Subscribe Now Subscribe Today
Research Article
 

Isolation and Characterization of Halotolerant Bacteria Associated with the Midgut of Culex quinquefasciatus Say (Diptera: Culicidae)



Appadurai Daniel Reegan, Michael Gabriel Paulraj and Savarimuthu Ignacimuthu
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

We show for the first time that the midgut of Culex quinquefasciatus (Say) mosquito larvae harbors halotolerant bacteria. The midgut from field collected Cx. quinquefasciatus larvae were dissected under aseptic conditions, homogenized and plated on LB agar medium with 2% (w/v) NaCl. Two different colonies were successfully isolated and bacterial isolates were identified by 16S rRNA sequences. The halotolerant bacterial isolates were: Halobacillus litoralis (CxH1) and Staphylococcus cohnii (CxH2). The gene sequence of these isolates has been deposited in GenBank (JN016804 and JN183986). These halotolerant bacteria grew in the absence of salt (0%) as well as in the presence of relatively high salt concentrations in culture medium (20%), and grew best in the presence of 8-10% (w/v) NaCl. H. litoralis and S. cohnii showed growth up to 18 and 20% (w/v) NaCl, respectively. Optimum growth temperatures for both the bacteria were between 30-37°C. H. litoralis was resistant to the antibiotics oxacillin, penicillin, polymixin and S. cohnii was resistant to the antibiotic oxacillin.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Appadurai Daniel Reegan, Michael Gabriel Paulraj and Savarimuthu Ignacimuthu, 2013. Isolation and Characterization of Halotolerant Bacteria Associated with the Midgut of Culex quinquefasciatus Say (Diptera: Culicidae). Pakistan Journal of Biological Sciences, 16: 1311-1317.

DOI: 10.3923/pjbs.2013.1311.1317

URL: https://scialert.net/abstract/?doi=pjbs.2013.1311.1317
 
Received: March 14, 2013; Accepted: March 18, 2013; Published: April 25, 2013



INTRODUCTION

Mosquitoes are medically important insects in the group of arthropods, which transmit parasites and pathogens responsible for several dreadful diseases. Mosquitoes in the genus Culex are the most important vectors of West Nile (WN) virus (Hayes et al., 2005) and Filariasis (F) worldwide (Rahuman et al., 2009). Cx. quinquefasciatus (Say) is a major vector in India; there are 45 million cases of lymphatic filariasis in India alone (Bowers et al.,1995; Agrawal and Sashindran, 2006). Estimates suggest that about 119 million people over 73 countries are infected with human lymphatic filariasis (Ramaiah et al., 2000; WHO, 2006). The alimentary canal of the mosquito larvae is composed of the foregut, midgut and hindgut. The foregut is involved primarily with ingestion, conduction and storage of food (Romoser, 1996) midgut is involved in digestion. Large communities of diverse microorganisms reside in insects with a major concentration in the intestinal midgut (Dillon and Dillon, 2004).

In early 1960s, a few studies have reported the presence of various species of Gram-negative and Gram-positive bacteria in the midguts of laboratory-reared Culex mosquitoes (Chao and Wistreich, 1959; 1960; Ferguson and Micks, 1961). A study of the midgut of Cx. quinquefasciatus larvae indicated the presence of bacteria represented by Bacillus spp., Staphylococcus sp., Pseudomonas sp., Aspergillus and Streptomyces sp. (Vasanthi and Hoti, 1992). The presence of Aeromonas culicicola (Pidiyar et al., 2002) and Wolbachia sp. (Pidiyar et al., 2003) from the midgut of Cx. quinquefasciatus mosquito larvae has been reported. The presence of Acinetobacter spp. and Lactococcus spp. from the midgut of wild Cx. quinquefasciatus mosquito larvae has also been reported (Pidiyar et al., 2004). However, many key questions about bacteria within the mosquito’s midgut remain largely unanswered; obligate bacteria have not been identified in mosquito’s digestive canal to date (Gusmao et al., 2007) and better understanding of the acquisition of Midgut-Associated Bacteria (MAB) by wild mosquito populations is needed for biological based control (Cirimotich et al., 2011).

