INTRODUCTION
Pythium ultimum Trow var. ultimum is one of the commonest Pythium
species and can cause severe damage to many plants in cool to moderately
warm climates. It is of frequent occurrence in Egypt (Abdelzaher,
1999, 2009), but intraspecific variations of P.
ultimum var. ultimum are not well known. During a survey of Pythium
flora in vegetable fields in Egypt and Germany, many isolates of P. ultimum
var. ultimum were isolated from diseased crop plants in the two countries.
Historically, P. ultimum var. ultimum was originally isolated
from rotten cress seedlings in England (Van der Plaats-Niterink,
1981). Pythium ultimum is one of the commonest Pythium species
in the soil. It reproduces asexually by means of either hyphae or hyphal swellings
and sexually by means of antheridia and oogonia. It has frequently been recorded
from California, Texas, Hawaii, Tahiti, Canada, South America, Iceland, South
Africa, Nigeria, Kenya, Kongo, Egypt, Japan, Australia, Germany, Britain, Denmark,
Greece, Turkey, Slovakia, France, the Netherlands and Pakistan (Van
der Plaats-Niterink, 1981; Mubeen et al., 2005;
Abdelzaher, 2009). Pythium ultimum can become
a severe parasite on many plants; it is a causal agent of damping-off and root-rots
of many crops (Van der Plaats-Niterink, 1981; Abdelzaher,
1999, 2009).
Sexual reproduction of Pythium species takes place by means of oogonia
and antheridia. After fertilization of the oogonium and then maturation of the
oospore, a dormant phase is usually necessary before the germination. At germination,
the oospore is converted into a thin-walled structure, which produces either
a germ tube or acts as sporangium producing zoospores (Lumsden
and Ayers, 1975). Therefore, oospores of Pythium species are commonly
considered to be overwintering structures which act as resistant structures
permitting long-time survival under unfavourable conditions (Van
der Plaats-Niterink, 1981; Abdelzaher, 1999, 2009).
Spreading of Pythium sp. in different soils depends upon many factors
that stimulate their overwintering structures in such soils (Ayers
and Lumsden, 1975). Many investigators studied the dynamics of oospores
in soils rather than the biology of oospores and factors affecting their germination
of the genus Pythium (Adams, 1971; Stanghellini
and Burr, 1973; Ayers and Lumsden, 1975; Ge
and Ichitani, 1992; Abdelzaher et al., 1994).
For this reason, studying oospore production and germination of these two Pythia isolated from Egypt and Germany may helps in understanding the dynamics of such fungi in their natural habitats.
In the present study, the characteristics of the two isolates of P. ultimum var. ultimum isolated from Egypt and Germany were compared. The isolates were compared in morphology, growth temperature, r-DNA-ITS including the 5.8S rDNA, pathogenicity and oospores production and germination under different physical and chemical factors. The isolates from Egypt and Germany are here referred to as isolate I and isolate II, respectively.
MATERIALS AND METHODS
Fungi and isolates: Mainly, two isolates of Pythium ultimum var. ultimum were selected for this study because of their economic and scientific importance. Isolate I was isolated from diseased wheat grown in an agricultural field near the bank of River Nile, Minia, Egypt (28° 6' 54" N, 45° 30' 08" E) in January, 2008. Isolate II was isolated from infected lettuce plants grown in an agricultural field in Grossbeeren, Germany, (28° 6' 54" N, 45° 30' 08" E) in July, 2009.
