Research Article
 

Prevalence and Genotypes of Rotavirus Infection among Children with Gastroenteritis in Abuja, Nigeria



Theophilus Kachi Udeani, Uzoamaka Chukwuma Ohiri, Okechukwu Steven Onwukwe and Chukwubike Chinedu
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

Background and Objectives: Rotavirus is a major cause of severe diarrhea in children worldwide. The existing genotypes of rotavirus in Nigeria are not widely known. This cross-sectional study investigated the prevalence, risk factors for rotavirus antigens and circulating genotypes amongst children within 5 years of age in Abuja, Nigeria. Materials and Methods: Watery and/or semi-solid stool samples were collected from children and preserved in glycerol. A structured questionnaire was used to obtain information on demographic characteristics and clinical details from their parents. Rotavirus antigen was detected in the stool specimens by Rotavirus antigen kit, while genotype characterization for G- and P-type genotypes were by reverse transcription polymerase chain reaction and polyacrylamide gel electrophoresis. Descriptive and chi-square statistics were used to analyze all the data obtained. Results: Of 144 stool samples analyzed, 25% (36) had Rotavirus infection, with male dominance than females15.3% (22/144) and 9.7% (14/144), respectively. The age group of less than 10 months had higher rotavirus infection of 13.9% (20/144). The major statistical significant risk factors identified were, use of feeding bottles, p = 0.003 and attendance to day care centers, p = 0.038. The peak of rotavirus infection was April, with a range of January-May. The prevalent genotypes identified were G1, G3, G9, G12, (VP7) and P8, P6 (VP4) with mixed G/P. The G12 genotype was the predominant G-type. The migration pattern of the viral genome showed that the long genomic segments were more than the short ones. Conclusion: The G12 genotypes were highly associated with rotavirus-diarrhea and disease amongst the children. There is a need to introduce rotavirus vaccination in the National program on Immunization in Nigeria.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Theophilus Kachi Udeani, Uzoamaka Chukwuma Ohiri, Okechukwu Steven Onwukwe and Chukwubike Chinedu, 2018. Prevalence and Genotypes of Rotavirus Infection among Children with Gastroenteritis in Abuja, Nigeria. Research Journal of Microbiology, 13: 84-92.

URL: https://scialert.net/abstract/?doi=jm.2018.84.92
 
Received: March 26, 2018; Accepted: June 28, 2018; Published: July 14, 2018



INTRODUCTION

Rotavirus infection is a major cause of non-bacterial gastroenteritis, responsible for severe diarrhea in infants and children Worldwide, causing approximately 453,000 deaths each year, thus having great impact on childhood morbidity and mortality1. The burden of rotavirus infection has been estimated to be higher in countries with low income, with Africa having more than half of the deaths2. Nigeria was ranked among the countries with developing high mortality due to rotavirus disease, both in children and adults, with 9.5% mortality rate accounting for ~49,974 deaths per annum3.

The genus Rotavirus is a member of the family Reoviridae, with 11 segments of double stranded RNA and 18,555 nucleoside base pair. The matured virus particle is non-enveloped and possesses a three layered icosahedra protein capsid, measuring about 75 nm in diameter4. The Rotavirus consists of six serological groups (A to F). Groups A to C have been shown to infect humans and Groups D to F have been implicated in Rotavirus diseases of animals5.

Group A serotype causes the most severe infections in humans. It has six structural proteins (VP 1, VP2, VP3, VP4, VP6 and VP7) and five Non Structural Proteins (NSP1 to NSP5) Based on antibody neutralization of the outer capsid viral protein antigens (VP7 and VP4), Rotavirus have been grouped into G serotypes (sequel to neutralization by antibodies against VP7 glycoprotein antigen) and P-serotype (with respect to neutralization by antibody against VP4-protease sensitive antigen)6.

Rotavirus is transmitted via the feacal-oral route, occurring mostly as a result of poor hygiene7. Other major risk factors includes ingestion of contaminated food and water, oral contact with contaminated surfaces of inanimate objects like toys and tables and participation in day care activities especially for children, with the virus likely spreading through faecal-oral contact from other children and day care workers8). Transmission may also be via respiratory droplets from sneezes, cough and nose drip9. Nosocomial transmission is also frequent in paediatric wards and hospitals with poor sewage treatment and sanitation status.

