Abstract: The main objective of the present study was to isolate and identify the secondary metabolite producing Actinomycetes and to analyze the phylogenetic relationship. The soil samples were collected from the rhizosphre soil of Manakkudy mangroves, West Coast of India and screened for its antimicrobial potential. The novel bioactive compound producing strains were cloned in pGEM-T vector and sequenced. The phylogenetic relationship among the 20 Streptomyces sp. were studied. Phylogeny analysis showed that all the 20 isolates were having strong similarity (98%) with Streptomyces. Eight different species of Streptomyces such as Streptomyces olivoverticillatus, Streptomyces caelestis, Streptomyces roseoviridis, Streptomyces venezuelae, Streptomyces showdoensis, Streptomyces bikiniensis, Streptomyces griseoruber, Streptomyces roseus and 8 new strains (Streptomyces JS-1, Streptomyces JS-8, Streptomyces JS-10, Streptomyces JS-12, Streptomyces JS-14, Streptomyces JS-17, Streptomyces JS-19 and Streptomyces JS-20) were identified among the 20 isolates. The Streptomyces isolates JS-1, JS-8, JS-10, JS-12, JS-14, JS-17, JS-19 and JS-20 were considered as the new lineages of Streptomyces. Biochemical characterization was carried out and showed highly active by having different extracellular enzyme production to metabolize the nutrients in the environment. The GC contents were calculated for all the 20 Streptomyces isolates and it ranges between 58 and 59.6% in all the 20 sequences. All the isolates (JS-1 to JS-20) were having strong antagonistic activity against various bacterial and fungal pathogens, but the activity was differing in all the 20 Streptomyces. Phylogenetic analysis revealed that the isolates are the divergent of Streptomyces which are associated in the rhizosphere soil of Mangrove. A study of this kind will provide more details about the bioactive potential of Streptomyces from the estuarine ecosystem.
INTRODUCTION
Mangroves, unique woody plant communities of intertidal coasts in tropical and subtropical coastal regions, are highly productive ecosystems (Costanza et al., 1997; Wang et al., 2003) though surprisingly little is known about the microbial communities living therein (Hong and Yan, 2008; Hyde and Lee, 1995; Yan et al., 2006) although there is evidence that mangrove sediments contain high populations of micromonosporae (Eccleston et al., 2008) and novel actinomycetes, as illustrated by the isolation of Asanoa iriomotensis (Han et al., 2007) and Nonomuraea maheshkhaliensis (Takizawa et al., 1993). It is also encouraging that bioactive compounds have been obtained from mangrove plants (Takizawa et al., 1993; Huo et al., 2008; Wu et al., 2004), fungi (Gao et al., 2007; Lazzarini et al., 2000; Lin et al., 2001, 2002, 2008) and bacteria (Tang et al., 2007) including actinomycetes (Bull et al., 2005; Xie et al., 2006). Streptomyces have provided many important bioactive compounds of high commercial value and continue to be routinely screened for new bioactive substances. Around two-thirds of naturally occurring antibiotics have been isolated from actinomycetes (Okami and Hotta, 1988) and they are responsible for the production of about half of the discovered bioactive secondary metabolites (Berdy, 2005), notably antibiotics (Strohl, 1997), antitumor agents and enzymes (Oldfield et al., 1998). Excellent track record of actinomycetes in this regard, a significant amount of effort has been focused on the successful isolation of novel actinomycetes from terrestrial sources for drug screening programs in the past fifty years. Rate of discovery of new compounds from terrestrial actinomycetes has decreased, whereas the rate of re-isolation of known compounds has increased (Fenical et al., 1999). Thus, it is crucial that new groups of actinomycetes from unexplored or underexploited habitats be pursued as sources of novel bioactive secondary metabolites. The diversity of life in the terrestrial environment is extraordinary; the greatest biodiversity is in the oceans (Donia and Hamann, 2003). As marine environmental conditions are extremely different from terrestrial ones, it is surmise that marine actinomycetes have different characteristics from those of terrestrial counterparts and, therefore, might produce different types of bioactive compounds. The genetic and metabolic diversity of marine actinomycetes, which remains largely unknown. Indeed, the marine environment is a virtually untapped source of novel actinomycete diversity (Bull et al., 2005) and, therefore, of new metabolites (Fiedler et al., 2005; Jensen et al., 2005). However, the distribution of actinomycetes in the sea and marine ecosystem is largely unexplored and the presence of indigenous marine actinomycetes in the oceans remains elusive. Furthermore, skepticism regarding the existence of indigenous populations of marine actinomycetes arises from the fact that the terrestrial bacteria produce resistant spores that are known to be transported from land into sea, where they can remain available but dormant for many years (Bull et al., 2000). Genomic studies indicate that the genetic potential for producing secondary metabolites is not uniformly distributed within the bacterial world. The Streptomyces in the mangrove ecosystem were remains untapped. In this study the diversity of antibiotic producing Streptomyces were identified from the Manakkudy Mangrove ecosystem of Palayaru river estuary, Arabian Sea, India.
