Subscribe Now Subscribe Today
Abstract
Fulltext PDF
References
Research Article
 

Characterization and Elimination of a TMV Isolate Infecting Chrysanthemum Plants in Egypt



Entsar A. Nassar, Kh. A. El-Dougdoug, M.E. Osman, Rehab A. Dawoud and Aliaa H. Kinawy
 
ABSTRACT

An Egyptian isolate of a Tobamovirus was isolated and identified from Chrysanthemum cultivation in Egypt. Both biological, serological and sequence analysis of the coat protein gene demonstrated that the virus represents an isolate of the Tobamoviridae family. The isolated virus was nominated as TMV Chrysanthemum Egyptian isolate (TMV-Ch-EG). This virus isolate caused severe disease symptoms in Chrysanthemum plants with mosaic, mottling and flower discoloration. The virus was purified biologically using serial transfer of the single local lesion technique on Nicotiana gultinosa. The induced antiserum for the isolated virus had a titer 1\1024. 600 bp DNA fragments from the coat protein gene (CP) of TMV-Ch-EG was amplified with Rt-PCR technique. Phylogenetic analysis of the TMV-Ch-EG/CP- gene showed 89% nucleotide sequence homology with other published strains of TMV in GenBank and 81% amino acid sequence homology. Tissue culture approach was used to permit the recovery of TMV-Ch-free micropropagated shoots via application of 20 mg L-1 virazole followed by thermotherapy at 38°C for two weeks and early screening to facilitate the efficient production of virus-free tissue culture derived propagules using the produced antiserum against TMV-Ch-EG.

Services
Related Articles in ASCI
Similar Articles in this Journal
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Entsar A. Nassar, Kh. A. El-Dougdoug, M.E. Osman, Rehab A. Dawoud and Aliaa H. Kinawy, 2012. Characterization and Elimination of a TMV Isolate Infecting Chrysanthemum Plants in Egypt. International Journal of Virology, 8: 14-26.

DOI: 10.3923/ijv.2012.14.26

URL: https://scialert.net/abstract/?doi=ijv.2012.14.26
 
Received: June 20, 2011; Accepted: July 26, 2011; Published: October 25, 2011

INTRODUCTION

Chrysanthemum is a genus of about 30 species of perennial flowering plants in the family Asteraceae. Chrysanthemum is one of the three most important cut flowers in the world. Chrysanthemum has an economical importance as ornamental, culinary, environmental and insecticidal uses (Marongiu et al., 2009). Chrysanthemum cinerariifolium is economically important as a natural source of insecticide with a huge international market (Liu and Gao, 2007) Chrysanthemum plants are infected with viruses as Tomato Aspermy Virus (TAV) (Verma et al., 2006), Tobacco mosaic virus (TMV) (Zaitlin and Israel, 1975) and Cucumber Mosaic Virus (CMV), Chrysanthemum B Virus (CVB) (Ram et al., 2009) and viroids as Chrysanthemum Stunt Viroid (CSVd) and Chrysanthemum chlorotic mottle viroid (CChMVd) (Hosokawa et al., 2005).

The current study aims at identifying and characterizing an Egyptian TMV isolate from naturally infected Chrysanthemum cinerariifolium based on its biological, serological, and molecular properties and the production of virus free plant materials.

MATERIALS AND METHODS

Source of the virus isolate: About 35 Chrysanthemum plants were collected from garden and houses plants of Horticulture Dept. Fac. of Agriculture, Ain Shams University. Egypt. Some of these samples showed virus like symptoms.

Biological properties of isolated: Infected Chrysanthemum plants with foliar symptoms were used in mechanical inoculation of indicator N. glutinosa plants. Infected Chrysanthemum tissues were triturated (1:1, v/v) with 0.05 M phosphate buffer pH 7.2, containing 0.2% mercaptoethanol. Homologous single local lesion produced on N. glutinosa were cut and macerated on a glass slide and mechanically inoculated on seedlings of N. tabacum cv. Samsun as a propagative host.

Infected sap from Samsun tobacco was used in host range testing using (20 plant species belonging to 7 families). Infectivity of inoculated plants was tested with ELISA (Table 1).

Physical properties characters as Thermal Inactivation Point (TIP), Dilution-End Point (DEP) and Longevity In Vitro (LIV) of the TMV isolate was determined according to Noordam (1973), using Ch. Aum production amaranticolor as a local lesion assay host.

The virus was purified from inoculated Chrysanthemum plants according to El-Ahdal et al. (1984).

