Isolation and Identification of Salmonella paratyphi from Enteric Fever Patients at Different Hospitals of Quetta City

MATERIALS AND METHODS

Research study was conducted in (CASVAB) Center for Advanced Studies in Vaccinology and Biotechnology University of Balochistan, Quetta from 1 January, 2017 to 1 March, 2018.

Collection of blood samples: A total 480 blood samples were aseptically collected from different hospital of Quetta. The samples were collected by venipuncture victimization sterile technique. The samples were taken to laboratory in cold chain condition for further process. All information about patient history, age, gender was collected through predesign proforma.

Processing of samples: Collected samples from hospital were inoculated directly into blood culture bottles containing 50 mL brain heart infusion broth and incubated at 37°C for 24 h. The samples were streaked on selective and differential media plates and incubated at 37°C for 24 h. All isolates were triple cloned to get pure growth for gram staining, different biochemical tests (Indole, Methyle red, Voges-proskeuer, Simmon Citrate, Sugar Fermentation test, Oxidase and Catalase) and PCR.

Anti-microbial susceptibility test: Anti-microbial susceptibility was checked by disc diffusion method according to clinical and laboratory standards institute guidelines¹⁵ (CLSI, 2006). Suspension of bacterial cells (0.5 McFarland) was prepared and dispersed on the surface of Mueller-Hinton agar (Oxoid, UK) and incubated at 37°C for 24 h. The isolates were considered as sensitive and resistant to particular anti-microbial agent on the basis of inhibitory zone.

Polymerase chain reaction for Salmonella paratyphi : The DNA was extracted from culture through DNA purification kit (Hiper^® Bacterial Genomic DNA Extraction Teaching Kit). The template DNA was stored at -20°C for further use. Primer of following sequence F: (AATCAACAACAACCTGCAGCG) R: (TAGTGCTTAATGTAGCCGAAGG) were design to allow amplification of 329 bp fragment of fliC-a gene. For PCR amplification 25 μL volume reaction mixture was used which contain 12 μL master mix (2x AmpMaster^™ Taq), 9 μL grade water, 1 μL of each primer (forward, reverse) and 2 μL template DNA. The PCR cycling for reaction mixture were: Initial melting 95°C for 5 min, denaturing 95°C 30 sec, annealing 48°C for 1 min, extension 72°C for 45 sec, final extension 72°C for 10 min. The final PCR product was run on 1.5% agarose gel and observed under UV light.

RESULTS

Total 480 blood samples were collected from different hospitals of Quetta. Out of which 55% were positive and 45% negative for S. paratyphi as shown in Fig. 1.

Gender wise distribution result showed that the male (34%) were more affected with paratyphoid fever as compare to female (20%) as shown in Fig. 2.

Age wise distribution revealed that Salmonella paratyphi was high in 20-30 years (38%) followed by 10-20 years (9.16%) and 1-10 years (7.5%) age group patients as shown in Fig. 3.

Race wise distribution results shown that paratyphoid fever cases were significantly high (25.41%) in Pashtoon followed by 15.83% in Baloch, 8.33% in Punjabi and 5.41% in Hazara as shown in Fig. 4.

The 40% paratyphoid fever were observed in patients with low socioeconomic status, 9.16% in middle socioeconomic status and 5.83% in the patients belonged to high socioeconomic status as shown in Fig. 5.

Fig. 1:	Positive and negative samples of S. paratyphi isolated from blood samples

Fig. 2:	Gender wise distribution of patients affected by S. paratyphi

Fig. 3:	Age wise distribution of patients affected by S. paratyphi

Fig. 4:	Race wise ratio of paratyphoid infection in patients positive admitted in different hospitals of Quetta city

Fig. 5:	Distribution of positive patients based on socioeconomic status

The S. paratyphi was identified through differential media, selective media, gram staining and different biochemical test.