Fungal isolation: Isolation of P. ultimum var. ultimum (isolates
I and II) from diseased wheat and lettuce plants Root rotted wheat and lettuce
plants were collected from an agricultural near the bank of River Nile in Minia,
Egypt (28° 6' 54" N, 45° 30' 08" E) in January, 2008 and agricultural
field in Grossbeeren, Germany, (28° 6' 54" N, 45° 30' 08" E) in July,
2009. The infected wheat and lettuce plants were rinsed in ethanol (50%, v/v)
for 30 sec, transferred to tap water, followed by sterile tap water, blotted
with sterile filter paper and then transferred to the surface of NARM [nystatin
(10 mg L-1), ampicillin (250 mg L-1), rifampicin (10 mg
L-1) and miconazole (1 mg L-1) in cornmeal agar (CMA)]
(Morita and Tojo, 2007; Senda et
al., 2009) for isolation of Pythium species, selectively, in
9 cm Petri plates at 4 corners in each plate. Four replicates for each plant
were made. The emerging hyphal tips were transferred to Water Agar (WA) for
further purification from bacterial contamination as follows: distal end of
a colony growing on the NARM medium was cut and re-inoculated on 2.5-3% (WA)
in a Petri-dish to obtain a colony of about 1 cm diameter. The whole agar medium
in the same Petri-dish and incubated until the colony reached before the edge
of the dish wall. During this procedure the non-contaminated mycelia penetrated
the agar medium and reached its top. Thin pieces of the agar containing a single
hyphal tip of the fungus were taken from the margin of the colony and transferred
to Corn Meal Agar (CMA) slants for maintaining the fungus and to CMA plates
supplemented with 500 μg mL-1 wheat germ oil to check the formation
of sexual structures (Abdelzaher et al., 1994).
Identification of the two isolates of P. ultimum var. ultimum:
A- Morphological studies: For purification and morphological identification
of isolated pythia, the NARM selective medium was found to be effective in inhibiting
the development of bacteria in Pythium cultures whilst not affecting
Pythium itself. The position, shape and size of sporangia, the formation
of zoospores and the position, shape and size of antheridia, oogonia and oospores
were determined in grass blade culture (Waterhouse, 1967).
Autoclaved grass blades were placed on 2% Water Agar (WA) inoculated with each
isolate. After incubation for 2 days at 25°C, colonized grass blades were
transferred to autoclaved distilled water and were incubated for 1-14 days at
20°C to follow the fungal development. Morphological identification was
done using the keys of Middleton (1943), Waterhouse
(1967), Van der Plaats-Niterink (1981) and Dick
(1990), as well as the original description of each species isolated.
Growth temperature: Growth response to temperature was investigated in the range of 1-40°C. Agar discs (7 mm in diameter) of pre-grown culture on CMA were inoculated onto Bacto-CMA (Difco) plates and incubated in darkness. Colony diameter was measured 1-2 day after inoculation and the mean growth rate (mm day-1) was calculated for each isolate. Two replicates were used for each isolate at each temperature. If no growth was observed, plates were subsequently incubated at 25°C to assess the viability of inocula.
Molecular studies: DNA extraction Mycelia were grown in V-8 agar medium
(composed of 20% V8 vegetable juice v/v, 0.25% CaCO3 and were clarified
by centrifugation at 13200 g for 30 min) at 25°C for 7 days or until adequate
growth was observed. To extract the total genomic DNA, mycelia from the edge
of Pythium colony from a culture plate were suspended in 200 μL
of PrepMan Ultra Sample Preparation Reagent (Applid Biosystems, CN, USA) in
a 2.0 mL microcentrifuge tube. Samples were vortexed for 10 to 30 sec and then
heated for 10 min at 100°C in dry thermo unit or water bath. Samples were
spin for 30 min at 15000 g. Supernatants were transferred into a new microcentrifuge
tubes and were ready for (PCR) amplification by the polymerase chain reaction
(Senda et al., 2009).
DNA amplification and sequencing The nuclear rDNA region of the Internal Transcribed
Spacer (ITS), including the 5.8S rDNA, was amplified with the universal primers
ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) and ITS5 (5′ GGAAGTAAAAGTCGTAACAAGG 3′). Depending
on the experiment, sometimes, primers of ITS1 (5′ TCCGTAGGTGAACCTGCGG3′) and
ITS2 (5′GCTGCGTTCTTCATCGATGC 3′) were used as described by White
et al. (1990) and Matsumoto et al. (1999).