MATERIALS AND METHODS
Sample collection and isolation of actinomycetes: The samples were collected during January, 2007 from the Rhizosphere soil of Rhizophora mucronata, Manakkudy estuary of Arabian Sea, Tamil Nadu, India (8° 6' 12" N77° 28' 57" E) at 5 feet depth. Soil samples were serially diluted in sterile water and spread plated over the medium containing soluble starch 20 g, KNO3 1 g, NaCl 0.5 g, K2HPO4 0.5 g, MgSO4 0.5 g, FeSO4 20 μM, agar 15 g, seawater from mangrove habitat 1 L and 15 μg nalidixic acid were added to inhibit the growth of other bacteria and incubated at 28°C for 3 days. Biochemical characterization was carried out based on Cappuccino and Sherman (2002) and shown in Table 1.
Antimicrobial assay: The isolated actinomycetes were further grown on the medium with glucose 20 g, tryptone 5 g, yeast extract 5 g, KNO3 1 g, NaCl 0.5 g, K2HPO4 0.5 g, MgSO4 0.5 g, distilled water 1 L and assayed for their antagonistic effect against selected microorganisms.
| Table 1: | Biochemical characterization of Streptomyces isolates JS-1 to JS-20 |
| Table 2: | Antimicrobial activity of Streptomyces isolates |
Antagonistic activity of the isolated strains JS-1 to JS-20 was performed by double-layer agar method (Gauthier et al., 1975). Staphylococcus aureus, Enterobacter sp., Pseudomonas aeruginosa (MTCC 741), Salmonella typhi (MTCC 733), Bacillus subtilis and Klebsiella pneumoniae (MTCC 109), Proteus vulgaris and Candida albicans were the microbes used for assay. The zone of inhibition is shown in Table 2.
Amplification and cloning of 16S rRNA gene: The genomic DNA was isolated by Phenol-Chloroform method. The amplification of 16 S rRNA gene was done by using universal forward (5' CAGGCCTAACACATGCAAGTC 3') and reverse (5' GGGCGGWGTGTACAAGGC 3') (Sigma, India). The following composition was made for the amplificatio n-PCR reaction buffer- 5 μL, MgCl2 2 μL, dNTPs 1.2 μL, Template DNA 2 μL, Reverse primer 4 μL, Forward primer 4 μL, Taq polymerase 5 μL, Water 26.8 μL were added for the reaction. The conditions were initial denaturation at 95°C for 3 min, denaturation at 95°C for 1 min, annealing at 56°C for 1 min, elongation at 72°C for 1.5 min and the final elongation at 72°C for 10 min for 30 cycles. The PCR amplified products were cloned into pGEM-T vector and then sequenced.