Antiserum production: An adult New Zealand rabbit was injected with TMV purified preparations seven times at one week intervals according to the method of Makkouk and Gumpf (1976). The titer of the antiserum was determined by indirect ELISA technique (Dijkstra and DeJager, 1998).

Molecular characterization of the TMV isolate: Total RNA was extracted from healthy and infected Chrysanthemum plants using High Pure RNA Tissue Kit (Roche Molecular Biochemicals, Cat. No.2033674).

RT-PCR protocol was as described by (Chung et al., 2007) using two primers (TMV1- ATGTCTTACAGTATCACTACTCC/ and TMV2-TCAAGTTGCAGGACCAGAGG for the coat protein gene. Complementary DNA (cDNA) synthesis was accomplished as described by Chung et al. (2005). Amplification of the cDNA included the following cycles: Denaturation at 94°C for 30 sec, primer annealing at 50°C for 1 min and extension at 72°C for 1 min for 40 cycles with a final extension at 72°C for 7 min. The PCR products were analyzed by electrophoresis onto 1.0% agarose gel and the size of the DNA fragment was determined in accordance with the molecular weight markers.

Table 1: Occurrence of TMV in infected Chrysanthemum samples using produced antiserum and common antiserum
Negative control for Chrysanthemum = 0.106; Positive control for Chrysanthemum = 0.212

The PCR products were visualized on a UV transilluminator (λ = 254) and photographed with an UVB laboratory products, Epichemi II Dark room, 3UV transilluminator Pharmacia.

DNA sequencing for the partially amplified coat protein gene (~600 nt) of TMV isolate was performed using ABI prism 3100, Genetic Analyzer by using dye- primer and dye terminator method at Gene Link D) NA Sequencing service, New York, USA. The resulting sequence for CP gene was then compared to the published sequences of TMV using the Clustal W method (Thompson et al., 1994).

Production of Chrysanthemum
TMV-free plantlets:
Media used in this investigation was salt mix of Murashige and Skoog (1962). The infected explants were aseptically cut into single nodal pieces. The base of each cutting was cultured in jars contained 25 mL of MS supplemented with 0.25 mg L-1 BA and at 25±1°C under florescent light. The heat treatment was applied to the in vitro micropagated plant material Shoot proliferation were pruned and placed in growth chamber at 37±1°C for 14 and 28 days at 16 photoperiod .Three different concentration of 10, 20 and 30 mg L-1 of filter sterilized virazole were tested. Combination between thermotherapy and chemotherapy were applied in vitro by subjecting the micropropagated shoots at 37±1°C for 21 days and then transferred to media containing 10, 20 and 30 mg L-1 virazole. After 2 weeks, shoots were placed in antiviral free media. A period of about 35 days was necessary to have all the cultures well- established and the shoots proliferated: then a few leaves could be sampled for virus detection using produced antiserum by indirect ELISA test.

RESULTS

Biological studies
Symptomatology and hostrange studies: Naturally infected Chrysanthemum plants exhibiting symptoms of conspicuous mottling, mosaic and vein banding of leaves are shown in Fig. 1.

Host range studies showed the formation of systemic mottling, mosaic and blisters upon virus inoculation on N. tabacum cv. Samsun. Whereas chlorotic local lesions surrounded by necrotic tissues were developed on inoculated N. glutinosa (Fig. 2).

According to the response of the tested hostrange plants (Table 1), host reactions was classified into four categories as follows: 1) Plants showed local infection including Cenopodium quinoa, C. murale, Vicia faba cv. Giza 402 and C. amaranticolor, Gomphrena globosa, N. glutinosa and N. tabacum cv. White Burley, Datora metel and D. stramonium, 2) Plants showed different systemic symptoms including, N. tabacum cv. Samson, L. esculentum cv. Castle rock, Capsicum annuum, Jasminum mesnyi, Jasmonium multiflorum, J. mesnyi, J. grandiflora and Chrysanthemum spp. 3) Plants showed local lesion followed by systemic symptoms including, N. gluca and N. rustica and 4) Plants showed no visible reaction with TMV isolate included, Cucarbita maxima, Cucarbita sativus and Plumeria sp. These results were confirmed by indirect ELISA.

Inclusion bodies: Light microscopy of the epidermal strips from infected Chrysanthemum morifolium leaves, 21 days post TMV inoculation showed cytoplasmic inclusion bodies. The crystalline inclusions induced by TMV were observed in epidermal and hair cell as well as amorphous inclusions stained with bromophenol blue and mercuric chloride. In addition, the virus infection caused decrease in number of stomata and lignifications of stomata gap as well as irregular of epidermal cells compared with healthy (Fig. 3).

