Subscribe Now Subscribe Today
Research Article
 

Differentiation Among Three Egyptian Isolates of Citrus psorosis virus



Kh.A. El-Dougdoug, S.A. Ghazal, A.A. Mousa, H. Fahmy and A.R. Sofy
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

This study was aimed to determined PCR product of the CP gene by electrophoresis. Three Egyptian isolates of Citrus psorosis virus (CPsV-EG), namely ARC, TB and TN were obtained from citrus cvs. Grapefruit, Balady and Navel, respectively. These isolates were differed in some of their external symptoms. The CPsV-EG isolates were detected by biological indexing, giving rise to Oak Leaf Pattern (OLP) on Dweet tangor. The three isolates were differentiated using Double Antibody Sandwich-Enzyme-Linked Immunosorbent Assay (DAS-ELISA), woody indicator plants, differential hosts, peroxidase isozymes and activity, total RNA content and Reserves Transcription-Polymerase Chain Reaction (RT-PCR). The severe isolate (ARC) gave the highest OD value (2.204) in ELISA, followed by the mild isolate (TB) (1.958) and the last latent isolate (TN) (1.669). These isolates differed also in incubation period, intensity of symptoms and response to sensitivity of woody indicator plants and differential hosts. The CPsV-EG isolates showed differences in isozymes fractions, RF value and intensity as compared with healthy plant. Results were confirmed by peroxidase activity where the level of peroxidase activity was considerably higher in ARC leaves than TB and the last TN. The total RNA content in infected leaves gave the highest content in ARC followed by TB isolate while the lowest was recorded in TN isolate. Finally, RT-PCR showed differences between CPsV-EG isolates of PCR products using specific primer (Ps66 and Ps65) where base number of coat protein gene ARC isolate 571 bp; TB isolate 529 bp and TN isolate 546 bp.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Kh.A. El-Dougdoug, S.A. Ghazal, A.A. Mousa, H. Fahmy and A.R. Sofy, 2009. Differentiation Among Three Egyptian Isolates of Citrus psorosis virus. International Journal of Virology, 5: 49-63.

DOI: 10.3923/ijv.2009.49.63

URL: https://scialert.net/abstract/?doi=ijv.2009.49.63
 

INTRODUCTION

Fawcett and Klotz (1938) classified psorosis into two types: psorosis A and psorosis B. Both types produced similar bark lesion symptoms but different leaf and fruit symptoms.

The more aggressive form of psorosis disease, called psorosis B (Fawcett, 1932; Fawcett and Klotz, 1938), additionally caused chlorotic blotching in old leaves with gummy pustules on the leaf underside and blisters on twigs (Roistacher, 1991, 1993).

Among graft transmissible diseases that have been reported from Egypt Citrus psorosis virus (Roistacher, 1991; Fahmy et al., 2002).

Particles of Citrus psorosis virus (CPsV), type species of the genus Ophiovirus (Milne et al., 2000), have been partially purified from several psorosis isolates (Derrick et al., 1988; Garcia et al., 1991b; Navas-Castillo et al., 1993) and later associated with additional isolates of different origins by Western-blot detection of the Coat Protein (CP) using an antiserum to the isolate CPV-4 (formerly CRSV-4) from Florida (Da Graca et al., 1991; Garcia et al., 1994; Navas-Castillo and Moreno, 1995).

Roistacher (1991) reported that, there was much variability in symptoms found in citron, Dweet tangor and sweet orange among the various isolates and only two isolates were mechanically transmitted. On the other hand, psorosis might remain symptomless in certain host trees, the virus could be transmitted from a symptomless host and induce symptoms in progeny trees.

CpsV isolates frequently are differed in the intensity and kind of symptoms induced in different citrus species (Derrick et al., 1988; Garcia et al., 1991a; Navas-Castillo et al., 1991; 1993; Garcia et al., 1994; Legarreta et al., 2000).