Table 1:	Biochemical characterization for S. paratyphi isolated from blood samples
+: Positive, -: Negative

Table 2:	Antibiotic susceptible pattern of Salmonella paratyphi isolated from blood samples

Salmonella paratyphi produce non-lactose fermenting colonies on MacConkey agar while on selective media Salmonella paratyphi produce red colonies with black center on Xylose lysine Deoxycholate and colorless colonies with black on Salmonella Shigella agar. The S. paratyphi have methyl red, motility, simmon citrate, urease and catalase positive tests. The Salmonella paratyphi ferment following sugar such as glucose, sorbitol, rhamnose, mannitol, dulcitol and xylose as shown in Table 1.

Antimicrobial susceptibility test: The Salmonella paratyphi were sensitive to Chloramphenicol, Gentamicin, Polypeptide, Quinolones and Amikacin while resistance to Penicillin, Amoxicillin, Cephalosporines, Cefotaxime, Glycopeptides, Aminoglycosides, Flagyl, Lincosamides, Macrolides and Sulfonamides as shown in Table 2.

Molecular detection of Salmonella paratyphi : In present study PCR based identification of specific gene was used to detect Salmonella Paratyphi. All isolates of Salmonella paratyphi was used to produce the specific size of 329 base pair fragment of flic-a gene as shown in Fig. 6.

Fig. 6:	Molecular identification of Salmonella paratyphi in blood samples by direct using flic-a genes specific primer
	Lane M:100 plus DNA ladder, Lane 1 negative control, Lane 2-4 positive samples

DISCUSSION

Paratyphoid fever caused by Salmonella paratyphi is rising in the country due to the non-availability of safe drinking water or ingestion of food contaminated with pathogen. In our study 480 blood samples were collected in which 55% were positive and 45% were negative for Salmonella paratyphi. Amongst them male (34%) were more affected with Salmonella paratyphi as compare to female (20%). Present finding was similar with the finding of Khosla¹⁶ and Sood and Taneja¹⁷. This study showed that Salmonella paratyphi affected all age group usually 20-30 years (38%) followed by 10-20 years (9.16%) and 1-10 years (7.5%).

In current study Salmonella paratyphi was identified through differential medium, gram staining and different biochemical tests like IMVIC, catalase, oxidase, sugar fermentation, citrate utilization and urease test similar finding were reported by Wanjiru¹⁸.

Salmonella paratyphi were sensitive to Chloramphenicol (23 mm), Gentamicin (12 mm), Amikacin (24 mm), Polypeptide (13 mm), Quinolones (23 mm) while resistance to Cephalosporines, Penicillin, Streptomycin, Neomycin, Kanamycin, Glycopeptides, Flagyl, Lincosamides, Macrolides and Sulfonamides, similar results were found by Afroze et al.¹⁹.

In present study PCR based identification of specific gene was used to detect Salmonella paratyphi. All isolates of Salmonella Paratyphi was used to produce the specific size of 329 base pair fragment of flic-a gene, similar results were found by Ali et al.²⁰ and Kulkarni et al.²¹.

This study was largely restricted to the research setting but in future, it will provide large scale surveillance data regarding the organisms that cause paratyphoid fever, in particular changes in Salmonella Paratyphi carriage and disease in the context of vaccination.

CONCLUSION

Paratyphoid fever is endemic in Quetta, Balochistan. Salmonella paratyphi show resistance against number of antibiotics so there is need to find that anti-microbial drug which is sensitive to this organism. In order to control disease strong initiatives must be taken to improve water sanitation, hygiene level, supply of save drinking water and vaccination is recommended in order to eradicate the disease.

SIGNIFICANCE STATEMENT

Salmonella paratyphi isolates was found to be increasing than previously reported and no study on the isolation and identification of Salmonella paratyphi in blood has been reported in the patients of Balochistan. The increasing drug resistant Salmonella paratyphi must be controlled to prevent epidemics of enteric fever within community. For paratyphoid fever, food and water precautions are the only prevention method as no vaccines are available. There is a strong need for determining the role of Salmonella paratyphi and also make effective procedure that help to prevent spread of infection.

ACKNOWLEDGMENT

The author acknowledged director CASVAB, University of Balochistan, Quetta who allowed for research study. Author also acknowledged the staff of Bolan medical complex hospital Quetta and Civil hospital Quetta who co-operates during samples collection.