Halotolerant bacteria have been isolated from different ecosystems of high salt content and some nonsaline environments. They have been found in the Sea wate r (Tarawneh et al., 2008), soil (Ahmed et al., 2007) and pond water (Gareeb and Setati, 2009). Cx. quinquefasciatus, the vector of filariasis in urban India, breeds in water polluted with organic wastes (Dua et al., 2007). In southern India, the polluted river Cooum running across Chennai Metropolitan area, is the major breeding site for Cx. quinquefasciatus mosquitoes. River Cooum is mainly polluted with organic wastes and household wastes (Gowri et al., 2008) and the concentration of salinity ranges from 588 to 3, 274 mg L-1 with a mean of 1,906 mg L-1 in premonsoon (Giridharan et al., 2010). To date, microbiological studies in the midgut of Cx. quinquefasciatus mosquito larvae have focused and discussed only on the aerobic non-halotolerant bacteria. Identification and characterization of such midgut flora may contribute to a better understanding of mosquito-pathogen interactions that are important for the development of vector control strategies (Rani et al., 2010) and many of the genetic tools developed for the non-halophilic bacteria can be applied to the moderate halotolerant bacteria (Ventosa et al., 1998) to make them suitable for use in bioremediation applications. In the present study Cx. quinquefasciatus mosquito larvae were collected from Cooum river and halotolerant bacteria were isolated from the midgut. The study described here represents one of the first studies to describe the population of halotolerant bacteria in the midgut of field-collected Cx. quinquefasciatus mosquito larvae. The phenotypic characteristics, 16S rRNA gene sequence identification and susceptibility to antibiotics were examined and a phylogenetic analysis was carried out.

MATERIALS AND METHODS

Field site, mosquito larvae collection and handling: Mosquito larvae, Cx. quinquefasciatus were collected from the polluted river Cooum, Chennai, India. River Cooum flows east into the Bay of Bengal through the center of the Chennai Metropolitan Area, India (13°04' N and 80°17' E). The larvae were brought live to the laboratory within one hour of collection.

Dissection and Isolation of microorganisms: Fourth instar Cx. quinquefasciatus larvae (n = 10) were taken for the midgut dissection and were surface sterilized according to Gusmao et al. (2007). The larvae were rinsed serially, for 1 min, in the following solutions: sodium hypochlorite (1%), sterile Phosphate-Buffered Saline (PBS) (81 mM Na2HPO4, 19 mM NaH2PO4, 150 mM NaCl, pH 7.4) and ethanol (70%). Finally, the insect larvae were rinsed three times in PBS/1 min. The sterilizations and dissections were performed in a laminar flow hood. The midgut was carefully separated from the larvae, rinsed in sterile PBS and transferred into a 2 mL micro centrifuge tube, containing 1000 μL of PBS. This procedure was repeated until ten midguts were obtained. The tubes were mixed thoroughly with a pestle, and an aliquot of 100 μL was transferred to a 50 mL test tube containing 10 mL of Luria-Bertani (LB) medium (HiMedia, India) with NaCl concentration of 2% (w/v). Then the test tube was incubated at 30-37°C for 48 h, under agitation (80 rpm). After incubation the cultures were serially diluted (10-1 through 10-7) and an aliquot of 100 μL of each one was transferred to Petri dishes containing LB agar (Luria-Bertani agar) with NaCl concentration of 2% (w/v). Plates were incubated at 30-37°C for 48 h and surveyed for aerobic halotolerant bacteria. The isolated halotolerant bacteria were further restreaked in LB agar plates with increased NaCl concentration to find out maximum tolerant level and in LB agar without NaCl (0%) to find out the capability of growth in the absence of NaCl.

Identification of microorganisms: Microorganisms were first screened based on colony morphology of isolates and characterized by microscopic observation. Gram staining was performed by KOH sensitivity test; Catalase sensitivity test was performed by Catalase identification Kit and Motility test was done by hanging drop technique. DNA extraction from the halotolerant bacteria was adapted from Li et al. (2001). The 16S rRNA was amplified using the following universal primers: 27f (5' - AGAGTTTGATCCTGGCTCAG - 3') (Lane et al., 1985) and 1492r (5' - TACGGCTACCTTGTTCTCAG - 3') (Delong 1992). Polymerase Chain Reaction (PCR) was performed with template DNA solution (2 μL/L100 μg), 27f primer (1 μL/6 μ mol), 1492r primer (1 μL/6 μmol), 25 mm MgCl2 (1.5 μL) and 17.5 μL of ultra pure water. Cycling parameters for the PCR included an initial denaturation step at 95°C/5 min, followed by 35 cycles of a denaturation step at 95°C/30 sec, a primer annealing step at 50°C/45 sec, an extension step at 72°C/ 1 min, and a final step at 72°C/4 min. The PCR was performed in a gradient cycler thermocycler (Mastercycler Gradient, Eppendorf, Germany). Sequencing of the amplified gene was performed in an ABI 3100 DNA Sequencer (Applied Biosystems, USA).