Rotavirus infection is neither a priority nor part of routine diagnostic tests in hospital clinical laboratories. The big challenge is that most of the patients are never diagnosed and blind treatment may ensure, especially in scarce resource countries like Africa. Such blind treatments leads to abuse of drugs, predisposing patient to drug resistance and drug reactions and increased mortality due to unknown agent. Thus the goal of this study was to determine the prevalence and risk factors for rotavirus infection in children with Diarrhea and characterize the genotypes of infecting rotaviruses.

MATERIALS AND METHODS

Patients: The study enrolled children attending Out-patient Department of both Government and private Hospitals in Abuja, Nigeria. The locations covered were Kubwa, Gwagwlada, Bwari, Karishi and Nyanya. The children were not hospitalized at the time of study. They were selected based on presenting symptoms of diarrhoea/vomiting and with or without fever. The study period was from October, 2013 to September, 2014.

Ethical considerations: The study protocol was reviewed and approved by Ethical Committee for Health Research, Directorate of Medical Laboratory Services, Federal Capital Development Authority, Abuja-Nigeria. Informed written consent was obtained from either of the parents of the children. Information about the children’s demographic and risk factors for rotavirus infection was obtained from the parents or caregiver.

Stool sample collection: All reagents used for the study were of analytical grade and sterile where necessary. A total of 144 diarrhoeic stool samples were collected from children within the age of 5 years. A diarrhoeic case in this study was defined as a child passing loose, liquid, watery or bloody stool, three or more times in a 24 h period as reported by the mother or caregiver. Information on demographic characteristics, nature of illness and clinical manifestations were obtained from either the parents or caregiver. The stool samples were divided into aliquots and stored in frozen at -95°C, until tested. Two vials of the aliquots were transported to Noguchi Memorial Institute of Medical Research, University of Ghana, Accra, for genotyping analysis.

Detection of rotavirus antigens: Ten percent (10%) suspensions of the stool samples were made using phosphate buffered saline (PBS) and subsequently used for the detection of rotavirus antigen using a commercial rotavirus enzyme-linked immunosorbent assay (ELISA) kit (Oxoid, Basingstoke-Hants, United Kingdom). The experiment was carried out according to manufacturer’s instructions.

Reverse transcription and determination of G and P genotypes: A total of 36 stool samples that were positive for rotavirus antigen were selected for genotyping. Extraction of viral RNA was performed using the Phenol Chloroform method. Briefly, 10% stool suspensions were mixed with 1:10 volume of 1 M sodium acetate containing 1% sodium dodecyl sulphate and incubated for 15 min at 37°C. Viral RNA was extracted with 500 μL volume of a 1:1 phenol-chloroform mixture at 56°C for 15 min and centrifugation at 12,000 rpm for 3 min each recovered supernatant was further extracted thrice by the same procedure described above and the final supernatant placed a sterile tube. The final supernatant was retrieved and placed in a 1.5 mL sterile tube. The 500 μL of 6 M Guanidine Isothiocyanate (GITC) was added to the recovered suspension, vortexed for 30 sec and centrifuged at 12,000 rpm for 5 min. The RNaid® kit (Qbiogene, Carlsbad, CA, USA) was used to further extract and purify the RNA according to manufacturer’s instructions. The supernatant from the extraction procedure containing the extracted RNA was transferred into sterile tubes and stored at -20°C until needed for RT-PCR reactions.

VP7 and VP4 RT-PCR: Reverse transcription PCR of the G and P genes was performed on the purified double stranded RNA (dsRNA). The VP7 gene was reverse transcribed using Beg9 (GGCTTTAAAAGAGAGAATTTCCGTCTGG) and End9 (GGTACACATCATACAATTCTAATCTAAG) primers10 while the VP4 genes were reverse transcribed using Con3 (ATTTCGGACCATTTATAACC) and Con2 (TGGCTTCGCTCATTTATAGACA) primers11 (Table 1).

VP7 and VP4 genotyping: The G (VP7) genotyping was performed using an array of primers specific to 8 human rotavirus strains, G1-4, G8, G9, G10, G12) already described by Gouvea et al.10. Also, P (VP4) genotyping was performed using VP4 specific primers (P4, P6, P8, P9 and P10) described by Gentsch et al.11. The PCR products from both processes were electrophoresed by adding 8 μL of amplicon to 1.5% agarose gel wells in 0.5 μg mL tris acetic acid EDTA buffer (PH 7.9) at 120 volts for 45 min. (Table 1).

