Occurrence and Distribution of Colletotrichum spp. on Mango (Mangifera indica L.) in Puerto Rico and Florida, USA

MATERIALS AND METHODS

Disease survey and collection of plant material: Samples showing typical anthracnose symptoms were collected from mango orchards in Puerto Rico and Florida, during October 1999 to July 2001 (Fig. 1). Fruit samples imported from Mexico, Brazil and Nicaragua that were sold in Florida’s markets were also collected to examine the possibility of the introduction of new species via fruit importation. Studies were conducted in the following locations; (I) in Puerto Rico: Juana Diaz, Ponce and Santa Isabel in the southern region; and Mayagüez and Rincon at the western region and (ii) in Florida: Bradenton, Sarasota and Pine Island in the western region; Homestead in the central region; and Palm Beach, Canal Point and Boynton Beach at the eastern region (Fig. 1).

Fungal isolation and identification: Fungi were isolated from symptomatic mango tissues after surface sterilization with ethanol (70%) and sodium hypochlorite (0.5%). Then tissues were rinsed with sterile de-ionized distilled water and transferred to potato dextrose agar acidified with 25% lactic acid (APDA). Plates were incubated at 26°C and single spore cultures were used for morphological, molecular and serological characterization of Colletotrichum isolates. Conidial measurements of each isolate were determined from 50 observations at 400X magnification. Morphological observations were made of colony types and from reproductive structures mounted in semipermanent slides.

Other Colletotrichum isolates obtained from different tropical crops such as coffee (Coffea arabica L.), anonna (Annona squamosa L.), guava (Psidium guajava L.), papaya (Carica papaya L.), soursop (Annona muricata L.) and starfruit (Averrhoa carambola L.) were included in the study for comparison. Cultures were maintained on APDA at room temperature and stored cryogenically at -80°C at the University of Florida, Gulf Coast Research and Education Center, Bradenton, FL.

Various taxonomic keys were used to identify all fungal isolates obtained from mango infected tissues (Barnett and Hunter, 1998; Dyko and Mordue, 1979; Sutton, 1980; Mordue, 1971). Isolates of Alternaria sp. and Fusarium sp. were sent to CABI Biosciences, UK for identification.

In vitro pathogenicity tests: Pathogenicity tests were conducted in vitro on detached mango leaves (var. Keitt) under controlled laboratory conditions at 25°C for 110 isolates of Colletotrichum species. Leaves were surface sterilized with 70% ethyl alcohol, 0.5% sodium hypochlorite for 1 min each, rinsed with sterile de-ionized distilled water and placed in plastic humidity chambers (i.e., 91x41x15 cm).

Fig. 1:	Location of mango farms and collection sites sampled for anthracnose in Florida and Puerto Rico

Inoculations were made by placing mycelial plugs (4 mm diam.) of Colletotrichum spp. from 7-day-old fungal cultures on the upper surface of the leaves after an incision made with a sterile dissection needle. Controls were inoculated with APDA disks after an incision. Humidity chambers were incubated at 25°C at 90-100% HR in randomized complete blocks. The experiment was replicated three times.

DNA extraction and ITS region amplification: DNA was extracted from all Colletotrichum isolates using the CTAB method (Graham et al., 1994). DNA amplification was performed using the following primers: ITS4 (TCCTCCGCTTATTGATATGC) coupled with primers for C. gloeosporioides (CgInt) (GGCCTCCCGCCTCCGGGCGG) and C. acutatum (CaInt2) (GGGGAAGCCTCTCGCGG) in a 50 μL reaction volume (Brown et al., 1996; Mills et al., 1992; White et al., 1990). PCR reaction mixture contained 1X Taq buffer (10 mM Tris-HCl, pH 9.0; 50 mM KCl), 0.2 mM of each dNTP (Promega, Madison, WI), 25 pmol of each primer, 1 U Taq polymerase (Fisher Scientific, Pittsburgh, PA or Sigma, St. Louis, MO), 1 mM spermidine, 1.5 or 3.75 mM MgCl₂ (for the C. gloeosporioides or the C. acutatum specific reactions, respectively) and 10-100 ng of template DNA. Amplification was performed using a MJ Research PTC100 thermocycler (Watertown, MA). PCR conditions were the following: initial DNA denaturation for 5 min at 95°C, followed by 34 cycles of 45 sec at 95°C, 75 sec at 55°C for CgInt or 69°C for CaInt2, 2 min (+3 sec/cycle) at 72°C. After all cycles, a final elongation was conducted for 5 min at 72°C. Following PCR, the amplification product was stored at 4°C until subjected to electrophoresis. PCR products were visualized in 1% agarose gels using ethidium bromide and UV light. DNA samples from any isolates that failed to react with either primer set were further purified by an additional isopropanol precipitation and then the PCR was repeated. Each individual analysis was replicated twice.