Sequencing and Phylogenetic analysis: DNA samples were sequenced by the sequencing instrument Macrogen 3730XL7-16112-010 and the sequences were processed by ABI 1.6.0. The sequence were merged in EMBOSS Merger. The merged sequences were blasted with the NCBI database and analyzed for homology and phylogenetic analysis using CLUSTAL W and Genebee online software (PHYLIP).
RESULTS AND DISCUSSION
Antimicrobial activity: The agar overlay method showed antimicrobial activity against different bacterial and fungal pathogens. The results were tabulated in Table 2. Same species of the Streptomyces which were collected from the same site showed different antimicrobial activity and they were physiologically different. The organisms were sequenced after their variations in the Biochemical test. The results of Biochemical tests were tabulated in Table 1.
Phylogenetic analysis and Streptomyces sp. diversity: The diversity of the colony morphology was observed and is shown in Fig. 1. Twenty different Streptomyces sp. were isolated from the Manakkudy Mangrove sediment. Among the 20 Streptomyces sp. JS-20, showed similarity to 7. Streptomyces venezuluea JS-11. Streptomyces JS-12 and Streptomyces roseus JS-18 and Streptomyces roseaviridis JS-9. This strain showed more antimicrobial properties, but they are biochemically different and antagonistic activity is different among the 99% similarity to the organisms. Streptomyces Olivoverticillatus strain JS-2 showed 98% of the sililarity to Streptomyces caelestis strain JS-6 and 97% homology to Streptomyces roseorubens, Streptomyces ghanaensis strain OSS 47 Streptomyces griseoruber strain JS-16 and Streptomyces caelestis strain JS-4. Streptomyces sp. JS-17 showed 96% similarity to Streptomyces albogriseolus. Streptomyces sp. JS-1 showed distant relation to all the other Streptomyces sp. isolated from the sediments. Streptomyces sp. JS-13 showed 97% similarity to Streptomyces viridobrunneus. Streptomyces olivoverticillatus strain JS-3 showed 97 and 98% homology to the strains. Streptomyces caelestis strain JS-6 Streptomyces griseoruber strain JS-16 Streptomyces caelestis strain JS-4 and Streptomyces caelestis strain JS-5. JS-7 JS-5, JS-6, JS-16 JS-4 These four Streptomyces showed different.
| Fig. 1: | Colony morphology of 20 Streptomyces JS-1 to JS-20 isolated from Mangrove swamp |
| Fig. 2: | Neighbourhood joining of Streptomyces strains JS-1 to JS-20 isolated from the rhizosphere soil of Rhizophora mucronata |
Biochemical properties but they are evolutionary oriented from Streptomyces venezuluea JS-10 in the phylogenetic tree analysis. Streptomyces olivoverticillatus strain JS-2 showed 98% of the similarity to Streptomyces caelestis strain JS-6 and 97% homology to Streptomyces roseorubens, Streptomyces ghanaensis strain OSS 47 Streptomyces griseoruber strain JS-16 and Streptomyces caelestis strain JS-4. The neighborhood analysis of the 20 Streptomyces sp. were shown in Fig. 2. Antibacterial and antifungal activities were different in all the 20 Streptomyces sp. isolated from the soil rhizosphere of Rhizophora mucronata sediments.
Nucleotide sequence accession numbers: The 16S rRNA gene sequences of representative isolates were deposited in the NCBI databank under the accession EU124770 to EU124788 and EF536325 shown in Table 3.
Analysis of length and GC content of Streptomyces: We analysed the number of nucleotide base pairs in the 16S rRNA gene sequencing of all the 20 Streptomyces and the GC content was calculated. The GC content was varied in all the eight species of Streptomyces ranging from 58-9.8%. The GC content variation range among the 20 Streptomyces and the basepairs for all the 20 sequences were tabulated in Table 4.