Sequences alignment and phylogenetic tree analysis: The DNA sequences from CxH1 and CxH2 were subjected to similarity searches to investigate sequence similarities using BLAST tool (http://www.ncbi.nlm.nih.gov/BLAST/). We took maximum similar sequences with nucleotide homology>90% and the sequences were aligned using Clustal W algorithm (Thompson et al., 1994). The phylogenetic tree was generated by MEGA-4 sequence analysis software (Kumar et al., 2004) with Neighbor-Joining (NJ) Euclidean method.

RESULTS

Isolation and morphology: Two different bacterial colonies were successfully isolated from the midgut of Cx. quinquefasciatus and purified on LB agar supplemented with 2% (w/v) NaCl. Purified strains (on 2% NaCl) were then streaked on LB agar plates with 3% (w/v) NaCl and incubated for 48 h at 30-37°C. Strains capable of growing at 3% were further grown on 4% (w/v) NaCl concentration for 48 h at 30-37°C and the NaCl concentration was increased on a weekly basis to find out maximum tolerant level. These two halotolerant strains, H. litoralis (CxH1) and S. cohnii (CxH2) grew in the absence of NaCl (0%) as well as in the presence of NaCl >15% (w/v) with an optimum concentration of 8-10% (w/v); they were considered as moderate halotolerant bacteria. Strain CxH1 grew up to 18% (w/v) NaCl and strain CxH2 grew up to 20% (w/v) NaCl.

Morphological characters, Gram staining and the range of NaCl concentrations that permitted growth are summarized in Table 1. Both the halotolerant bacteria produced colonies on solid LB agar media that were pink to pale yellow. CxH2 was Gram negative, motile, catalase positive and CxH1 was Gram positive, motile, catalase, oxidase and coagulase positive. Spore formation and orange pigmentation were observed in CxH1. However CxH2 did not produce spore but showed pale yellow pigmentation. Escherichia coli (MTCC-25922) was used as control organism to countercheck the halo growth of midgut isolated halotolerant bacteria.

Antibiotic susceptibility assay: Strain CxH1 was found to be highly resistant to the antibiotics oxacillin, penicillin, polymixin and sensitive to the antibiotics Ampicillin, Imipenem, Rifampicin, Tetracycline and Vancomycin. Strain CxH2 was found to be sensitive to most of the antibiotics tested. In particular CxH2 was susceptible to Ampicillin, Imipenem, Penicillin, Polymyxin, Rifampicin, Tetracycline and Vancomycin and resistant to the antibiotic Oxacillin. The zone size measurements of the antibiotic susceptibility are presented in Table 2.

Phylogenetic analysis: Phylogenetic analysis was performed for both the midgut isolated halotolerant bacteria (CxH1 and CxH2) and it was based on a comparison of the 16S ribosomal RNA sequences with some of their closest phylogenetic relatives. Fifteen related sequences were randomly chosen by BLAST analysis in GenBank and correlated with the 16S rRNA gene sequence (791 bp) of strain CxH1 (Fig. 1) and 16S rRNA gene sequence (750 bp) of strain CxH2 (Fig. 2). The tree was generated by neighbor-joining method using the MEGA-4 software.