PAGE analysis: Double stranded RNA was extracted using the Bender Buffer method with slight modifications12. In brief, 200 μL of Bender buffer was added to 200 μL of 10% stool suspension and vortexed before incubating at 65°C for 30 min. This was followed by the addition of 60 μL of 8 M potassium acetate, mixing and incubation on ice for 45 min. After incubation, the tubes were centrifuged at 10,000 rpm for 20 min and the supernatant transferred into new eppendorf tubes and 950 μL of absolute ethanol were added to the recovered supernatant, incubated on ice for 10 min and centrifuged at 10,000 rpm for 20 min twice. The ethanol was discarded followed by the addition of 200 μL tris EDTA buffer to the pellet and incubation at room temperature for 30 min. Further extraction was performed by the addition of 100 μL of 5M NaCl and 420 μL of cold absolute ethanol and incubation at -20°C for 1 h followed by centrifugation at 10,000 rpm for 20 min. The supernatant was discarded and the extracted RNA pellets dried under vacuum.

Electrophoresis was performed on the extracted RNA in a 10% polyacrylamide resolving gel enhanced by 3% stacking gel in a tris-glycine buffer system. The RNA pellets were resuspended in bromophenol blue loading buffer containing glycerol, centrifuged for 10 sec at 10,000 rpm and loaded on to the gel wells. Electrophoresis was conducted at 100 V for 18 h at room temperature. The gels were stained using the Silver nitrate method and the PAGE profiles documented.

Statistical analysis: The data were analyzed using descriptive statistics and expressed as means and standard deviations. The variables were compared using chi-square and Fisher’s exact test at a 95% confidence interval with probability (P) values less than or equal to 0.05 considered statistically significant. The SPSS package version 25.0 was used for data analysis.

Table 1:
Oligonucleotide gene specific primer sequence used for VP7 and VP4 GENOTYPING PCR
Image for - Prevalence and Genotypes of Rotavirus Infection among Children with Gastroenteritis in Abuja, Nigeria

RESULTS

Rotavirus antigen detection: A total of 25% (36/144) of the subjects had human rotavirus antigen detected in their stool sample. The rotavirus infection was distributed among the Abuja districts, with Gwagwalada having the highest prevalence of 8.3% (12/144), followed by Kubwa with 5.6% (8/144). Nyanya, Bwari and Karishi had prevalence rates of 4.9% (7/144), 3.5% (5/144) and 2.8% 4/144), respectively.

Patient characteristics: Rotavirus antigen was detected more in males than in females. Analysis of the age distribution of children affected by rotavirus showed that the highest prevalence rate of rotavirus infection was found in children aged between <10 months old. The prevalence seemed to decrease with increasing age (Table 2). The seasonal occurrence of rotavirus indicated a peak period of April, while Infection rates fluctuate between November, March and declined from May, till September, (Fig. 1).

Assessment of risk factors: The risk factors for the transmission of rotavirus were also assessed (Table 2). The children that were fed with feeding bottles were more infected, than those that do not use feeding bottles. The use of feeding bottles was a significant risk factor (p = 0.003).

Table 2:
Demographic features and risk factors associated with rotavirus infections in infants
Image for - Prevalence and Genotypes of Rotavirus Infection among Children with Gastroenteritis in Abuja, Nigeria

Image for - Prevalence and Genotypes of Rotavirus Infection among Children with Gastroenteritis in Abuja, Nigeria
Fig. 1:
Seasonal distribution of rotavirus infections during the study period

Table 3:
Distribution of rotavirus genotypes in 36 positive stool samples
Image for - Prevalence and Genotypes of Rotavirus Infection among Children with Gastroenteritis in Abuja, Nigeria
GNT: Genotype non-typable, GMIX: Genotype mix

Attendance to Day Care centers was also a significant risk factor (p = 0.038), infants attending Day Care centers had more rotavirus infections than those who do not attend Day Care Centers. In a multivariate analysis, the use of feeding bottles, OR 0.30 (95% C I: 0.130-0.675) and attendance to day care centre with OR 0.45 (95% C I: 0.208-0.963), were independently associated with the rotavirus infection (Table 2).