The amplicons were 700-900 bp long. On the other hand, 563 bp of the cox
II gene was amplified in certain Pythia with the primer pair FM66
(5′ TAGGATTTCAAGATCCTGC 3′) and FM58 (5′ CCACAAATTTCACTACATTGA 3′) (Martin,
2000). Amplification of the sequencing template was carried out with DNA
Thermal Cycler 2700 (Applied Biosystems) with a cycling profile of pre-PCR at
94°C for 5 min, followed by denaturation at 94°C for 1 min, 1 min primer
annealing at 55°C for ITS, 52°C for cox II and elongation at
72°C, 2 min for 40 cycles, with a 7 min extension at 72°C after the
final cycle. To check the presence of PCR products, 5 μL of the PCR reaction
mixture was loaded in 2% L03 (Takara Bio) agarose gel, electrophoresed at 100
V, 20-30 min and stained with ethidium bromide. The sequencing templates were
purified with GenElute PCR Clean-up kit (Sigma Chemical Co., St Louis, Missouri,
USA) following the manufacturer’s instructions. Sequencing was performed
with BigDye Terminator v3.1 Cycle Sequencing Reaction kit (Applied Biosystems)
using the same primers in the initial PCR step. After purifying the sequencing
reaction mixture through ethanol precipitation it was run on ABI 3100 DNA Sequencer
(Applied Biosystems).
Pathogenicity: Isolates I and II were each cultured in vegetable V-8
juice broth for 3 weeks at 25°C. Suspensions of propagules were prepared
from the mycelial mats of the isolates by the method of Kusunoki
and Ichitani (1982) and used as the inoculum. The suspension was added to
the soil previously sterilized by autoclaving and kept for 3 weeks in a black
plastic bag at room temperature and the final density was adjusted to 100 and
1,000 propagules per g dry soil. The soil was passed through a 2 mm mesh, sieve
and 5 mL each of soil was immediately poured into 20 cells of plastic plug flats
for rice seedbeds. One each of bait seed was buried in each cell. Twenty germinated
seeds of cucumber (cv. Baladi) were sown into the cell with one seed per cell.
The plug flats were placed in a plastic box in a growth chamber (Precision,
United States) at 25°C with 12 h photoperiod (91 μmol/m2/sec)
under humid conditions. Soil water contents were maintained at approximately
30% (v/w). The number of seedlings showing damping-off was scored at 10 to 14
days after sowing. Experiments were performed in duplicate.
Oospores production: To examine the effect of temperature on oospores
production, the two isolates P. ultimum var. ultimum were cultured
to produce oospores at different temperatures ranging from 5 to 45°C for
three weeks in 100 mL Erlenmeyer flasks containing 10 mL of clarified V-8 juice
medium (composed as described previously) (Ayers and Lumsden,
1975; Abdelzaher et al., 1994). Oospore suspensions
were then obtained by mincing mycelial mats in a blender for 3 min. Because
average oospores diameter of P. ultimum var. ultimum was 18 μm,
the resulting suspension of each isolate was filtered through a sieve, (15 μm
pore diameter) in order to produce a suspension of oospores reasonably free
of hyphal fragments. The number of mature (vital contents and intact walls)
oospores was counted and related to the examined criteria.
The effect of pH on oospores production was conducted using 2-(N-morpholino)
ethanesulfonic acid (MES) buffer (Inoue and Ichitani, 1990).
Double strength of the buffer and V-8 juice medium were separately autoclaved
at 121°C for 15 min and the cooled buffer was then added to an equal volume
of the medium to give a final buffer concentration of 50 mM and adjusted between
4.5 and 9 at 0.5 pH unit intervals using 1 N HCl or 1 N NaOH. Flasks were incubated
at 28°C for three weeks in the dark.
In the osmotic potential experiment, mannitol which was not found to be utilized
by Pythium as a nutrient (Thill et al., 1979;
Abdelzaher et al., 1994) was added to V-8 juice
to obtain potentials of -0.13, -0.27, -0.47, -1.00, -1.65 and -3.40 MPa according
to Robinson and Stokes’s formula (Robinson and Stokes,
1949). Flasks were incubated at 28°C for three weeks in the dark.