Fig. 1(a-b): Different types of symptoms on naturally infected Chrysanthemum morifolium. (A), Healthy Chrysanthemum, (b) Leaves showing vein banding, (c) Flower showing color breaking and (d) Leaf curling with vein clearing

Fig. 2(a-b): Differential hosts mechanically inoculated with TMV isolate showing: (a) Necrotic local lesions with chlorotic spots on N. glutinosa and (b) Mosaic and mottling on N. tabacum cv. Samasun

Serological characters
Production of antiserum: The titer of induced antiserum was determined by indirect ELISA was 1/1024. The induced antiserum for the TMV-Ch-EG isolate (AS1) was more specific than commercial authentication serum (AS2) in detection of TMV in Chrysanthemum samples (Table 1) and other hosts (Table 2). Molecular characters.

Fig. 3(a-b): Epidermal cells of Chrysanthemum leaves inoculated with TMV-Ch-EG isolate showing. (a) Crystalline (CI) and (b) amorphous (AI) inclusions

Fig. 4: 1.0% Agarose gel electrophoresis showing partially amplified PCR products for the TMV/CP gene. lane at the left represents 1 kb DNA markers; lane 1, inoculated Chrysanthemum morifolium, lane 2 and 3: naturally infected Chrysanthemum morifolium

Table 2: Occurrence of TMV in infected Chrysanthemum samples using produced antiserum and common antiserum
Negative control = 0.105 nm

RT-PCR: RT-PCR successfully detected TMV viral RNA from Chrysanthemum tissues. Partial amplification of the CP gene about 600 bp in size was detected from TMV infected tissues by using TMV1 and TMV2 specific primer for the coat protein gene (Fig. 4).

Fig. 5: The partial nucleotide sequence (598 nt) analysis of the TMV/CP-gene for the TMV-Ch-EG isolate

Fig. 6: Phylogenetic tree constructed from the multiple alignments of the CP/TMV-Ch-EG (GeneBank accession GU982315) and six TMV strains (AY686725_Egypt, AB369276_ Korea, AJ239099_China, AF273221_USA, AJ429078_ Germany and AY633749_ Thailand)

Results for the partially amplified DNA sequence of the CP gene is presented in Fig. 5.

Phylogenetic analysis: The partial nucleotide sequence (598 nt) of the TMV/CP-EG was aligned with six coat protein sequences of TMV (Fig. 6) by using DNAMAN programme (DNAMAN V 5.2.9 package, Madison, Wisconsin, USA). A phylogenetic tree of TMV/CP-EG showed 89% sequence similarity with the other compared accessions.

Deduced amino acids sequence of TMV/CP gene: Deduced amino acids were determined using computer software. The predicted number of amino acids produced from translation of partial CP gene nucleotide sequence of TMV-Ch-EG (GeneBank accession ADF47092.1) isolate was 159 amino acids starting with Methionine (M) and ended with Serine (Fig. 7).

The predicted amino acids sequence (159 amino acids) of the TMV-Ch-EG CP-gene was published in GeneBank accsseion ADF47092.1 and compared with other nine amino acid sequences of TMV published in GeneBank.

Fig. 7: Predicted amino acids of partial CP gene of sequence of TMV-Ch-EG isolate (GeneBank accsseion ADF47092.1)

Fig. 8: A multiple alignment of predicted amino acid sequences encoding the Coat Protein (CP) gene of TMV-Ch-EG isolate (GeneBank accession ADF47092.1)

A phylogenetic tree of TMV-EG presented in (Fig. 8) revealed that the deduced amino acid sequence of TMV under study has 82% resemblance accessions (AAK33120_Brazil, AAT45114_Thailand, P69507_Japan, AAK06750_Korea, AM64218_China, AAQ12020_Finland, CAL69972_Vietnam, ACY412-14_USA and CAD22079 Germany).

Comparisons between the predicted amino acids of partial CP-gene sequence of TMV-Ch-EG isolate were showed that, the type of amino acids consists of 18 amino acids. Threonine and (Serine and Leucine) have a high frequency and percentage 17 and 10.69%, respectively, when Histidine and Methionine have low frequency and percentage 1 and 0.62%, respectively (Table 3).

Production of virus free plantlets using tissue culture techniques: Combining chemotherapy and thermotherapy by subjecting the infected shoots to 3^°C for 2 weeks in addition to 10, 20 and 30 mg L-1 virazole produced ratios of 95, 90 and 85% Chrysanthemum survival, respectively, while the percentages of virus free were 38, 61.5 and 76.8%, respectively (Table 4).