Variation in the epitopes present in the CP of different CPsV isolates (Djelouah et al., 2000; Alioto et al., 2003) makes it advisable to use a mixture of MAbs (Martin et al., 2002).

Praveen et al. (2003) reported that, the failure to amplify the coat protein gene of Indian Citrus ringspot virus (ICRSV) by the specific primers of Citrus psorosis virus (CPV) suggested that these 2 viruses were quite distinct.

The present study was carried out to compare among CPsV Egyptian isolates through biological, serological and molecular characters.

MATERIALS AND METHODS

Source of Virus Isolates
Three CpsV-EG isolates namely ARC, TB and TN were obtained from citrus cvs. Grapefruit (at the farm of Agric. Res. Cent.), Balady and Navel (Tersa), respectively where show different external symptoms (Fig. 1).

Double Antibody Sandwich Enzyme-Linked Immuonosorbent Assay (DAS-ELISA) was used for CPsV-EG isolates detection in shoots of infected trees, using specific monoclonal antibody for CPsV (Agritest, Italy) regarding Clark and Adams (1977).

Grapefruit (ARC), Navel (TB) and Balady (TN) trees were for the presence of Citrus tristeza virus (CTV) using Direct Tissue Blot Immuno-Assay (DTBIA) according to Garnsey et al. (1993), Spiroplasma citri using Diene’s stain according to El-Dougdoug et al. (1993) and Citrus excortis viroid (CEVd) using direct tissue blot hybridization according to Sambrook et al. (1989).

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 1: Citrus trees of different varities presumed to be CPsV infected or CPsV free on the basis of the symptoms showing: (A) healthy tree, (B) ARC isolate and (C and D) TB isolate

Source of Virus Isolates
Infected trees of Grapefruit, Balady and Navel which gave +ve DAS-ELISA were used as a CPsV-EG isolates source. The virus isolates were isolated and propagated by graft inoculation with eye buds from infected materials on sour orange. The inoculated plants were kept under greenhouse conditions (24-27°C/16 h light day).

The three CPsV-EG isolates were differentiated based on external symptoms, DAS-ELISA, woody indicator plants, differential hosts, peroxidase isozymes and activities, total RNA content and RT-PCR as follow:

DAS-ELISA
As mentioned earlier in detection of CPsV-EG by DAS-ELISA (Clark and Adams, 1977).

Woody Indicator Plants
Three CPsV-EG isolates samples were indexed by graft inoculation with two blind buds, using different woody indicator plants for each isolate (Dweet tangor, Madam vinous, New hall, Navel parent Washington, Balady, Navelina and Valencia) grafted on Volkameriana lemon as rootstock. The grafted plants were kept under insect proof greenhouse at 24-27°C (max. day) / 18-21°C (min. night) and recorded the symptom development for 1 month.

Differential Hosts
The CpsV-EG isolates were mechanically inoculated onto healthy herbaceous plants (Gomphrena globosa, Chenopodium amaranticolor L., Ch. quinoa L., Datura metel L. and Nicotiana rustica) via., forefinger.

Peroxidase Isozymes
The present study was carried out using Native-Polyacrylamide Gel Electrophoresis (Native-PAGE) to detect peroxidase isozymes variation among the three Egyptian virus isolates. The enzyme was extracted from citrus leaves of the three virus isolates and separated in 9% polyacrylamide gel electrophoresis according to Stegemann et al. (1988).

The extraction buffer solutions for extract of the enzyme was prepared by dissolving 1 g tris-base (pH 7.5), 5 mL glycerol and 100 μL mercaptoethanol in 94.9 mL distilled water.

A ½mL of extraction buffer was added to each sample. The samples were centrifuged at 10000 rpm for 5 min. The supernatant was transferred into new eppendorff tubes. Forty microliter of each sample was mixed with 10 μL bromophenol blue and then loaded in each well.

Acrylamide stock solution (30%) was prepared by dissolving 30 g of acrylamide and 1 g of bis-acrylamide in 50 mL distilled water. Then the solution was completed to 100 mL by distilled water.