Clinical manifestations: The manifestation of symptoms like fever, diarrhea and vomiting, were not significantly associated with Rotavirus infections (Table 2). The number of subjects presenting with fever and who were diagnosed with rotavirus disease were greater than those who did not present with fever. The same pattern of presentation was observed for subjects presenting with diarrhea and vomiting. There was a greater number of subjects who were rotavirus positive among those that employed the use of Oral Rehydration Therapy (ORT) as a control measure for diarrhea, than those that did not use ORT. All 36rotavirus positive stool samples were infants that never received rotavirus vaccine (Table 2).

Distribution of G and P genotypes: Thirty-six (36) stool samples that were positive for rotavirus antigen were genotyped. Table 3 summarizes the distribution of G and P genotypes in the typed samples. A total of 69% (22/36) rotavirus-positive fecal samples had only one rotavirus strain, whereas 11 (31%) had mixed rotavirus strains. The most common G genotypes identified were G1, followed by G3 and G12. The G9 genotype and the G non-typable (GNT) were the least frequent and seen in one sample each. Among the mixed G-types (G Mix)found in 4 samples, the G12 G1 strain was more common than the G12 G3 strain (Table 3).

Among the P-genotypes, the P6 genotype were more prevalent in the samples than the P8 genotype. Among the samples with mixed P genotypes (P mix), the P8,6 genotype was the most common combination while P4 was also detected in two samples as a P8,4 enotype mix. Generally, about one third of the infants typed samples were infected with mixed G/P genotypes. Among the non-mixed rotavirus infections, strains with the single G3P6 genotype predominated (Table 3).

No significant difference was observed in the distribution of rotavirus genotypes between the males and females. The G12 genotype occurred in all ages with its highest frequency seen in children below 10 months old. The genotypes G9 and GNT occurred only in two infants within the same age group (11-20 months old).

Image for - Prevalence and Genotypes of Rotavirus Infection among Children with Gastroenteritis in Abuja, Nigeria
Fig. 2(a-c):
PAGE analysis of rotavirus strains in stool samples. Fig. 2a, b and c represents migration patterns for the 36 rotavirus positive samples 1-14, 15-28 and 24-36, respectively. The lanes marked ‘C’ is the control lane. The lanes marked ‘L’ indicate gene segment clusters showing long migration patterns while those marked ‘S’ indicate gene segment clusters showing short migration patterns. Lanes marked ‘N’ indicates segments showing either mixed long and short RNA migration patterns or faint positive or negative migration patterns

Table 4:
Summary of p type distribution by age
Image for - Prevalence and Genotypes of Rotavirus Infection among Children with Gastroenteritis in Abuja, Nigeria

Age distribution analysis of the P-genotypes also showed that P6 and P8 occurred more in infants aged less than 21 months, with highest frequency seen in children between 6-10 months old (Table 4).

Nucleic acid detection: The nucleic acids of all 36 positive specimens were analyzed by Polyacrylamide Gel Electrophoresis (PAGE) (Fig. 2). The migration pattern of the viral genomic segments showed 47% (17/36) were of long RNA migration pattern while 28% (10/36) showed a short RNA migration pattern and 25% (9/36) showed either mixed long and short RNA migration patterns or faint positive or negative migration patterns.

DISCUSSION

The present study was undertaken to assess the prevalence and genotype of rotavirus infections among infants aged 5 years and below in Abuja, Nigeria. Rotavirus infection was found in 36 out of the 144 samples taken with children aged 10 months or less being affected.

Rotavirus has been found to be a major cause of childhood diarrhea that leads to hospitalization of children less than 5 years of age with associated high morbidity and mortality rates1. A prevalence rate of 25% observed in this study was similar to previous study by Mohammed et al.7 in Kaduna, Nigeria where a prevalence rate of 32.2 and 7.6% from diarrheic stools was reported. A prevalence rate of 25.5 and 28.9% was reported from Ghana and Abidjan13,14, respectively, while in Uganda, Bwogi et al.15 reported 37% higher occurrence of rotavirus infection. The detection of rotavirus as aetiologic agent of gastroenteritis indicates the wide spread of the viral infection within the areas surveyed and this constituted a major health problem.