Actinomycetes are a group of prokaryotic microorganisms capable of producing many types of secondary metabolites, which are Gram-positive bacteria that grow extensively in soils with rich organic matter (Henis, 1986; Demain, 1999). Actinomycetes are isolated from rhizosphere soil of Mangroves and all of them showed antibacterial and antifungal properties against human pathogens. Actinomycetes are previously reported in the rhizosphere sample by Sembiring et al. (2000). The bioactive compound of same Streptomyces are showing different antifungal and antibacterial activities which shows the chemodiversity of the bioactive compounds present in all the 20 Streptomyces JS-1 to JS-20 isolates.
| Table 3: | Taxan with accession number of the 16 S rRNA gene sequences of Streptomyces JS-1 to JS-20 |
| Table 4: | The length and GC content of the 20 Streptomyces JS-1 to JS-20 isolated from mangrove swamp |
Studies on the antimicrobial property of the actinomycetes are showing variations in the antimicrobial activities (Zheng et al., 2000). In the present work similar results are shown and highly supporting the present research. Actinomyctes were reported for the production of bioactive compounds based on their distribution in various habits (Huck et al., 1991). Mangrove ecosystem is poorly studied environment of bioactive compounds (Hong et al., 2009). Hence, the development and application of new strategies for the detection, isolation and subsequent description of novel actinomycetes, from natural mangrove habitat was an essential need for the bioactive compound discovery (Zengler et al., 2002). Actinomycetes are one of the most prolific producers of antibiotics (Strohl, 1997; Berdy, 2005). Among 52 Actinomyctes isolated in the present study, twenty isolate showed antimicrobial potential against the human pathogens. Similar results were previously reported by Huck et al. (1991). Antimicrobial property to human pathogens and secondary metabolite production from Streptomyces sp. was also observed (Thangapandian et al., 2007; Rabah et al., 2007; Krishna Kumari et al., 2006).
Most bioactive products of microbial origin are derived from few taxonomic groups and terrestrial habitats (Berdy, 2005; Lam, 2007). The phylogenetic relationship of the Streptomyces sp. isolates are proving that, they are the lineages of the same genus and originated from the terrestrial environment which are acclimatized to the halophilic and the chemophilic environment of the rhizosphere soil of the mangrove Rhizophora mucronata. The Streptomyces isolates JS-1, JS-8, JS-10, JS-12, JS-14, JS-17, JS-19 and JS-20 are considered as the new lineages of Streptomyces because of its variations in biochemical, antimicrobial properties and phylogenetic analysis. The range of GC content of all the 16S rRNA sequences of the Streptomyces shows the divergence among the Streptomyces sp. The chemical diversity of the Streptomyces of same species is due to the rhizosphere environment which produces soil exudates and the halophilic nature of mangrove soil. Hence, the different lineages of Streptomyces sp. were adapted to the complex environment in the rhizosphere soil.
Antibiotic production is more in the Actinomycetes (Berdy, 2005; Strohl, 1997) and produces over half of the bioactive compounds in the Antibiotic Literature Database (Lazzarini et al., 2000). Exploitation of terrestrial actinobacteria over many years estimated 95% rediscovery rate of known compounds (Fenical et al., 1999), but Streptomyces from the estuarine ecosystem were halophilic nature and were adapted to the rhizosphere soil will produce novel antibiotics. It is becoming evident that mangrove rhizosphere habitats are an abundant, novel source of actinobacteria for discovering natural products originated from terrestrial environment. In the present work, the Streptomyces sp. were believed to be of terrestrial origin, transported to rivers by rain or irrigation water and finally to the marine environment where they are exposed to water with salt concentrations and temperatures that differ from those of the terrestrial environment. As a result, some metabolic changes may occur in the organisms (Okazaki and Okami, 1975) and secondary metabolite would be produced with good antibacterial and antifungal potential. Actinomycetes in marine and estuarine sediments have not been investigated extensively although their ubiquitous presence in marine sediments has been well documented (Takizawa et al., 1993; Moran et al., 1995). The purification and structural characterization studies of the bioactive secondary metabolites being carried out in the laboratory.