Oospores germination: The two test isolates of P. ultimum var.
ultimun were cultured to produce oospores at 28°C and pH 7 for three
weeks in 100 mL Erlenmeyer flasks containing 10 mL of vegetable V-8 juice. Oospore
suspensions were then obtained by mincing mycelial mats in a blender for 3 min.
The resulting suspension was filtered through a sieve, the size of which was
chosen in relation to the oospore diameter in order to produce a suspension
of oospores reasonably free of hyphal fragments (as previously described). This
suspension was used directly after counting and adjusting the number of mature
oospores and incubated on Difco-CMA (Difco cornmeal agar 17 g and distilled
water to 1 L) medium for 24 h at fixed temperature in the dark. Oospores germination
was examined microscopically and 200 oospores were selected at random for calculation
of germination rate. All the results are the mean of five replicates tests,
each repeated twice.
Difco-CMA medium was employed for the investigation of temperature response of oospore germination. V-8 juice medium at pH 7 was used for testing the effect of temperature on oospore germination.
In the pH experiment, CMA medium was adjusted to pH values between 4.5 and
9 at 0.5 pH unit intervals using 50 mM MES buffer (Inoue
and Ichitani, 1990; Abdelzaher et al., 1994).
Double strength of the buffer salt was dissolved in a fixed volume of distilled
water and adjusted to the desired pH using 1 N HCl or 1 N NaOH. Double strengths
of MES buffer and CMA medium were separately autoclaved at 121°C for 15
min and the buffer was then added to an equal volume of the medium to give a
final buffer concentration of 50 mM. Oospores germination tests were carried
out at 25°C for the studied fungi.
For studying the osmotic potential, mannitol, was added in a ratio of 0.04,
0.08, 0.16, 0.32, 0.64 and 1.28 mol kg-1 to CMA medium to create
the following potentials: -0.13, -0.27, -0.47, -1.00, -1.65 and -3.40 MPa, respectively,
according to Robinson and Stokes’s formula (Robinson
and Stokes, 1949). The osmotic potential was determined with a Dew point
Microvoltmeter (HR-33T; Wescor, Logan, USA). Incubation temperature of the test
was 25°C for the tested species.
RESULTS
Ten isolates of the Egyptian Pythium were isolated from diseased wheat
plants grown in an agricultural field near the bank of River Nile, Minia, Egypt
(28° 6' 54" N, 45° 30' 08" E) in January, 2008 and 9 isolates of the
German Pythium were also isolated from infected lettuce plants grown
in an agricultural field in Grossbeeren, Germany, (28° 6' 54" N, 45°
30' 08" E) in July, 2009. The 19 isolated fungi of Pythium, which could
be identified on morphological a nd molecular basis and these are; P. ultimum
var. ultimum.
These were characterized as follows:
Morphology: Morphology and dimensions of sexual organs and hyphal swellings
in Isolate I and Isolate II of P. ultimum var. ultimum and the
related data of P. ultimum var. ultimum from the key of Van
der Plaats-Niterink (1981) are presented in Table 1. I and
II isolates were distinguishable from each other on the basis of morphology
of sexual structures (Fig. 1a-h, 2a-i).
Antheridia of the German (isolate II) tend to be shorter and thiner than those
of the Egyptian (isolate I). Monoclinous antheridia were less frequently observed
in the isolate I than in the Isolate II. The number of antheridia per oogonium
was usually one, sometimes two in the two isolates. Oogonia and oospores of
the isolate I averaged 21.5±1.7 and 18±1.2 μm, respectively,
whereas those of the isolate II were 20.5±1.3 and 17.5±1.1 μm,
respectively. Oogonia were mostly terminal in the two isolates. The thickness
of oospore wall ranged 0.7-1.4 μm for isolate I and 0.7-0.9 μm for
isolate II. The average aplerotic index was 69% for the isolate I and 61.1%
for the isolate II. The average wall index was 28.6% for the isolate I and 27%
for the isolate II. Hyphal swellings were mostly intercalary in all isolates
and usually smaller in the isolate II than in the isolate I (Fig.