The study revealed a predominance of rotavirus infection in male subjects compared to the females. This report is similar to that of Tagbo et al.16 and Bonkoungou et al.17. The reason for this predominance remains unclear though a possible explanation might be the suggestion that boys are 2 times more likely to be hospitalized than girls hence explaining the slight predominance by males.

The high prevalence of rotavirus in children less than 10 months old. This age pattern of rotavirus infection can be attributed to the absence of well-developed immune system to offer protection against rotavirus, especially as majority of the children analyzed were not vaccinated against rotavirus. It has been suggested that as children grow and have repeated exposure to the virus, they eventually become immune to and/or possibly become carriers of the virus18. This finding is in contrast to the report of Dennehy19 that reported that rotavirus infection is more in children aged 9-15 months. The reduction of rotavirus infection as age increases is similar to a previous study by Grace and Jerald18.

In a multivariate analysis, the independent risk factors for the transmission of rotavirus were the use of feeding bottles and attendance to day care centres. These are part of environmental factors that may be related to poor hygiene and lack of care20. Viral transmissions and infections possibly occur via fecal contamination of caregivers hands during changing of diapers of other infected children, contaminated hands of staff and children touching contaminated surfaces (like tables, toilet seats and toys) that are used by most of the children. Another possible source of infection is the respiratory route, since rotavirus, like influenza, can spread by large droplets that travel short distances suspended in the air (typically less than 3 ft.). These droplets are usually produced through sneezing and coughing as children do not reliably cover their mouth and nose properly when sneezing and coughing. The significant association seen in the use of feeding bottle could be attributed to use of improperly washed feeding bottles, touching of feeding bottle cap by children with contaminated hands during feeding and use of contaminated water in preparing foods put in the feeding bottle.

Analysis of the seasonal distribution of rotavirus reflected an increase in infection rate during the dry cooler period of the year with its peak within the months of November and April. This is similar to seasonality trends in other parts of Nigeria21 and Africa22. Seasonal changes observed occasionally in temporal distribution of rotavirus cases can be explained by the variability of mean temperature, relative humidity and rainfall.

The rotavirus genotypes identified in the study shows that G/P antigens combinations of G3P6 (19.4%), G12P8 (16.6%) and G1P6 (13.8%) were the three most prevalent genotypes. The genotype, G9P8 was also detected in an 11-month child, which contrast previous study in Lagos Nigeria that found G9 infections to exist in older children greater than 24 months23. The G9P8 genotypes was more prevalent among children five years in Uganda15. The findings supported the premise that G9 strains remained a major rotavirus genotypes. The different G genotypes play a role in the severity of the diarrhea associated rotavirus infections. On global basis, most severe infections are caused by 5 G-types (G1-G4 and G9) although considerable differences exist between countries1. The finding of G1, G3, G4 and G9 in this study, is in line with the globally identified diarrheic serotypes and to an extent correlate with the study in Surabaya, Indonesia23 in which the authors observed a significant association diarrheal severity with the different genotypes. A frequency of diarrhea greater than 10 times daily was reported in children infected with G3, G4 and G9 rotavirus strains while an insignificant correlation was reported between the different P-types and severity of diarrhea. In this study the presence of G3, G4 and G9 may present a severe rotavirus disease.

The presence of the unusual rotavirus genotype, G12, being an emerging strain is a source of concern. The G12 strain had been reported previously in Nigeria by Ayolabi et al.24. The identification of this strain in the present study is consistent with recent reports of the possible global presence and spread of this serotype highlighting its increasing epidemiological importance and confirming it as an emerging strain although its origin is yet to be established. It has been speculated that the occurrence of this new G12 strain may be due to genetic reassortment of nucleotide sequences of other strains. This strain has been regarded as a "traveler’s rotavirus strain" as it has been reported to have entered Saudi Arabia (for instance) through visitors coming in from Nepal and India25. Hence this G12 strain should be seen as an emerging strain exhibiting high capacity to spread among children just like other human rotavirus strains of the G types and requires further studies and investigations. G12 was identified in combination with P8 in 16.6% of the strains and with P6 in 8.3% of the strains representing a ratio of 2:1.