Table 3: Composition of predicted amino acids of partial cp gene sequence for TMV- Ch-EG isolate
A.A.: Amino acids

Table 4: The effects of thermotherapy and chemotherapy (virazole) on TMV elimination from infected C. morifolium plants

Fig. 9: Micropropagation stage of Chrysanthemum plants in vitro (healthy and infected). (1) 1-Starting stage; (a) Healthy and (b) Infected. (2) Multiplication stage (a) Healthy, (b) Infected and (3) Rooting stage (a) Healthy (b) Infected

Fig. 10(a-b): Effect of temperature (thermotherapy) on TMV infected C. morifolium plants (a) 2 weeks and (b) 3 weeks

Fig. 11(a-c): Effect of Virazol on TMV infected C. morifolium plants. (a) mg L-1, (b) mg L-1 and (c) mg L-1

Micro propagation stage of in vitro Chrysanthemum plants healthy and infected are shown in Fig. 9. while the effect of thermotherapy and chemotherapy are shown in Fig. 10 and 11, respectively.

DISCUSSION

According to biological and molecular characters, TMV isolated from Chrysanthemum (TMV-Ch-EG) is considered as a strain of TMV common (isolated from tobacco plants).

TMV isolate used in this study was found to give necrotic local lesions on N. tabacum cv. White Burley plants and chlorotic local lesions surrounded with necrotic tissue on N. glutinosa. These findings differed from that obtained by (El-Ahdal et al., 1984; El-Afifi et al., 2003) who described severe mosaic and malformation on N. tabacum cv. White Burley and necrotic local lesions on N. glutinosa.

The partial nucleotide sequence of the RT-PCR amplified fragment with TMV1 and TMV2 primers for the coat protein cp-gene of TMV isolate was done to determine the relationship with other recommended TMV strains registered in Gene Bank.

Threonine and (Serine and Leucine) have a high frequency and percentage 17 and 10.69% respectively, when Histidine and Methionine have low frequency and percentage 1 and 0.62%, respectively (Chung et al., 2005).

A phylogenetic tree of TMV isolate revealed 89% a moderate degree of similarity to the other isolate sequences of TMV strains while that obtained by Cherian et al. (1999), TMV (Tom-K) nucleotide sequence of coat protein cp-gene showed 93.1% identity with other TMV strains and by Chung et al. (2007) nucleotide sequence of coat protein cp-gene of TMV-pet showed 99.0% identity with TMV-potato 3-2 (GeneBank accession no. AF318215) isolated from potato showing yellow mosaic and stunt symptom and with a TMV Korean strain (GeneBank accession no. X68110).

The predicted number of amino acids was produced from translation of partial cp-gene nucleotide sequence were 159 amino acids starting with Methionine (M) and ended with Serine (S). Comparison between amino acids composition of partial cp-gene sequence for TMV isolate and nine TMV strains published in GeneBank (accessions (AAK33120_Brazil, AAT45114_Thail-and P69507_Japan, AAK06750_Korea, AAM64218_China, AAQ12020_Finl and, CAL69972_Vietnam, AC- Y41214_USA and CAD22079_Germany) was done to determine amino acid composition and revealed 82% aminoacids similarity with these TMV strains.

The biological, serological and molecular characters reported in this study confirmed identification of an isolate TMV-Ch-EG strain of TMV Tobamovirus isolated from C. morifolium in Egypt.

In our results, shoot tips (explants) were cultivated after sterilization process in media containing 0.25 mg L-1 BAP that mainly resulted in the growth of stem, leaves and occurrence of auxiliary shoots. While the micropropagated stage was done by sub cutting of the stem cuttings up to two times every 21 days. These results were in agreement with Liu and Gao (2007) who mentioned that rapid propagation technology was established and optimized in vitro on MS medium supplemented with 0.3-0.5 mg L-1 benzyl adenine (BA) and 0.3 mg L-1 Naphthalene Acetic Acid (NAA). Root induction and development could be observed within 15 days after inoculation on 1/2 MS medium supplemented with 0.2 mg L-1 Indole-3-Acetic Acid (IAA). Subculture of these shoots on the same medium resulted in similar responses in multiple shoot formation within 4 weeks. Also, the results of Patil et al. (2005) revealed that the shoot tip explants of Chrysanthemum inoculated in MS basal media containing 2 mg BAP and 0.5 mg NAA/L gave better performance in terms of response to shoot initiation, the days to shoot initiation and number of shoots per culture. The best rooting was obtained in MS basal 1.0 mg NAA/L.