Table 1: Phenotypic characteristic of two halotolerant strain H. litoralis and S. cohnii
Image for - Isolation and Characterization of Halotolerant Bacteria Associated with 
  the Midgut of Culex quinquefasciatus Say (Diptera: Culicidae)

Table 2: Antibiotics Susceptibility test (Zone size measurements in mm)
Image for - Isolation and Characterization of Halotolerant Bacteria Associated with 
  the Midgut of Culex quinquefasciatus Say (Diptera: Culicidae)
The data shown are mean values of three replicates±standard deviation, *Indicates resistant to the particular antibiotics

Image for - Isolation and Characterization of Halotolerant Bacteria Associated with 
  the Midgut of Culex quinquefasciatus Say (Diptera: Culicidae)
Fig. 1: Phylogenetic tree showing the relationships between strain CxH1 and related bacterial species, based on 16S rRNA gene sequences. The branching pattern was generated by the MEGA-4 with neighbour-joining method. Bootstrap values higher than 70 out of 100 subreplicates are indicated at the respective bifurcations, The scale bar represents 0.2 substitutions per nucleotide position

Image for - Isolation and Characterization of Halotolerant Bacteria Associated with 
  the Midgut of Culex quinquefasciatus Say (Diptera: Culicidae)
Fig. 2: Phylogenetic tree showing the relationships between strain CxH2 and related bacterial species, based on 16S rRNA gene sequences. The branching pattern was generated in MEGA-4 with neighbour-joining method. Bootstrap values higher than 40 out of 100 subreplicates are indicated at the respective bifurcations. GenBank accession numbers of the sequences of the organisms used are shown in parenthesis

DISCUSSION

Hypersaline environment represents a valuable source of halotolerant/halophilic microorganisms with potential applications. Although, a lot of investigations have been done on isolation and characterization of halotolerant microorganisms from saline and non-saline environments, there is no report available on halotolerant microorganisms residing in the midgut of Cx. quinquefasciatus mosquito larvae. Our investigations narrowed down to mosquito larvae Cx. quinquefasciatus, which lives in polluted waters. Results of our study showed that midgut of Cx. quinquefasciatus mosquito larvae harbors two halotolerant microorganisms belonging to bacterial populations. This result coincided with the earlier report of Pseudoxanthomonas icgebensis sp. nov. isolated from the midgut of Anopheles stephensi field collected mosquito larvae, which grew in TSB medium containing 0-8% NaCl (optimum at 2% NaCl) (Rani et al., 2010).

The salt tolerance of the halotolerant bacteria isolated in this study showed growth in the presence of relatively high salt concentrations in culture medium (Table 1). For instance, several Bacillus, Staphylococcus, Halomonas, Paenebacillus and Clostridium spp., are well known for their broad salt tolerance, being able to tolerate salinities of 10% (w/v) NaCl or even greater. The capacity of these bacteria to produce spores contributes to their resistance to a broad range of physiological stresses such as salinity (Tiquia et al., 2007). Two strains of halotolerant bacteria found in this study belonged to the genus Halobacillus and Staphylococcus; they were previously been reported in saline environments such as the Great Salt Plains of Oklahoma (Caton et al., 2004), deep-sea sediments (Naganuma et al., 2005; Takami et al., 1997), Great Salt Lake in Utah (Spring et al., 1996) and from marine sediment-derived sample (Yang et al., 2002). To the best of our knowledge, this is first report of halotolerant strains (H. litoralis and S. cohnii) in the midgut of medically important insect such as the Cx. quinquefasciatus mosquito larvae. Several other non-halotolerant Bacillus and Staphylococcus species have previously been reported in mosquito midguts. Straif et al. (1998) found different Bacillus species in field-caught An. gambiae and An. funestus mosquitoes. Fouda et al. (2001) concluded that Bacillus and Staphylococcus, isolated from the midguts of a laboratory colony of Cx. pipiens mosquitoes, were essential for high and normal fecundity.

Since halotolerant bacteria grow below 1% NaCl, they have been found in some unusual environments, such as on desert plants, desert animals, river and ground water, etc. Atriplex halinus (family Chenopodiaceae) is a desert plant widespread in the Negev Desert, Israel and in other desert environments. On these plants dominant orange pigmented bacterium, identified as Pseudomonas sp., was growing from 0.05 to 20% NaCl with an optimum at 5% and 30°C (Simon et al., 1994). Even more unusual is the isolation of a halotolerant Bacillus sp. from the nasal cavities of desert iguanas (Deutch, 1994). Hasnain and Taskeen (1989) isolated halotolerant bacteria from the rhizosphere of Leptochloa fusca and Atritplex rhocodoidaes. The presence of halotolerant bacteria, Oceanobacillus chironomi sp. nov., from chironomid egg mass from a waste-stabilization pond has also been reported, which grew in LB agar medium containing 0-11% NaCl (optimum at 1-3% NaCl) (Raats and Halpern, 2007). A number of halotolerant bacteria have been reported from waste water and coastal sediment in Korea, showing excellent growth in 3% NaCl (Kim et al., 2003). Members of the genus Bacillus have been isolated from groundwater system by Chapelle et al. (1988). Tiquia et al. (2007) demonstrated that the river water and groundwater harbor a variety of halotolerant bacteria that may have potential in bioremediation of organic contaminants at the site.