1, 2). The isolate II tended to produce spherical hyphal
swellings (1.1, length/breadth) as compared to the isolate I (1.4, length/breadth).
The two isolates were lacking in zoospore production at 5 and 20°C. These
morphological characters of isolate I and isolate II were in accordance with
the reference data of P. ultimurn var. ultimum (Van
der Plaats-Niterink, 1981; Dick, 1990), except for
oospore wall thickness and the wall index and the aplerotic index.
| Table 1: |
Morphology and dimensions of sexual structures and hyphal
swellings in the Egyptian (isolate I) and the German (isolate II) of Pythium
ultimum var. ultimum |
 |
| Data from Van der Plaats-Niterink (1981)
(not marked) and Dick (1990) (marked with *). Six
fungi of each isolate were examined with at least 30 structures |
|
| Fig. 1: |
Morphology of Pythium ultimum var. ultimum (isolate
I). (a) Mycelia. (b, c) Young oogonia encircled with an antheridia[3] and
with 2 antheridia [2]. (d-h) Sac antheridia attached with oogonia. (f) An
aplerotic oospore. (h) A thick walled aplerotic oospore. Bar (20 μm)
on photo 7 is applicable to the rest photos |
Growth temperature: The isolate II was distinguishable from the isolate I by its faster growth at 1-15°C and slower growth at 25-37°C (Fig. 3). The optimum and maximum temperature for growth of all isolates were 28-30°C and 37°C, respectively. The minimum growth temperature was below 1°C for the isolate II, whereas it ranged 1-5°C for the isolate I. Growth of hypha was observed in the two isolates when colonies were transferred to the optimum temperature following incubation at 40°C. No variations in the data were found among fungi of the same isolate.
Molecular identification: Sequencing of rDNA-ITS including the 5.8SrDNA
were analyzed for the two isolates of P. ultimum var. ultimum tested
by the method of Kageyama et al. (2003, 2005)
to confirm the species identification. The sequence of (EgH25) was closely related
with that of P. ultmium var. ultmium (Genbank accession number,
AY598657.1) with 100% similarity (Fig. 4).
|
| Fig. 2: |
Morphology of Pythium ultimum var. ultimum (isolate
II). (a) Mycelia. (1) Terminal and intercalary hyphal swellings, (b-h) Young
oogonia, (c) Hypogenous antheridium (d-f) Monoclinous antheridium attached
to a young oogonium, (g) Diclinous antheridium, (i) Thick walled aplerotic
oospores. Bar (20 μm) on photo 3 is applicable to the rest photos |
Pathogenicity: The pathgenicity of isolates of the two isolates of P. ultimum var. ultimum on cucumber seedling was observed. Percentages of damping-off caused by the isolates were 75% damping-off with 1,000 propagules per g dry soil at 25°C. The results of the pathogenicity test were similar for the two studied isolates.
Factors affecting oospores production and germination Influence of temperature
on oospores production: As shown in Fig. 5, oospores produced
over a temperature ranging of 5-35°C for the 2 isolates of P. ultimum
var. ultimum. The optimum range was between 25-28°C for oospores
production of the two studied isolates. The Egyptian isolate I of P. ultimum
var. ultimum produced oospores more than that of the German isolate II.
|
| Fig. 3: |
Growth-temperature relations of the Egyptian isolate I and
the German isolate II of Pythium ultimum var. ultimum. Twelve
fungi comprising isolate I and isolate II were used with duplicates |
|
| Fig. 4: |
Sequence of the rDNA internal transcribed spacer (ITS)
region of Pythium ultimum var. ultimum (isolate I and isolate
II). The sequences were completely identical for the two isolates. The
amplified DNA consists of 5.8S rDNA, studied by the method of Kageyama
et al. (2003) to confirm the species identification. The sequence
of EgH015 and EgH010 showed 100% similarity to (AY598657.1) |
Influence of hydrogen ion concentration on oospores production: As shown
in Fig. 6, oospores production happened over a range of pH
5-9. Optimum pH values were noticed between 6.5-7 for test isolates. The Egyptian
isolate I of P. ultimum var. ultimum produced oospores more than
that of the German isolate II.