Tris-borate buffer (pH 8.4) was prepared by dissolving 2.12 g of tris and 0.62 g of boric acid in 50 mL distilled water. HCl adjusted the pH to 8.4. Then the solution was completed to 100 mL by distilled water.

Vertical slab gel electrophoretic apparatus was used. The gel solution was prepared by mixing the chemical components (32 mL acrylamide 30%, 26 mL TB buffer, 47 mL distilled water, 1 mL APS and 50 μL TEMED). The prepared gel solution was poured immediately between the two glass plates. The comb was placed immediately. The gel was left to polymerize.

A volume of 5 L was prepared by mixing 27.25 g tris, 8.5 g boric acid in 5 L distilled water. The apparatus was connected to the power supply (100 V). Electrophoretic apparatus was placed inside a refrigerator during running duration.

After electrophoresis, the gel was stained. The staining gel was carried out by 0.025 g of benzidine dihydrochloride was dissolved in 0.5 mL glacial acetic acid and 3:4 mL of distilled water was added in dark room. The volume was completed up to 100 mL with distilled water and poured on the gel. A half mL of H2O2 was added to the gel. The gel was left on a shaker at room temperature until the appearance of the bands (Gottlieb, 1977).

After the appearance of the enzyme bands, the reaction was stopped by washing the gel two or three times with tap water. This was followed by adding the fixative solution, which consists of ethanol and 20% glacial acetic acid (1:11), respectively. The gel was kept in the fixative solution for 24 h and then stored in the refrigerator until ready to be photographed. The gel was analyzed using AlphaEaseFC 4.0 software.

Peroxidase Activity
The peroxidase activity was directly determined of the crude enzyme extract according to a typical procedure (Hammerschmidt et al., 1982).

Total RNA Content
Nucleic acids were extracted according to the method of Marmur (1961) as modified by Mohamed and Capensius (1980). RNA determination was carried out according to the method described by Schneider (1957).

RT-PCR
Total RNAs were extracted from infected Grapefruit, Balady and Navel plants, by using High Pure RNA Tissue Kit (Roche) as described by the manufacturer.

The two sets of oligonucleotide primers used to amplify the coding sequence of CPsV 3’ end of the coat protein region were commercially obtained from OPERON (Qiagen company, 1000 Atlantic Avenue, suite 108 Alameda, CA 94501). The following RT-PCR primers (Ps66 and Ps65) were selected according to Martin et al. (2004). The Ps66 primer (TCGAAGCTGTATGATGGTGA) and Ps65 primer (TGCCATCTGGAGTGAGGCCT).

cDNA synthesis and PCR amplification were performed according to Martin et al. (2004) for PS66 and PS65 primers.

The PCR Product of the CP gene was determined by electrophoresis onto 1% agarose gel in 1XTAE to examine for the actual size of the PCR products. The gel was analyzed using AlphaEaseFC 4.0 software.

RESULTS

The CPsV-EG isolates were detected in infected citrus trees, by DAS-ELISA which gave different range with specific Mab of CPsV where, 2.204, 1.958 and 1.669 for ARC, TB and TN, respectively compared with negative 0.302-0.137 and positive DAS-ELISA control 2.248-2.213. Also, they were detected by indexing on healthy citrus Dweet tangor seedlings which gave Oak Leaf Pattern (OLP) on Dweet (Table 1, Fig. 2). On the other hand, these trees were found free from CTV (Fig. 3), CEVd and Spiroplasma citri (Fig. 4).

