictable.
Diversity of Vibrio spp. detected at Tarutao: The DGGE technique was used to evaluate the types of different Vibrio populations present in the community by generating fingerprints of PCR products from the DNA of different isolates (Rahman et al., 2008; Kutako et al., 2009). Although different DNA sequences that represent many of the dominant microbial organisms are amplified, this DGGE technique cannot quantify numbers of organism in the sample. DGGE analysis of Vibrio spp. revealed that similar Vibrio spp. including V. harveyi, V. parahaemolyticus, V. proteolyticus, V. aestuarianus, V. neptunius, V. brasiliensis were detected in every month at Son Bay (Table 1, Fig. 5) except that V. hepatarius was replaced by V. parahaemolyticus in December.
| Table 1: | Predominant and diversity of Vibrio spp. detected at Son and Ruesri Bays |
| Fig. 4(a-b): | Copepods detected at (a) Son Bay and (b) Ruesri Bay |
This correlated to the result of an undetected this organism on the selective CHROMagar Vibrio in December (Fig. 2a). In Ruesri Bay, the detected Vibrio spp. was more heterogeneous (Table 1). It was of interest that in December although V. parahaemolyticus was not detected by cultivation on CHROMagar Vibrio, it was present in this month according to the DGGE technique. Thus, the number of this bacterium was probably low or it was in a VBNC phase for some unknown reason. In this study, V. harveyi was detected in both areas every month by DGGE.
| Fig. 5: | DGGE profile of Vibrio spp. at Son Bay . (1) V. proteolyticus, (2) V. aestuarianus, (3) V. neptunius, (4) V. brasiliensis, (5) V. harveyi, (6) V. parahaemolyticus and (7) V. hepatarius |
This indicates that this bacterium is normal microbiota and is present in the Andaman Sea throughout the year.
Correlation between copepods and V. parahaemolyticus: It has been suggested that there is a close partnership between Vibrio spp. and zooplankton. Large numbers of Vibrio including V. parahaemolyticus are known to attach to the external surface of zooplankton (Huq et al., 1983; Heidelberg et al., 2002). The association of V. cholerae with zooplankton, copepods, is assumed to cause cholera outbreaks during planktonic blooms (Lipp et al., 2002). In this study, during January to April and November to December, the correlation between V. parahaemolyticus and copepods was investigated at both Son and Ruesri Bays (Fig. 4). Copepods were regularly detected at between 42-62% of the total zooplankton population in Son Bay except in January; copepods were predominant but their numbers did not correlate to the numbers of V. parahaemolyticus detected in this month (Fig. 2a, 4a). The distribution of this plankton was irregular at Ruesri Bay (between 20-50% of total plankton). There was no relationship between copepods and V. parahaemolyticus detected in this bay although both of them were detected in abundance in April (Fig. 2b, 4b). These results confirm the study of Huq et al. (1983) who demonstrated that in the presence of live copepods, number of V. cholerae was increased but little change in number of V. parahaemolyticus was observed. Thus prediction of V. parahaemolyticus outbreaks cannot rely on the number of copepods.
CONCLUSION
An investigation of the Vibrio community in a tropical area, Thailand, indicated that the diversity of Vibrio spp. was dependent on the location. A homogeneous population of Vibrio spp. was detected in an area that was open to the sea whereas a more sheltered bay of the island, supported a much more heterogeneous population. Correlation between V. parahaemolyticus and copepods was not observed.
ACKNOWLEDGMENTS
This study is a subproject under the biodiversity of Tarutao project conducted by the Centre for Biodiversity of Peninsular Thailand (CBIPT), Thailand. The authors thank Thai Government for providing some funds for this study and thank Dr. Brian Hodgson for assistance with the manuscript.