The infections by rotavirus of mixed strains observed in this study seem to be a common finding in Nigeria, as it has consistently been reported in other studies26,27. This could also be attributed to naturally occurring reassortment among Rotaviruses28. It could also be due to varying concentrations of rotavirus strains that resulted in an uneven degree of PCR amplification, making interpretation of PCR gel band patterns difficult to read27 or even incorrect primer binding due to genetic drift on rotavirus genome. The presence of one G non-typeable strain (GNT) is also a common feature of rotavirus molecular characterization studies in most developing countries. As observed in this study, the GNT strain existing as mixed infection with P8,6 strain may represent either a strain with accumulated point mutations in the used primer binding sites, novel strains yet to be identified or even too few virus particles with intact RNA in the stool sample.

Global reports have shown PAGE to be a potential tool in understanding and studying the molecular epidemiology of rotaviruses infections22,29. In this study, 27 different electropherotypes (17 long and 10 short electropherotypes) were found. The predominance of long electropherotypes over the short electropherotypes is not unusual as it’s in accordance with previous findings and now seems to be a routine14,30. Twenty-five percent of the stool samples identified as positive by ELISA did not show clear or any RNA pattern on PAGE. This could be attributed to insufficient intact RNA in the specimens detectable in PAGE, given that the sensitivity limit of PAGE stained by silver nitrate has been shown to be 3.4 ng of viral genomic RNA31. There is also the possibility that RNA in the samples might have degenerated due to poor storage resulting from power failure. However, it is important to also note that development of extensive genomic diversity among rotaviruses can also occur due to genetic reassortment as genetic rearrangement occurs either naturally or through drug or immune pressure mounted by the host system could also be a factor.

CONCLUSION

In this study, it was observed that rotavirus is responsible for some of the cases of severe gastroenteritis in children under the age of 5 years in Abuja, Nigeria. Children aged 10 months and below were the most affected with G1 and P6 genotypes being the most prevalent. The use of feeding bottles and attendance to Day Care facilities were found to be the most significant risk factors for rotavirus infection.

SIGNIFICANCE STATEMENTS

The present study puts forth vital epidemiological data on the prevalence, genotypic pattern, seasonal distribution and risk factors of rotavirus infection among children aged less than 5 years in Abuja, Nigeria. Such information is required in designing and implementing necessary preventive and curative measures aimed at stemming the menace of the viral gastroenteritis such as vaccination programs, that is non existence in Nigeria. This study will also provide preliminary bases on which further studies of molecular sequencing analysis and constant monitoring of genetic drift and shift especially in G12 and the non type able strains would be based.

ACKNOWLEDGMENTS

We wish to thank the parents of these children for allowing the participation of their wards in this study, voluntarily. We are grateful to Dr. Michael Ofori and members of staff of Noguchi Memorial Institute of Medical Research , University of Ghana Accra, for allowing the use of their facilities for the molecular studies.

Funding: There was no funding from any funding agency for this study.

REFERENCES

  1. Tate, J.E., A.H. Burton, C. Boschi-Pinto, A.D. Steele, J. Duque, U.D. Parashar and The WHO-Coordinated Global Rotavirus Surveillance Network, 2012. 2008 estimate of worldwide rotavirus-associated mortality in children younger than 5 years before the introduction of universal rotavirus vaccination programmes: A systematic review and meta-analysis. Lancet Infect. Dis., 12: 136-141.
    CrossRef  |  Direct Link  |  


  2. Mwenda, J.M., K.M. Ntoto, A. Abebe, C. Enweronu-Laryea and I. Amina et al., 2010. Burden and epidemiology of rotavirus diarrhea in selected African countries: Preliminary results from the African rotavirus surveillance network. J. Infect. Dis., 202: S5-S11.
    CrossRef  |  Direct Link  |  


  3. Parashar, U.D., A. Burton, C. Lanata, C. Boschi-Pinto and K. Shibuya et al., 2009. Global mortality associated with rotavirus disease among children in 2004. J. Infect. Dis., 200: S9-S15.
    CrossRef  |  Direct Link  |  


  4. Modrow, S., D. Falke, U. Truyen and H. Schatzl, 2013. Viruses with Double-Stranded, Segmented RNA Genomes. In: Molecular Virology, Modrow, S., D. Falke, U. Truyen and H. Schatzl (Eds.)., Springer, Berlin, Heidelberg, pp: 521-553