CpsV-EG isolates exhibited external symptoms that could be differentiated into three groups (Fig. 1):

Isolate ARC exhibited severe psorosis-bark scaling, bark lesions which appeared as pimples or small flakes of the outer bark and gum symptoms were observed on the two sides of the main trunk above grafting union
Isolate TB produced mild symptoms where bark scaling on the two sides of the trunk above grafting union and branches
Isolate TN produced no symptoms (latent) with decreasing of the fruits numbers

Table 1: Detection of CPsV infected citrus cultivars* by indexing on woody indicator plants (Dweet tangor/Volkameriana)
Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
OLP: Oak Leaf Pattern. *Six samples out of 120 samples

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 2: Oak Leaf Pattern (OLP) on Dweet tangor leaf as woody indicator plant

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 3: Immunoprinting assay for CTV detection in six citrus trees cv. Navelina, Balady and Grapefruit infected with CPsV (source of CPsV-EG isolates) using specific monoclonal antibodies against CTV

The tested citrus woody indicators (Dweet tangor, Madam vinous, New hall, Navel parent Washington, Balady, Navelina and Valencia) (Table 2) were differed in response to the three CPsV-EG isolates. These isolates were differentiated from each other through the symptoms initiated into various woody indicator plants and different incubation periods. Oak leaf pattern developed on Dweet, New hall, Navel and Valencia inoculated with the three isolates but were differed in incubation periods. On the other hand, oak leaf pattern developed on Balady inoculated with the isolates ARC and TB except isolate TN non-symptoms developed. Shock symptoms developed on Madam vinous inoculated with the isolates ARC and TB except isolate TN non-symptoms developed.

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 4: Diene’s stain for Spiroplasma citri detection showing: (A) Healthy petiole and blade in which the xylem and phloem remains unstained and (B) infected petiole and blade (positive control) containing Spiroplasma citri in which the xylem colored bright turquoise blue and the phloem stained a distinct blue

Table 2: Response of woody indicators to graft inoculation with three CPsV-EG isolates from different locations
Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
aField inspections symptoms. bBark scaling and gum symptoms were observed on the trunk on the 2 sides of the main trunk (severe). cBark scaling was observed on the trunk and branches on the 2 sides of the tree (mild). dTree symptomless with decreasing of fruits (Latent). Six samples were tested from isolates, +: Response (OLP), ++: Sensitivity (shock), +++: Hypersensitivity (OLP and shock), -: No response (non symptoms)

Oak leaf pattern and shock symptoms developed on Navelina inoculated with ARC while isolate TB and TN developed oak leaf pattern differed in incubation periods. These results were confirmed serologically by DAS-ELISA against specific CPsV Mab where as DAS-ELISA gave positive results.

On the other hand, the three CPsV-EG isolates reacted with different responses at 28±2°C under greenhouse conditions on 5 host plants belonging to 3 families (Table 3) as follow; Gomphrena globosa exhibited chlorotic local lesions followed by epinesity and deformation of leaves (systemic infection) with ARC isolate whereas TB isolate exhibited chlorotic local lesions followed by epinesity only (systemic infection). On the other hand, TN isolate gave chlorotic local lesions only (local infection) after 15 days (Fig. 5).

Table 3: Comparison between the three CPsV-EG isolates
Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Three replicates of each host were mechanically inoculated by infectious sap of infected citrus plants

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 5: Leaves of G. globosa inoculated with the three CPsV-EG isolates. (A-1) ARC isolate (chlorotic local lesions), (A-2) ARC isolate (epinisty and deformation of leaves), (B-1) TB isolate (chlorotic local lesions), (B-2) TB isolate (epinisty of leaves) and (c) TN isolate (chlorotic local lesions)

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 6: Leaves of Ch. amaranticolor inoculated with the three CPsV-EG isolates. (A-1) ARC isolate (vein chlorotic local lesions), (A-2) ARC isolate (necrotic veins and rugosity) and (B) TB isolate (chlorotic local lesions)

Ch. amaranticolor L. exhibited local vein chlorotic lesions on inoculated leaves followed by necrotic veins and rugosity (systemic infection) with ARC isolate only. On the other hand, TB isolate gave local chlorotic lesions only (local infection). TN isolate developed non-symptoms (no response) (Fig. 6). Ch. quinoa L. exhibited chlorotic local lesions (local infection) with isolates ARC, TB and TN but with different incubation periods (Fig. 7). Datura metel L. exhibited chlorotic lesions (local infection) followed by deformation of leaves (systemic infection) with isolate ARC. On the other hand, exhibited local chlorotic lesions (local infection) followed by deformation of leaves (systemic infection) with isolate TB whereas, exhibited chlorotic lesions followed by necrosis (systemic infection) with isolate TN (Fig. 8).