Therapeutic treatments were tested since the 1920s to cure valuable cultivars from virus-like diseases.

The obtained results indicated that during in vitro heat therapy at 37°C±1 for 14 and 21 days, the percentage of survival was (100%) and (95%) and virus free plantlets was (28.5%) and (42.8%) for C. morifolium plants, respectively. These results were in agreement with (Ram et al., 2005) whom stated that heat treatment (thermotherapy) at elevated temperatures (34-42°C) was used to produce healthy plants from individuals suffering from diseases such as potato witches’ broom and aster yellows caused by phytoplasma.

Walkey (1991) reported that for obtaining virus-free materials, addition of antiviral compounds were recommended in the absence of heat treatment and meristem culture to eliminate viruses especially in the commercial laboratories. Several investigators suggested that the contact of the virus-infected tissues with the culture medium might eliminate viruses present in the tissue. Moreover, the multiplication of viruses was usually decreased when infected plants were treated with chemical analysis to the purine and pyrimidine bases of nucleic acids. These analogues act like heat therapy to increase the success of the apical meristem and tip culture technique.

Harris and Robins (1980), Kim et al. (1994) and Ram et al. (2005) stated that ribavirin (Virazole or 1- B-D-ribofuranosyl-1, 2, 4-triazole -3-carboxamide), a base nucleotide analogues that has been extensively tested against human viruses, appears to be effective against both RNA and DNA viruses. Many investigators demonstrated that incorporation of ribavirin into culture media resulted in an increased percentage of virus-free progeny.

The obtained results indicated that incorporation of ribavirin (virazole) in culture medium at concentration of 10, 20 and 30 mg L-1 progressively increase the percentage of virus-free plantlets to (29.4, 31.3 and 58%) in Chrysanthemum plantlets respectively. Virazole proved to be somewhat phytotoxic to Chrysanthemum plantlets but this effect disappeared gradually 15 days after culture and the plantlets reversed to green color. The percentages of survival by using virazole were (100, 93 and 86%) for Chrysanthemum plantlets, while Albouy et al. (1988) reported that in Orchid cultures, two viral diseases caused by Odontoglossum Ring Spot Virus (ORSV) and Cymbidium Mosaic Virus (CMV) have been reported to limit the production. Attention of virus free orchids by meristem tip culture has proved to be often inadequate. Different chemicals such as virazole have been reported as means of freeing plant culture in vitro from viruses. In order to increase the efficiency of eradication of ORSV and CyMV, chemotherapy based on the incorporation of virazole in the solid medium culture has been investigated on Cymbidium protocorms cultured in vitro. Factors such as growth regulators and active charcoal are of critical importance. Best results were obtained in shortening the time of transplantation (18 days) allowing a good excision of Cymbidium new protocorms. After 5 subcultures of 18 days in presence of 25 ppm of virazole we obtained 95% virus free plantlets.

The obtained results concerning the combination between chemotherapy and thermotherapy by subjecting the infected shoots to 3^°C for 2 weeks produced (95, 90 and 85%) survival for Chrysanthemum while the percentages of virus free were (38, 61.5 and 76.8%) for 10, 20 and 30 mg L-1 virazole, respectively, showed the effects of thermotherapy and chemotherapy (virazole) on TMV elimination from infected Chrysanthemum plants.

Finally, the obtained results under this study concerning the combination treatments are promising to be an effective method for TMV eradication from Chrysanthemum plants in order to produce TMV-free Chrysanthemum plantlets via tissue culture technique.

REFERENCES
Albouy, J., C. Flouzat and M. Tronchet, 1988. Eradication of rchid viruses by chemotherapy from in vitro cultures of cymbidium. Acta Hort. Vol., 234.

Cherian, S., J. Joseph, V. Muniyappa and H.S. Savithri, 1999. Characterization of tobacco mosaic virus isolated from tomato in India. Curr. Sci., 76: 1384-1388.

Chung, B.N. J.H. Lim, S.Y. Choi, J.S. Kim and E.J. Lee, 2005. Occurrence of Chrysanthemum stunt viroid in chrysanthemum in Korea. Plant Pathol. J., 21: 377-382.
Direct Link  |  

Chung, B.N., J.S. Kim, J.D. Cho, S.R. Cheong and M.I. Jeong, 2007. Tobacco mosaic virus detected in vegetatively propagated petunia hybrids Surfinia. Plant Pathol. J., 23: 34-36.
Direct Link  |  

Dijkstra, J. and C.P. Dejager, 1998. Practical plant virology: Protocols and excercises. Bio. Plantarum, 11: 12-934.