  5. Tamura, T., M. Nishikawa, D.D. Anh and H. Suzuki, 2010. Molecular epidemiological study of rotavirus and norovirus infections among children with acute gastroenteritis in Nha Trang, Vietnam, December 2005-June 2006. Jpn. J. Infect. Dis., 63: 405-411.
    Direct Link  |  


  6. Hoshino, Y., M.M. Sereno, K. Midthun, J. Flores, A.Z. Kapikian and R.M. Chanock, 1985. Independent segregation of two antigenic specificities (VP3 and VP7) involved in neutralization of rotavirus infectivity. Proc. Natl. Acad. Sci. USA., 82: 8701-8704.
    CrossRef  |  Direct Link  |  


  7. Mohammed, A.A., M. Aminu, S.A. Ado, E.D. Jatau and M.D. Esona, 2016. Prevalence of rotavirus among children under five years of age with diarrhea in Kaduna State, Nigeria. Niger. J. Padiatr., 43: 264-268.
    CrossRef  |  Direct Link  |  


  8. Stupka, J.A., J.I. Degiuseppe and G.I. Parra, 2012. Increased frequency of rotavirus G3P [8] and G12P [8] in Argentina during 2008-2009: Whole-genome characterization of emerging G12P [8] strains. J. Clin. Virol., 54: 162-167.
    CrossRef  |  Direct Link  |  


  9. Dennehy, P.H., 2000. Transmission of rotavirus and other enteric pathogens in the home. Pediatr. Infect. Dis. J., 19: S103-S105.
    Direct Link  |  


  10. Gouvea, V., R.I. Glass, P. Woods, K. Taniguchi, H.F. Clark, B. Forrester and Z.Y. Fang, 1990. Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens. J. Clin. Microbiol., 28: 276-282.
    Direct Link  |  


  11. Gentsch, J.R., P.A. Woods, M. Ramchandran, B.K. Das and J.P. Leite et al., 1996. Review of G and P typing results from a global collection of rotavirus strains: Implications for vaccine development. J. Infect. Dis., 1: S30-S36.
    CrossRef  |  Direct Link  |  


  12. Flook, P.K., M.D. Wilson and R.J. Post, 1992. The Use of Repetitive DNA Probes in the Analysis of Natural Populations of Insects and Parasites. In: Genes in Ecology, Berry, R.J. and T.J. Crawford (Eds.)., Cambridge University Press, New York, pp: 485-486


  13. Armah, G.E., E.K. Essel, R.H. Asmah, F.R. Anto and F.N. Binka, 2000. Detection of human group C rotavirus in Ghanaian children. Ghana Med. J., 34: 157-164.
    Direct Link  |  


  14. Akran, V., I. Peenze, C. Akoua-Koffi, H. Kette, M.C. De Beer, M. Dosso and A.D. Steele, 2010. Molecular characterization and genotyping of human rotavirus strains in Abidjan, Cote d'Ivoire. J. Infect. Dis., 202: S220-S224.
    CrossRef  |  Direct Link  |  


  15. Bwogi, J., S. Malamba, B. Kigozi, P. Namuwulya and P. Tushabe et al., 2016. The epidemiology of rotavirus disease in under-five-year-old children hospitalized with acute diarrhea in central Uganda, 2012-2013. Arch. Virol., 161: 999-1003.
    CrossRef  |  Direct Link  |  


  16. Tagbo, B.N., J.M. Mwenda, G. Armah, E.O. Obidike and U.H. Okafor et al., 2014. Epidemiology of rotavirus diarrhea among children younger than 5 years in Enugu, South East, Nigeria. Pediatr. Infect. Dis. J., 33: S19-S22.
    CrossRef  |  Direct Link  |  


  17. Bonkoungou, I.J.O., I. Sanou, F. Bon, B. Benon and S.O. Coulibaly et al., 2010. Epidemiology of rotavirus infection among young children with acute diarrhoea in Burkina Faso. Biol. Med. Chem. Pediatr., Vol. 10.
    CrossRef  |  Direct Link  |  


  18. Grace, P. and U. Jerald, 2010. The prevalence of group A rotavirus infection and some risk factors in pediatric diarrhea in Zaria, North central Nigeria. Afr. J. Microbiol. Res., 4: 1532-1536.
    Direct Link  |  