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 7: Leaves of Ch. quinoa inoculated with the three CPsV-EG isolates. (A) ARC isolate (chlorotic local lesions), (B) TB isolate (chlorotic local lesions) and (c) TN isolate (chlorotic local lesions)

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 8: Leaves of D. metel inoculated with the three CPsV-EG isolates (A-1) ARC isolate (chlorotic local lesions), (A-2) ARC isolate (deformation of leaves), (B-1) TB isolate (chlorotic local lesions), (B-2) TB isolate (deformation of leaves), (C-1) TN isolate (chlorotic local lesions) and (C-2) TN isolate (necrosis)

Table 4: Comparison between RNA content three CPsV-EG isolates comparing with healthy
Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus

Nicotiana rustica exhibited vein clearing (systemic infection) with isolates ARC, TB and TN but with different incubation periods. These results were confirmed serologically by DAS-ELISA against specific CpsV antiserum. DAS-ELISA gave positive results with all host plants (except Ch. amaranticolor with isolate TN) inoculated with all isolates but with different ELISA reading where ARC isolate gave the highest value, then the TB isolate and the last TN isolate.

The total RNA content values in the leaves of the three CPsV-EG isolates compared with healthy are showed in Table 4. From the results, the highest value of 328 μg g-1 was recorded in ARC isolate, followed by the value of 300 μg g-1 in TB isolate. While the lowest value of 280 μg g-1 was recorded in TN isolate, compared with the value of 240 μg g-1 in healthy (Fig. 9).

The total number of peroxidase isozymes shown in all samples (ARC, TB, TN and healthy) were 7 isozymes. The healthy plant has one pattern of peroxidase isozyme (lane No. 4). The CpsV-EG isolates affect the fraction of peroxidase isozyme.

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 9: The RNA content of the three CPsV-EG isolates

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 10: SDS-polyacrylamide gel electrophoresis illustrating peroxidase isozyme of the studied CPsV-EG isolates extracted from citrus leaves. 1: ARC isolate, 2: TB isolate, 3: TN isolate and 4: Healthy

The CPsV-EG isolates (ARC, TB and TN) appeared 2 isozymes (lane No. 1, 2 and 3, respectively) but differed in density of isozyme fractions (Fig. 10). TB near to TN isolate in RF value but was differed in density of isozyme fractions. On the other hand, ARC isolate was differed from TB and TN isolates in RF and density of isozyme fractions Table 5 and Fig. 11. These results were confirmed by peroxidase activity where Citrus psorosis virus-Egyptian-infection in citrus plants altered peroxidase activity. Figure 12 showing that, the level of peroxidase activity was found to be considerably higher in infected leaves than healthy ones. Where the ARC isolate gave the highest level of peroxidase activity, then the TB isolate and the last TN isolate.

Finally, RT-PCR appeared differences between CPsV-EG isolates of PCR products (Table 6), (Fig. 13). It was found that, base number of coat protein gene ARC isolate 571 bp; TB isolate 529 bp and TN isolate 546 bp.

Table 5: Electrophoretic banding patterns of peroxidase isozymes in healthy and infected CPsV-EG isolates
Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
*Width massxheight. Fraction (%): Relative to the total protein contents in each sample. ARC isolate: Agricultural Research Center. TB isolate: Balady from Tersa. TN isolate: Navel from Tersa

Table 6: PCR products differences among three CPsV-EG isolates
Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 11: Gel documentation software analysis (AlphaEaseFC 4.0 software) showing peroxidase isozyme patterns, distance and intensity of bands for CPsV-EG isolates compared with healthy. (A) ARC isolate, (B) TB isolate, (C) TN isolate and (D) Healthy