In conclusion studying such microbial population will improve our knowledge on better understanding of the acquisition of Midgut-associated Bacteria (MAB) of wild mosquito larvae.

ACKNOWLEDGMENTS

The authors are grateful to the Entomology Research Institute for financial assistance. We gratefully acknowledge Mr. A. Stalin, Division of bioinformatics, ERI, Loyola College for his assistance during the construction of phylogenetic tree.

REFERENCES

  1. Ahmed, I., A. Yokota and T. Fujiwara, 2007. racilibacillus boraciitolerans sp. nov., a highly boron-tolerant and moderately halotolerant bacterium isolated from soil. Int. J. Syst. Evol. Microbiol., 57: 796-802.
    CrossRef  |  


  2. Agrawal, V.K. and V.K. Sashindran, 2006. Lymphatic filariasis in India: Problems, challenges and new initiatives. Med. J. Armed Forces India, 62: 359-362.
    CrossRef  |  Direct Link  |  


  3. Bowers, W.S., B. Sener, P.H. Evans, F. Bingol and I. Erdogan, 1995. Activity of Turkish medicinal plants against mosquitoes Aedes aegypti and Anopheles gambiae. Int. J. Trop. Insect Sci., 16: 339-341.
    CrossRef  |  Direct Link  |  


  4. Caton, T.M., L.R. Witte, H.D. Ngyuen, J.A. Buchheim, M.A. Buchheim and M.A. Schneegurt, 2004. Halotolerant aerobic heterotrophic bacteria from the great salt plains of Oklahoma. Microb. Ecol., 48: 449-462.
    CrossRef  |  Direct Link  |  


  5. Chao, J. and G.A. Wistreich, 1959. Microbial isolations from the midgut of Culex tarsalisM Coquillett. J. Insect. Pathol., 1: 311-318.


  6. Chao, J. and G.A. Wistreich, 1960. Microorganisms from the midgut of larval and adult Culex quinquefasciatus Say. J. Insect Pathol., 2: 220-224.


  7. Chapelle, F.H., J.T. Morris, P.B. McMahon and J.L. Zelibor, 1988. Bacterial metabolism and the del-13C composition of groundwater, Floridian aquifer, South Carolina. Geology, 16: 117-121.


  8. Cirimotich, C.M., A.M. Clayton and G. Dimopoulos, 2011. Low- and high-tech approaches to control plasmodium parasite transmission by Anopheles mosquitoes: A review. J. Trop. Med.
    CrossRef  |  


  9. Delong, E.F., 1992. Archea in coastal marine environments. Proc. Natl. Acad. Sci., 89: 5685-5689.
    CrossRef  |  Direct Link  |  


  10. Deutch, C.E., 1994. Characterization of a novel salt-tolerant Bacillus sp. from the nasal cavities of desert iguanas. FEMS Microbiol. Lett., 121: 55-60.
    Direct Link  |  


  11. Dillon, R.J. and V.M. Dillon, 2004. The gut bacteria of insects: Nonpathogenic interactions. Annu. Rev. Entomol., 49: 71-92.
    CrossRef  |  Direct Link  |  


  12. Dua, V.K., A.C. Pandey, S. Rai and A.P. Dash, 2007. Larvivorous activity of Poecilia reticulata against Culex quinquefasciatus larvae in a polluted water drain in Hardwar, India. J. Am. Mosq. Control Assoc., 23: 481-483.
    CrossRef  |  PubMed  |  Direct Link  |  


  13. Ferguson, M.J. and D.W. Micks, 1961. Microorganisms associated with mosquitoes: Bacteria isolated from adult Culex fatigans Wiedemann. J. Insect. Pathol., 3: 112-119.