ELISA: ELISA was used to differentiate C. acutatum from other Colletotrichum species. This assay utilized a Colletotrichum acutatum Identikit (ADGEN Limited, Ayr, Scotland, UK) following the manufacturer’s instructions. Samples tested were conidial suspensions made from Colletotrichum spp. cultures grown on acidified carnation leaf agar (ACLA). Results of the ELISA were read at 405 nm (reference point = 550 nm), on the Easy Reader EAR 400AT plate reader (SLT Labinstruments, Australia).

RESULTS

Disease survey, collection of plant material and fungal isolation: Twelve sites were sampled from different geographical regions in Puerto Rico and Florida. Sites surveyed, number of samples per plant organ and location are shown in Table 1. A total of 183 fungal isolates were collected, of these 149 isolates were obtained from typical anthracnose lesions from mango leaves, flowers, fruits and panicles. Eighty and sixty nine isolates were obtained from Puerto Rico or Florida, respectively. The majority of the isolates were obtained from fruits (46%) and leaves (50%) (Table 1). Eighty seven percent of the isolates were from mango including nine additional isolates from imported fruits from Mexico, Brazil and Nicaragua that were sold in Florida’s markets. Another 5% (10 isolates) were obtained from other tropical fruits including anonna, guava, papaya, soursop, coffee and starfruit. Eight percent (14 isolates) were either contaminated or lost during manipulation.

Characterization of Colletotrichum spp. from mango: Different types of colonies were commonly observed on acidified potato dextrose agar: i) white, cottony mycelium with not obvious sporulation (11%); ii) white, cottony mycelium with gray concentric rings with not obvious sporulation (19%) and iii) gray and/or white mycelium with different levels of sporulation showing orange masses of conidia (70%) (Fig. 2).

Based on morphological observations, fungal colonies producing cylindrical conidia with obtuse ends or slightly ellipsoid, such as Colletotrichum gloeosporioides, was frequently isolated from mango leaves and fruits at both locations, whereas fungal colonies producing fusiform conidia, with one acute end, likely C. acutatum, were obtained from peduncles, flowers and immature fruits only in Homestead, FL (Fig. 3 A and B). Ninety five percent of the isolates examined were identified as C. gloeosporioides; while only 5% were identified as C. acutatum.

Conidial size of C. gloeosporioides and C. acutatum ranged from 12-20x3.5-6 μm and 8-13x2-5 μm, respectively. Both species’ bear unicellular and hyaline conidia produced in setose acervuli (Fig. 3 C). Perithecia containing asci and ascospores of C. gloeosporioides teleomorph, Glomerella cingulata, were observed in culture plates (Fig. 3D). As we had foreseen, the accurate identification of a group of isolates required further studies using PCR and ELISA to confirm their identification due to instability of traits such as colony type, conidial morphology and production in APDA. In addition, some isolates did not sporulate profusely on culture media and their characterization required molecular or serological techniques.

Table 1:	Location of mango groves examined during this survey and number of Colletotrichum spp. isolates collected per plant organ

Fig. 2:	Colletotrichum spp. colony types grown on acidified potato dextrose agar were: A) white, cottony mycelium with no obvious sporulation; B) white, cottony mycelium with gray center with no obvious sporulation and C) white or D) gray mycelium with different levels of sporulation, showing orange masses of conidia (→)

Fig. 3:	Conidia of (A) C. gloeosporioides and (B). C. acutatum. (C) Acervulus of C. gloeosporioides, observed black setae and (D) perithecia of C. gloeosporioides teleomorph, Glomerella cingulata, containing asci and ascospores (→)

Table 2:	Identification of Colletotrichum spp. using PCR and ELISA assays
a/ Primers set used were CgInt/ITS4 for C. gloeosporioides and CaInt2/ ITS 4 for C. acutatum. Two different PCR reactions were conducted. Key: + = positive or - = negative reactions, b/A commercial ELISA test for C. acutatum from Adgen Limited, Scotland, UK was used. Key: + = positive and - = negative reactions for C. acutatum

Other fungi isolated during the studies: Various fungal species were isolated from necrotic lesions in mango and were identified as Phomopsis sp., Cladosporium sp., Curvularia sp., Fusarium pallidoroseum, Pestalotiopsis sp., Alternaria infectoria and Nigrospora sp. Pathogenicity tests indicated that A. infectoria, F. pallidoroseum and Pestalotiopsis sp. were pathogenic to detached mango leaves under laboratory conditions (data not shown).

