Abstract: To explore the sequence structure of fox TYR gene and it’s mechanism to regulate the pelage color’s dividing. In this study, the partial DNA sequence (1370 bp) of silver fox TYR gene was obtained by PCR amplification and direct sequencing. This sequence contained the intron 1 of 368 bp, the complete exon 2 of 217 bp and the intron 2 of 785 bp and GC content was 40.5%. Based on the sequences of TYR gene exon 2, the homological analysis and the construction of un-rooted phylogenetic tree were carried out among silver fox and the other 16 species by using DNAMAN software and Clustalx (1.83) software, respectively. The homological analysis showed that silver fox had the closest genetic relationship with dog and the closer genetic relationship with domestic cat and domestic ferret. The cluster result of un-rooted phylogenetic tree was similar to that of the homological analysis. The length of TYR gene exon 2 were 217 bp for all analyzed species, which indicated that TYR gene exon 2 were highly conservative in phylogeny. The above results can provide the important biological information for further researching the development and regulation mechanism of fox coat color which result from TYR gene.
INTRODUCTION
Tyrosinase is the key regulatory enzyme of melanogenesis and it can catalyzes the rate-limiting steps of melanin biosynthetic pathway and plays a major role in animal coat color (Del Marmol and Beermen, 1996; Aigner et al., 2000; Chen et al., 2012). The TYR gene belongs to the TYR gene family, the members of which (tyr, typ-1 and typ-2) encode the tyrosinase, tyrosinase related protein 1 and 2, respectively (Garcia-Borron and Solano, 2002). The mammalian TYR gene is composed of 5 exons and 4 introns and coding sequence has a length of 1.6 kb (Aigner et al., 2000). The function mutations of the TYR gene were shown to result in mammalian albinism phenotype, which were confirmed in human (Spritz et al., 1990; Oetting and King, 1999), cattle (Schmutz et al., 2004), domestic cat (Schmidt-Kuntzel et al., 2005) and rhesus monkey (Zhang, 2000; Ding et al., 2000) and so on.
The silver fox, a variant of the red fox (Vulpes vulpes) (Kukekova et al., 2004) originated from Alaska of North America and the eastern region of Siberia and it has become a major breed of valuable fur animals through the artificial breeding and training of more than 100 years. The hair coat of silver fox is mixed black and white and have a layer guard hair like fog. Silver-blue fox and blue-silver fox are the hybrids of silver fox and blue fox. Crystal fox, golden island fox and agate fox are the hybrids of silver fox and red fox. All of the hybrids above have concentrated the fine qualities of silver fox. For example, there are thin, unbending, short and smooth guard hairs and uniform distributed some silvery hair in the hybrids coat. The fur of fox are one of the major ornament of clothes for modern people in winter.
In recent years, some reports have focused on structure of the TYR gene and more attention has been focused on expression, polymorphism analysis of the TYR gene in many species. Yang et al. (2006) studied the correlation between TYR gene polymorphism and coat color of sheep, suggesting that TYR gene could be a functional gene affecting the synthesis of coat color of sheep. Gao et al. (2008) reported that TYR expression level might be related to coat color of alpaca. Chen et al. (2012) reported that TYR expression level was positively correlated with the degree of gray in Jining gray goat. Previous investigations of the TYR gene focused on its variation in sheep, goat and alpaca and little attention was paid to other special economic animals, especially to fox.
In the study, the partial DNA sequence of silver fox TYR gene was obtained by PCR amplification, sequencing and sequences alignment and this sequence was further analyzed. The results could provide the biological information to further study the TYR gene expression, corresponding protein structure and regulation mechanism of fox coat color.
MATERIALS AND METHODS
Sample preparation and extraction of genomic DNA: Skin samples were collected from silver fox by biopsy at the Golden Island fox breeding farms, Changli County, Qinhuangdao City, Hebei Province, samples were stored in liquid nitrogen.
Genomic DNA was isolated from each 100 mg skin sample of silver fox according to the standard phenol: chloroform extraction method and stored at -20°C.
Primer design, PCR amplification and sequencing: The fragment (1405 bp) of silver fox TYR gene containing partial intron 1, complete exon 2 and partial intron 2 was amplified using a pair primer designed by Primer 3 based on dog sequence from GenBank (NW_876273). The forward and reverse primers were 5’- TGTGAGAGCCAAAAGAGAAGA -3’ and 5’- CTGAAGGAAAGAGCAAGTAGGA -3’), respectively and they were synthesized by Shanghai Sangon Biological Engineering and Technology services Co. Ltd (Shanghai, China).