El-Afifi, S.I., A.M.E. El-Ahdal, M.H. Abdel-Ghaffar and A.M. El-Borollosy, 2003. Evaluation studies on multiplication of tobacco mosaic virus and potato virus Y in callus culture. I Biological and microscopic detection. Ann. Agric. Sci., 40: 1525-1544.

El-Ahdal, A.M.E., F. Mayer, S.I. EL-Afifi and E.K. Allam, 1984. Characterization of two strains of two strains of tobacco mosaic virus by biological, biochemical, immunological and electron microscopical techniques. Zeitschrift fur Allgemeine Mikrobiologie, 24: 507-514.
CrossRef  |  

Harris, S. and R.K. Robins, 1980. Ribavirin: Structure and Antiviral Activity Relationships. In: Ribavirin: A Broad Spectrum Antiviral Agent, Smith, R.A. and W. Kirkpatrick (Eds.)., Academic Press, New York, USA., pp: 1-21.

Hosokawa, M., Y. Matsushita, K. Ohishi and S. Yazawa, 2005. Elimination of chrysanthemum chlorotic mottle viroid (CChMVd) recently detected in Japan by leaf-primordia free shoot apical meristem culture from infected cultivars. J. Japan. Soc. Hort. Sci., 74: 386-391.
Direct Link  |  

Kim, J.Y., S.Y. Lee, H.R. Kim and J.K. Choi, 1994. Effect of virazole in elimination of viruses (LSV and CMV) from infected lily plants. J. Agric. Sci. Crop Prote., 36: 370-374.

Liu, Z. and S. Gao, 2007. Micropropagation and induction of autotetraploid plants of Chrysanthemum cinerariifolium (Trev.) Vis. In vitro Cell. Dev. Biol., 43: 404-408.
Direct Link  |  

Makkouk, K.M. and D.J. Gumpf, 1976. Characterization of potato virus Y strains isolated from pepper. Phytopathology, 66: 576-581.

Marongiu, B., A. Piras, S. Porcedda, E. Tuveri, S. Laconi, D. Deidda and A. Maxia, 2009. Chemical and biological comparisons on supercritical extracts of Tanacetum cinerariifolium (Trevir) Sch. Bip. with three related species of chrysanthemums of Sardinia (Italy). Nat. Prod. Res. Part A, 23: 190-199.
CrossRef  |  Direct Link  |  

Murashige, T. and F. Skoog, 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Planta., 15: 473-497.
CrossRef  |  Direct Link  |  

Noordam, D.D., 1973. Identification of Plant Viruses: Methods and Experiments. Center for Agricultural Publishing and Documentation, Netherlands, ISBN-13: 9789022004647, Pages: 207.

Patil, S.R., S. Balachandran, C. Anitha and M. Chopde, 2005. In vitro propagation of chrysanthemum (Dendranthema gandiflora). J. Soils Crops, 15: 287-289.

Ram, R., N. Verma, A.K. Singh and A.A. Zaidi, 2009. Virus-free chrysanthemum: Production and quality management. Arch. Phytopathol. Plant Prote., 42: 940-949.
CrossRef  |  

Ram, R., N. Verma, A.K. Singh, L. Singh, V. Hallan and A.A. Zaidi, 2005. Indexing and production of virus-free chrysanthemum. Biol. Plantarum, 49: 149-152.
CrossRef  |  

Thompson, J.D., D.G. Higgins and T.J. Gibson, 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22: 4673-4680.
CrossRef  |  PubMed  |  Direct Link  |  

Verma, N., K. Kumar, S. Kulshrestha, G. Raikhy and V. Hallan et al., 2006. Detection and molecular characterization of a Tomato aspermy virus isolate infecting chrysanthemums in India. Acta Hort. (ISHS), 722: 41-54.

Walkey, D.G.A., 1991. Applied Plant Virology. 2nd Edn., Chapman Hall, Landon, ISBN: 9780412357404, Pages: 338.

Zaitlin, M. and H.W. Israel, 1975. Tobacco mosaicvirus (Type strain) No. 151: Description of plant viruses. Commonwealth Mycology Institute/Association of Applied Biologists, Kew, Surrey, England.

©  2019 Science Alert. All Rights Reserved
Fulltext PDF References Abstract