PCR amplification of rDNA ITS region and ELISA assays: Ninety three percent of the mango isolates tested positive for C. gloeosporioides, while only 5% (eight isolates from Florida) were identified as C. acutatum using specific primers for each species (Table 2; Fig. 4 and 5). Three isolates representing 2% (one fruit isolate from Sarasota, Florida and 2 leaf isolates from Mayagüez, Puerto Rico) initially identified as C. gloeosporioides were not confirmed at species level using PCR and ELISA assays. Seven isolates from guava, soursop and starfruit tested positive for C. gloeosporioides, while isolates from annona (PR), papaya (FL) and coffee (PR) were negative for both C. gloeosporioides and C. acutatum. All Colletotrichum spp. isolates obtained from Florida’s markets imported from Mexico, Brazil and Nicaragua were identified as C. gloeosporioides.

Fig. 4:

Colletotrichum isolates from mango identified as C. gloeosporioides using primers CgInt and ITS 4. Isolates tested were: 1820-2 (lane 2 and 13), 1820-3 (lane 3 and 14), Mxed 01 (lane 4 and 15), C. acutatum control (lane 5 and 16), 1815-3 (lane 6 and 17), 1821-3 (lane 7 and 18), 1820-4 (lane 8 and 19), 1820-5 (lane 9), C. gloeosporioides + control (lane 10 and 11), water (lane 12) and 1kb ladder (lanes 1 and 20)

Fig. 5:

Colletotrichum isolates from mango were identified as C. acutatum using primers CaInt2 and ITS 4. Isolates tested were: 1824-4 (lane 2), 1866 (lane 3), 1805A (lane 4), 1805C (lane 5), Mcg 27(lane 6), Mcg 36 (lane 7), Mcg 12 (lane 8), Mcg 73 (lane 9), Mcg 25 (lane 10), Mcg 89 (lane 11), Mxed 02 (lane 12), Mxed 12 (lane 13), Mxed 13 (lane 14), Mxed 14 (lane 15), C. acutatum + control (lane 18), water (lane 20) and 1kb ladder (lane 1)

Pathogenicity tests: Pathogenicity tests conducted with 110 selected isolates on detached mango leaves showed that 100% were pathogenic on mango leaves. Necrotic lesions and typical orange conidial masses were often observed on leaves 5 to 7 days after inoculation (Table 3).

Table 3:	Pathogenicity tests of C. gloeosporioides and C. acutatum isolates collected from mango tissues from Puerto Rico and Florida. Data represent mean lesion dia. (mm) per number of isolates tested on detached mango leaves in vitro after 5 to 7 days of incubation at 25°C

Puerto Rico’s isolates of C. gloeosporioides caused larger lesion diameter (mm) on detached mango leaves than Florida’s isolates. Fruit isolates caused larger lesions than those obtained from leaves. Florida’s isolates of C. acutatum obtained from flowers produced larger lesions than those obtained from panicles. There were no differences in lesion size among Florida’s C. gloeosporioides.

DISCUSSION

Present results verified and corroborated the identity of C. acutatum causing anthracnose on mango flowers, peduncles and immature fruit from Homestead, Florida. Previous studies in Florida using cluster analysis of randomly amplified polymorphic DNA (RAPD) indicated five distinctive Colletotrichum groups. Davis (1999) applied boot-strap analysis and stated that RAPD groupings were not rigorous and that RAPD groupings could not be used to evaluate phylogenetic relationships among groups because membership of individual isolates within a particular group could be considered equivocal. Based on spore shape and virulence on mango inflorescence, Davis (1999) suggested that one group of isolates might be classified as C. acutatum and not C. gloeosporioides.

The findings reported herein facilitate and improve current detection systems of diseases through the application of DNA technology (PCR). An important fact is that C. acutatum is reportedly more resistant to fungicides such as benomyl and azoxystrobin than the more common species C. gloeosporioides, which is critical for disease management purposes (Adakaveg and Foster, 2000: Lugo- Noel, 2001). This might imply future significant changes in distribution and prevalence of Colletotrichum populations in sampled regions of Florida.

In Puerto Rico, C. acutatum was not isolated from mango and has not been reported, even though, fungal isolations were made strictly from fruits and leaves. Studies on the genomic and pathogenic diversity of Colletotrichum spp. are needed to improve the scope of our knowledge of the anthracnose causing populations in different tropical fruits in Puerto Rico.

ACKNOWLEDGMENTS

This research was supported by a USDA T-STAR-76 grant in collaboration with the Department of Plant Pathology, University of Florida in Bradenton and the Department of Crop Protection, University of Puerto Rico, Mayagüez Campus. We thank all reviewers for their time and effort.