PCR amplification was carried out in a Biometra personal PCR instrument with a total volume of 50 μL reaction containing 1 μL (75 ng μL-1) of silver fox genomic DNA, 5 μL of 10xPCR standard reaction buffer (Mg2+ Plus), 4 μL deoxynucleoside triphosphates (2.5 pmol L-1 of each deoxynucleotide), 2 μL (10 pmol L-1) of each forward and reverse primer, 0.5 μL (5 U μL-1) of Taq DNA polymerase (TaKaRa Biotechnology Co. Ltd., Dalian, China) and 35.5 μL of distilled water. After predenaturation for 5 min at 94°C, the PCR profile consisted of a denaturation step at 94°C for 45 sec, an annealing step at 58°C for 45 sec and an elongation step at 72°C for 1 min for a total of 34 cycles, followed by a final extension of 10 min at 72°C. The PCR products were detected on 1.5% agarose gel including 0.5 μg mL-1 of ethidium bromide, photographed under UV light and sequenced by Shanghai Sangon Biological Engineering Technology, Biological and Technology and Service Co., Ltd. (Shanghai, China).
Sequences analysis and database search of TYR gene: Sequence of the silver fox TYR gene was examined and edited using the BioEdit version 7.0.5.2 (Hall, 1999). Searches for the other sequence similarity were performed with the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST). A total of 16 sequences with the exon 2 of the TYR gene belonging to 16 species were searched from GenBank. Alignment and homological analysis of sequences were performed using DNAMAN software. The un-rooted phylogenetic tree among species was constructed using Clustalx (1.83) software.
RESULTS
PCR amplification, sequencing and identification of silver fox TYR gene: The 1405 bp fragment of silver fox TYR gene was obtained by PCR amplifying (Fig. 1). By alignment of sequences and detecting chromatogram of nucleotide sequences, we were able to analyze 1370 bp bases because sequencing of bases from 10145 to 10184 were not successful, according to the reference sequence (NW_876273).
The alignment result revealed that the obtained sequence had 92.3% identity and the corresponding region of dog TYR gene (NW_876273), which suggested that the sequence was the partial sequence of silver fox TYR gene. Further analysis showed that the sequence contained the intron 1 of 368 bp, the complete exon 2 of 217 bp and the intron 2 of 785 bp and the content of A, C, G and T were 29.3, 22.8, 17.7 and 30.2%, respectively.
Homology analysis of TYR gene exon 2 among species: Based on the sequences of TYR gene exon 2, the homological analysis were carried out between silver fox and the other 16 species respectively by using DNAMAN software. Results revealed that the sequence similarity between silver fox and dog, domestic cat, domestic ferret, pig, cattle, sheep, goat, human, gorilla, baboon, gibbon, monkey, house mouse, Norway rat, chicken and goldfish were 98.6, 93.6, 92.6, 92.2, 89.5, 88.9, 88.5, 89.4, 89.4, 88.9, 88.5, 88.0, 82.0, 81.1, 76.0 and 67.3%, respectively (Table 1).
Phylogenetic analysis: Based on the sequences of TYR gene exon 2, the un-rooted phylogenetic tree among silver fox and other 16 species was constructed by using Clustalx (1.83) software (Fig. 2). According to Fig. 2, the phylogenetic tree was significantly divided into three major clades. The mammalian animals (including silver fox, dog, domestic ferret, domestic cat, sheep, goat, cattle, monkey, gibbon, human, gorilla, baboon, house mouse and Norway rat), goldfish and chicken were fall into a clade, respectively. Further observation found that the mammalian animals were again divided into four small clade. Silver fox, dog, domestic ferret and domestic cat fall into one small clade.
| Fig. 1: | PCR products (1405bp) of silver fox TYR gene (1-3: PCR products; M: DNA Marker DL 2000) |
| Table 1: | Homology analysis of silver fox to other species in TYR gene exon 2 |
| Fig. 2: | Un-rooted phylogenetic tree of silver fox and other species based on the nucleotide sequence of TYR gene exon 2 |
Sheep, goat, cattle and pig fall into another small clade. Monkey, gibbon, human, gorilla and baboon fall into the third small clade. House mouse and Norway rat fall into the fourth small clade.