  19. Dennehy, P.H., 2008. Rotavirus vaccines: An overview. Clin. Microbiol. Rev., 21: 198-208.
    CrossRef  |  Direct Link  |  


  20. Wardana, O.P., A.F. Athiyyah, Budiono, O. Soedirham and S. Soegijanto, 2015. The role of rotavirus genotype in the severity of acute diarrhea in children under 5 years old at Surabaya, Indonesia. J. Hum. Virol. Retrovirol., Vol. 2, No. 2.
    CrossRef  |  Direct Link  |  


  21. Aminu, M., N.A. Page, A.A. Ahmad, J.U. Umoh, J. Dewar and A.D. Steele, 2010. Diversity of rotavirus VP7 and VP4 genotypes in Northwestern Nigeria. J. Infect. Dis., 202: S198-S204.
    CrossRef  |  Direct Link  |  


  22. Kotloff, K.L., J.P. Nataro, W.C. Blackwelder, D. Nasrin and T.H. Farag et al., 2013. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (The Global Enteric Multicenter Study, GEMS): A prospective, case-control study. Lancet, 382: 209-222.
    CrossRef  |  Direct Link  |  


  23. Sudarmo, S.M., K. Shigemura, K. Osawa, O.P. Wardana and A. Darma et al., 2015. Genotyping and clinical factors in pediatric diarrhea caused by rotaviruses: One-year surveillance in Surabaya, Indonesia. Gut Pathogens, Vol. 7, No. 1.
    CrossRef  |  Direct Link  |  


  24. Ayolabi, C.I., D.A. Ojo and G.E. Armah, 2013. Electropherotypes and G-types of group A rotaviruses detected in children with diarrhea in Lagos, Nigeria. ISRN Virol., Vol. 2013.
    CrossRef  |  Direct Link  |  


  25. Kheyami, A.M., T. Nakagomi, O. Nakagomi, W. Dove, C.A. Hart and N.A. Cunliffe, 2008. Molecular epidemiology of rotavirus diarrhea among children in Saudi Arabia: First detection of G9 and G12 strains. J. Clin. Microbiol., 46: 1185-1191.
    CrossRef  |  Direct Link  |  


  26. Pennap, G., I. Peenze, M. De Beer, C.T. Pager and J.K.P. Kwaga et al., 2000. VP6 subgroup and VP7 serotype of human rotavirus in Zaria, Northern Nigeria. J. Trop. Pediatr., 46: 344-347.
    CrossRef  |  Direct Link  |  


  27. Audu, R., S.A. Omilabu, M. de Beer, I. Peenze and A.D. Steele, 2002. Diversity of human rotavirus VP6, VP7 and VP4 in Lagos state, Nigeria. J. Health Popul. Nutr., 20: 59-64.
    PubMed  |  Direct Link  |  


  28. Herring, A.J., N.F. Inglis, C.K. Ojeh, D.R. Snodgrass and J.D. Menzies, 1982. Rapid diagnosis of rotavirus infection by direct detection of viral nucleic acid in silver-stained polyacrylamide gels. J. Clin. Microbiol., 16: 473-477.
    Direct Link  |  


  29. Nielsen, N.M., J. Eugen-Olsen, P. Aaby, K. Molbak, A. Rodrigues and T.K. Fischer, 2005. Characterisation of rotavirus strains among hospitalised and non-hospitalised children in Guinea-Bissau, 2002: A high frequency of mixed infections with serotype G8. J. Clin. Virol., 34: 13-21.
    CrossRef  |  Direct Link  |  


  30. Ojeh, C.K., D.J. Atti and O.O. Omotade, 1995. Comparison of the genome ds RNA of human rotavirus strains shed in parts of Ibadan, Nigeria. Afr. J. Med. Med. Sci., 24: 359-363.
    Direct Link  |  


  31. Barril, P.A., L.C. Martinez, M.O. Giordano, A.A. Castello and R.P. Rota et al., 2006. Detection of group a human rotavirus G9 genotype circulating in Cordoba, Argentina, as early as 1980. J. Med. Virol., 78: 1113-1118.
    CrossRef  |  Direct Link  |  


©  2022 Science Alert. All Rights Reserved