  14. Fouda, M.A., M.I. Hassan, A.G. Al-Daly and K.M. Hammad, 2001. Effect of midgut bacteria of Culex pipiens L. on digestion and reproduction. J. Egypt. Soc. Parasitol., 31: 767-780.
    PubMed  |  Direct Link  |  


  15. Gareeb, A.P. and M.E. Setati, 2009. Assessment of alkaliphilic haloarchaeal diversity in Sua pan evaporator ponds in Botswana. Afr. J. Biotechnol., 8: 259-267.
    Direct Link  |  


  16. Giridharan, L., T. Venugopal and M. Jayaprakash, 2010. Identification and evaluation of hydrogeochemical processes on river cooum, South India. Environ. Monit. Assess., 162: 277-289.
    CrossRef  |  Direct Link  |  


  17. Gowri, V.S., S. Ramachandran, R. Ramesh, I.R.R. Pramiladevi and K. Krishnaveni, 2008. Application of GIS in the study of mass transport of pollutants by Adyar and Cooum Rivers in Chennai, Tamilnadu. Environ. Monit. Assess., 138: 41-49.
    CrossRef  |  Direct Link  |  


  18. Gusmao, D.S., A.V. Santos, M.D. Cristine, R.E. de Souza and A.M.D. Peixoto et al., 2007. First isolation of microorganisms from the gut diverticulum of Aedes aegypti (Diptera: Culicidae): New perspectives for an insect-bacteria association. Mem. Inst. Oswaldo Cruz, 102: 919-924.
    CrossRef  |  


  19. Hasnain, S. and N. Taskeen, 1989. Characterization of salt tolerant bacteria isolated from the rhizosphere of Leptochloa fusca and Atritplex rhocodoidaes. Pak. J. Pharm. Sci., 2: 47-53.


  20. Hayes, E.B., N. Komar, R.S. Nasci, S.P. Montgomery, D.R. O'Leary and G.L. Campbell, 2005. Epidemiology and transmission dynamics of West Nile virus disease. Emerg. Infect. Dis., 11: 1167-1173.
    PubMed  |  Direct Link  |  


  21. Tarawneh, K.A., M. Wedyan, M.A. Al-zoubi, K.M. Khleifat and A. Tarawneh, 2008. Isolation and characterization of halophilic bacteria from the Dead Sea Coast, Jordan. Adv. Environ. Biol., 2: 63-69.
    Direct Link  |  


  22. Kim, S.G., H.S. Bae, H.M. Oh and S.T. Lee, 2003. Isolation and characterization of novel halotolerant and/or halophilic denitrifying bacteria with versatile metabolic pathways for the degradation of trimethylamine. FEMS Microbiol. Lett., 225: 263-269.
    CrossRef  |  


  23. Kumar, S., K. Tamura and M. Nei, 2004. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform., 5: 150-163.
    CrossRef  |  PubMed  |  Direct Link  |  


  24. Lane, D.J., B. Pace, G.J. Olsen, D.A. Stahl, M.L. Sogin and N.R. Pace, 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. USA., 82: 6955-6959.
    PubMed  |  Direct Link  |  


  25. Li, L., M. Wu, S.Y. Qiao and K.S. Chen, 2001. Cloning and expression of the bacteriorhodopsin gene. J. Zhejiang. Univ., 35: 324-327.


  26. Naganuma, T., P. NgocHua, T. Okamoto, S. Ban, S. Imura and H. Kanda, 2005. Depth distribution of euryhaline halophilic bacteria in Suribati lake, a meromictic lake in East Antarctica. Polar Biol., 28: 964-970.
    CrossRef  |  Direct Link  |  


  27. Pidiyar, V., A. Kaznowski, N.N. Badri, M. Patole and Y.S. Shouche, 2002. Aeromonas culicicola sp. nov., from the midgut of Culex quinquefasciatus. Int. J. Syst. Evol. Microbiol., 52: 1723-1728.
    Direct Link  |  


  28. Pidiyar, V.J., K. Jangid, M.S. Patole and Y.S. Shouche, 2003. Detection and phylogenetic affiliation of Wolbachia sp. from Indian mosquitoes Culex quinquefasciatus and Aedes albopictus. Curr. Sci., 84: 1136-1139.