DISCUSSION
According to TYR gene sequence of dog (NW_876273), PCR amplification was completed using silver fox genomic DNA as template. The obtained nucleotide sequence had highly identity to that of dog TYR gene (NW_876273) and the similarity was 92.3%. The alignment results preliminary showed that the obtained nucleotide sequence was the partial sequence of silver fox TYR gene. Further analysis indicated that the fragment contained the partial sequence of intron 1 (368 bp), the complete exon 2 (217 bp) and the partial sequence of intron 2 (785 bp) and GC content was 40.5%. In usual condition, GC content is about 40 to 45% in the vertebrate genome. Whereas, GC content was not uniform distributed in the genome, the content reached 67% in some DNA fragment, it was only about 33% in another DNA fragment (Sueoka, 1962). The genomes of warm-blooded vertebrates were a mosaic of alternating fragments, isochores, with low and high GC contents and embedded genes (Bernardi et al., 1985; Jaksik and Rzeszowska-Wolny, 2012). The difference of GC content in genomic, might play an important role in the regulation of gene expression and gene mutation (Bernardi et al., 1988). In this study, GC content (40.5%) of the obtained sequence for silver fox TYR gene was in the range of 40~45%. However, whether there was a close contact between the obtained sequence (particular exon 2) and functions of silver fox TYR gene, then need to carry out in further research. After comparing DNA sequence of exon 2 of silver fox TYR gene and the corresponding sequences of 16 species published in GenBank, the results showed that the similarity between silver fox and dog was the highest (98.6%), the next was domestic cat (93.6%) and domestic ferret (92.6%) and it also had higher similarities (92.2~81.1%) with pig, cattle, sheep, goat, human, gorilla, baboon, monkey, house mouse and Norway rat, etc. It is suggested that silver fox had the closest genetic relationship with dog and the closer relationship with domestic cat and domestic ferret. In addition, the length of TYR gene exon 2 were 217 bp for all of the species listed in Table 1, which suggested that TYR gene exon 2 was highly conserved. The un-rooted phylogenetic tree of silver fox and 16 other species also showed that silver fox had the closest genetic relationship with dog, then with domestic cat and domestic ferret. It is well known that silver fox and dog belong to the Vulpes species of canidae. Domestic cat belongs to the felis of felidae. Domestic ferret is a member of the weasel family and a descendant of the European Polecat. But the three species are all carnivores. The another small clade of un-rooted phylogenetic tree was sheep and goat clustered first and then cattle and pig were added successively. The third small clade from the mammalian animals were human and gorilla clustered first and then gibbon, monkey and baboon were added successively. The fourth clade from the mammalian animals only included two species: house mouse and Norway rat. Sheep, goat and cattle belong to ruminants. Human, gorilla, gibbon, monkey and baboon belong to primates. House mouse and Norway rat belong to rodent. Obviously, the cluster result was similar with the traditional classification in general and the species of each clade accorded with their physiological characteristics. These results were basically consistent with those of Liu et al. (2010, 2012) and Kang et al. (2008). Liu et al. (2012) reported that the closest relationship existing among silver fox, red fox, dog and domestic cat, between sheep and cattle, among human, chimpanzee, common gibbon and olive baboon and between house mouse and oriental house rat by constructing phylogenetic tree of MC1R gene for 19 species. In addition, Liu et al. (2010) drew the same conclusion that the closest relationship existing among sheep, goat and cattle, between human and rhesus monkey, between house mouse and Norway rat by constructing phylogenetic tree of MyoG gene for 12 species. Kang et al. (2008) also reported that the closest relationship existing among sheep, goat and cattle, between human and chimpanzee and between mouse and rat by constructing phylogenetic tree of LF gene for 10 species.
CONCLUSION
In this study, the partial DNA sequence (1370 bp) of silver fox TYR gene was obtained by PCR amplification and direct sequencing. This sequence contained the intron 1 of 368 bp, the complete exon 2 of 217 bp and the intron 2 of 785 bp and GC content was 40.5%. According to the sequence of TYR gene exon 2, the results of homology analysis and un-rooted phylogenetic tree both showed silver fox had the closest genetic relationship with dog. These can provide the important biological information for further researching the development and regulation mechanism of fox coat color which result from TYR gene.
ACKNOWLEDGMENTS
This study was supported by National Natural Science Foundation of China (No. 31040048, 31272412),Special Fund for Agro-scientific Research in the Public Interest (No. 200903014-07) and Natural Science Foundation of Hebei Province (No. C2013407101).