|
| Fig. 5: |
Effect of temperature on oospores production of the E1gyption
(Isolate I) and German (Isolate II) fungi of Pythium ultimum var.
ultimum grown on V-8 juice medium for 21 days in the dark |
|
| Fig. 6: |
Effect of hydrogen ion concentration on oospores productio
n of the Egyption (Isolate I) and German (Isolate II) of Pythium ultimum
var. ultimum grown on V-8 juice medium at 28°C for 21 days
in the dark |
Influence of osmotic potential on oospores production: The effect of osmotic potential on oospores production at 28°C is indicated in Fig. 7. The two tested isolates showed similar responses. Oospores produced at -0.13 to -1.65 MPa with the optimum production rate at -0.27 to -0.47 MPa. The Egyptian isolate I of P. ultimum var. ultimum produced oospores more than that of the German isolate II.
Oospores germination
Influence of temperature on oospores germination: As shown in Fig.
8, oospores of the Egyptian isolate (isolate I) germinated between 15°C
and 30°C, those of the German isolate (isolate II) germinated between 10°C
and 30°C, with optimum between 25-30°C for isolate I and 20-25°C
for isolate II.
|
| Fig. 7: |
Effect of osmotic potential on oospores production of the
Egyption isolate I and German isolate II of Pythium ultimum var.
ultimum grown in V-8 juice medium at 28°C for 21 days in the dark |
|
| Fig. 8: |
Effect of temperature on oospores germination of the Egyption
isolate I and German isolate II of Pythium ultimum var. ultimum
on CMA medium after 24 h in the dark |
|
| Fig. 9: |
Effect of hydrogen ion concentration on oospores germination
of the Egyption isolate I and German isolate II of Pythium ultimum var.
ultimum on CMA after 24 h at 25°C in the dark |
Influence of hydrogen ion concentration on oospores germination: As
presented in Fig. 9, the two isolates tested germinated over
pH 5 to pH 9 with an optimum between 6.5~8.
|
| Fig. 10: |
Effect of osmotic potential on oospores germination of the
Egyption isolate I and German isolate II of Pythium ultimum var.
ultimum on CMA after 24 h at 25°C in the dark |
Influence of osmotic potential on oospores germination: The effect of osmotic potential on oospore germination at 28°C is given in Fig. 10. The two isolates tested showed similar responses. At -3.40 MPa, non could germinate. They germinated at the other osmotic potentials tested, with good germination between -0.13 and -0.27 MPa and the optimum at -0.47 MPa.
DISCUSSION
Morphological comparisons of the reproductive structures, especially their
dimensions, revealed clear differences between the Egyptian isolate I and the
German isolate II of P. ultimurn var. ultimum. The isolate I was
readily distinguished from the is olate II by the combination of larger oogonia
and elongated antheridia. The two isolates were also distinguishable by growth
temperature and oospores production. Similarities in the sequence of the r-DNA-ITS
including the 5.8S rDNA demonstrated evident genetic similarity at the species
level between the two isolates. Tojo et al. (1998)
compared between two morphological groups of Pythium ultimum var. ultimum
strains isolated in a vegetable field in Japan. They showed differences in morphology
within their groups of P. ultimum var. ultimum. They further postulated
that Random Amplified Polymorphic DNA (RAPD) and isozyme analyses revealed genetic
dissimilarity between the two groups of P. ultimum var. ultimum.