  29. Pidiyar, V.J., K. Jangid, M.S. Patole and Y.S. Shouche, 2004. Studies on cultured and uncultured microbiota of wild Culex quinquefasciatus mosquito midgut based on 16S ribosomal RNA gene analysis. Am. J. Trop. Med. Hyg., 70: 597-603.
    PubMed  |  


  30. Rahuman, A.A., A. Bagavan, C. Kamaraj, E. Saravanan, A.A. Zahir and G. Elango, 2009. Efficacy of larvicidal botanical extracts against Culex quinquefasciatus Say (Diptera: Culicidae). Parasitol. Res., 104: 1365-1372.
    CrossRef  |  Direct Link  |  


  31. Ramaiah, K.D., P.K. Das, E. Michael and H.L. Guyatt, 2000. The economic burden of lymphatic filariasis in India. Parasitol. Today, 16: 251-253.
    CrossRef  |  Direct Link  |  


  32. Rani, A., A. Sharma, T. Adak and R. K. Bhatnagar, 2010. Pseudoxanthomonas icgebensis sp. nov., isolated from the midgut of Anopheles stephensi field-collected larvae. The J. Microbiol., 48: 601-606.
    CrossRef  |  Direct Link  |  


  33. Raats, D. and M. Halpern, 2007. Oceanobacillus chironomi sp. nov., a halotolerant and facultatively alkaliphilic species isolated from a chironomid egg mass. Int. J. Syst. Evol. Microbiol., 57: 255-259.
    CrossRef  |  


  34. Romoser, W.S., 1996. The Vector Alimentary System. In: The Biology of Disease Vectors, Beaty, B.J. and W.C. Marquardt (Eds.). Colorado University Press, Niwot, CO., USA., p: 298-317


  35. Simon, R.D., A. Abeliovich and S. Belkin, 1994. A novel terrestrial halophilic environment: The phylloplane of Atriplex halinus, a salt-excreting plant. FEMS Microbiol. Ecol., 14: 99-110.


  36. Spring, S., W. Ludwig, M.C. Marquez, A. Ventosa and K.H. Schleifer, 1996. Halobacillus genus. nov. With description of Halobacillus litoralis sp. nov. And Halobacillus truepari sp. nov. and transfer of Sporosarcina halophila to Halobacillus halophilus comb. nov. Int. J. Syst. Bacteriol., 46: 492-496.


  37. Straif, S.C., C.N. Mbogo, A.M. Toure, E.D. Walker, M. Kaufman, Y.T. Toure and J.C. Beier, 1998. Midgut bacteria in Anopheles gambiae and Anopheles funestus (Diptera: Culicidae) from Kenya and Mali. J. Med. Entomol., 35: 222-226.
    PubMed  |  Direct Link  |  


  38. Takami, H., A. Inoue, F. Fuji and K. Horikoshi, 1997. Microbial flora in the deepest sea mud of the Mariana Trench. FEMS Microbiol. Lett., 152: 279-285.
    PubMed  |  


  39. Thompson, J.D., D.G. Higgins and T.J. Gibson, 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22: 4673-4680.
    CrossRef  |  PubMed  |  Direct Link  |  


  40. Tiquia, S.M., D. Davis, H. Hadid, S. Kasparian and M. Ismail et al., 2007. Halophilic and halotolerant bacteria from river waters and shallow groundwater along the Rouge river of southeastern Michigan. Environ. Technol., 28: 297-307.
    PubMed  |  Direct Link  |  


  41. Vasanthi, V. and S.L. Hoti, 1992. Microbial flora in gut of Culex quinquefasciatus breeding in cess pits. Southeast Asian J. Trop. Med. Public Health, 23: 312-317.
    PubMed  |  Direct Link  |  


  42. Ventosa, A., J.J. Nieto and A. Oren, 1998. Biology of moderately halophilic aerobic bacteria. Microbiol. Mol. Biol. Rev., 62: 504-544.
    Direct Link  |  


  43. WHO, 2006. Global programme to eliminate lymphatic filariasis. Weekly Epidemiological Record, World Health Organization, Geneva, Switzerland, pp: 221-232.


  44. Yang, L., R.X. Tan, Q. Wang, W.Y. Huang and Y.X. Yin, 2002. Antifungal cyclopeptides from Halobacillus litoralis YS3106 of marine origin. Tetrahedron. Lett., 43: 6545-6548.
    CrossRef  |  


©  2022 Science Alert. All Rights Reserved