Present results were comparable with the results of Tojo
et al. (1998) except that they used random amplified polymorphic
DNA (RAPD) and isozyme analyses for caparisons between the two different groups
of Pythium ultimum var. ultimum whereas in our study we used sequencing
of the r-DNA-ITS including the 5.8S rDNA for comparison between the Egyptian
and German isolates of the same species. Present results indicate that the two
isolates were not distinguishable by their pathogenicity to cucumber seedling
which is in agreement with the results indicated by Tojo
et al. (1998). Sequencing of the r-DNA-ITS including the 5.8S rDNA
is more reliable than random amplified polymorphic DNA (RAPD) and isozyme analyses
because the first deals with a part of a gene and the second of isozyme analysis
affected by environmental conditions (Lévesque and
de Cock, 2004). Therefore, identification of Pythium species to species
level can be done using in the sequence of the r-DNA-ITS including the 5.8S
rDNA, despite of dissimilarities in some morphological and physiological characteristics.
Several morphological characters of isolates I and II differed from the reference
data of P. ultimum var. ultimum (Van der Plaats-Niterink,
1981; Dick, 1990). Oospore wall thickness and the
wall index of isolates I and II were thinner than those of the reference data.
This morphological difference is difficult to explain, but both isolates can
be distinguished from other thin oospore wall species such as P. irregulare
and by other morphological features such as types and number of antheridia,
oogonial wall and shapes of oogonia, plerotic and aplerotic characters of oospores
and other features. The aplerotic index of the isolate I ranged 66.2-71% and
ranged 55.8-66.4% for isolate II. Dick (1990) arbitrarily
classified species with a mean aplerotic index over 60-65% as plerotic. Based
on this criterion, oospores of the isolates I and II were plerotic. However,
in this study, the oospores did not fill the oogonium and, therefore, they were
aplerotic according to classical concepts. This concurs with the findings of
Barr et al. (1996), who reported that the aplerotic
index of P. ultimum oospores ranged 60.5-75.3% when the oospores did
not fill the oogonium.
Oospores are considered important survival structures. They can remain viable
after 8 months to 12 years in the soil (Lumsden and Ayers,
1975; Abdelzaher et al., 1994). When the
soil conditions become favorable, oospores germinate to produce huge amount
of disease inducing elements, which spread from place to place causing infestation.
Accordingly, studying oospore production and germination of two isolates of
Pythium ultimum var. ultimum isolated from diseased plants grown
in Egypt and Germany is of importance in order to shed light on their life cycles
under variable conditions.
The production of oospores is dependent on several factors including temperature,
hydrogen ion concentration and osmotic potential. Our results here indicate
that the most favorable temperatures for oospore production were 25-30°C
by the tested fungi. It could be postulated that the very cold winter and very
hot summer retard oospore production of such fungi (Abdelzaher
et al., 1994). Oospore produced most abundantly around neutral. Previous
studies revealed that Pythium sp. non-tolerant to acid soils (Webster,
1980; Abdelzaher et al., 1994). In this study,
no oospores have been produced below pH 5 for the two studied isolates of P.
ultimum var. ultimum. Pythium species have been absent from
heavily polluted places and seldom found in partially polluted locations (Harvey,
1952; Abdelzaher et al., 1994). It would
be suggested that, high polluted locations with osmotic potentials above -1.65
MPa represent inhibitive media toward oospore production. Oospores germination
of these two pythia occurred over a broad pH range with an optimum around 7.
Acidic soil appeared unsuitable for oospore germination. Heavy polluted places
retard oospore germination, therefore, it could be expected that high polluted
localities with osmotic potentials above -1.65 MPa inhibit oospore germination.
Our results are comparable with the results of many previous researches (Abdelzaher
et al., 1994; Cliquet and Tirilly, 2002;
Ge and Ichitani, 1992).
However, the Egyptian isolate produced more oospores than the German isolate, similarities of oospore behavior (production and germination) of the two tested isolates under the studied factors were confirmed.
Finally, it is worth to mention that identification of Pythium sp. to the species level can be done using sequencing of r-DNA-ITS including the 5.8S rDNA, however, some morphological and physiological differences might present within the same species. This might be attributed to the effect of environmental factors and cultural conditions.
Subscribe Today