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 12: Peroxidase activity curve showing the level of peroxidase activity in infected citrus leaves with CPsV-EG isolates and healthy

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 13: Agarose gel electrophoresis stained with ethidium bromide showing the PCR products after amplification. Arrow indicated the correct sizes of the amplified products (571, 529 and 546 bp) by using downstream and upstream primers (PS66 and PS65). Lane M: DNA molecular weight marker (100 bp ladder), Lane 1: Citrus Grapefruit leaves sample infected with CPsV-EG isolate (ARC), Lane 2: Citrus Balady leaves sample infected with CPsV-EG isolate (TB), Lane 3: Citrus Navel leaves sample infected with CPsV-EG isolate (TN) and Lane 4: Healthy citrus Grapefruit leaves sample

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 14: Gel documentation software analysis (AlphaEaseFC 4.0 software) showing scanning profile of stained agarose gel containing of PCR product of nucleic acid for CPsV-EG isolates. (A) ARC isolate, (B) TB isolate nad (c) TN isolate

Image for - Differentiation Among Three Egyptian Isolates of Citrus psorosis virus
Fig. 15: UPGMA-dendrogram based on the previous data illustrating similarity and dissimilarity distances between the studied isolates

On the other hand, it was appeared different in height of peak 253, 255 and 252 and area under peak 2783, 5100 and 4536 for ARC, TB and TN isolates, respectively. In addition, it was appeared different of band density for three isolates.

Whereas, TB isolate more density than ARC and TN isolates (Fig. 14). Finally, according to the dendrogram produced from cluster analysis based on the previous data it was found that, the studied isolates have been an average dissimilarity percentage of 68% and at this level the three CPsV-EG isolates were delimited into two distinct groups. The first group included ARC and TB isolates linked together in the same level of 33%. The second group included TN isolate in level 68% (Fig. 15).

DISCUSSION

CpsV-EG isolates were detected on the basis of biological assay which gave oak leaf pattern on Dweet tangor and serological assay using specific Mab specific CPsV by DAS-ELISA. Where ARC, TB and TN were differed in external symptoms and DAS-ELISA reading where the severe isolate (ARC) gave the highest rate (2.204), then the mild isolate (TB) (1.958) and the last latent isolate (TN) (1.669). These results are in harmony with Barthe et al. (1998) who reported that, Mabs are useful for the differential serological identification of CPsV strains. Also, these differences due to variation in the epitopes which present in the CP of different CPsV isolates (Djelouah et al., 2000; Alioto et al., 2003; Fahmy et al., 2003).

Duran-Vila et al. (1991) and El-Dougdoug et al. (1993) mentioned that, more one viroid, phytoplasma and 5 viruses affecting the genus Citrus have been described. The CPsV induced distinct symptoms in commercial cultivars. Because virus and virus like agents infected many citrus cultivars in commercial farms, the obtained samples which using for CPsV-EG isolates were examined serologically by immunoprinting, Diene’s stain and tissue print hybridization for the presence of Citrus tristeza virus (CTV), Spiroplasma citri and Citrus excortis viroid (CEVd). The results showed that, the tissues of Grapefruit, Balady and Navel samples gave negative results using specific monoclonal antibodies of CTV, Spiroplasma citri using Diene’s stain and CEVd using tissue print hybridization. These results indicate the samples were virus and virus like agents tested and infected with CPsV-EG only (El-Shorbagy, 2007).

The woody indicators (Dweet tangor, Madam vinous, New hall, Navel parent Washington, Balady, Navelina and Valencia) citrus plants were differed in response to three CPsV-EG isolates. These isolates were differentiated from each other through the symptoms initiated into various woody indicator plants and different incubation periods. These results are in agreement with Roistacher (1991) who reported that, 21 isolates of psorosis have variability in symptoms found in citron, Dweet tangor and sweet orange among the various isolates. Also, CpsV isolates frequently differ in the intensity and kind of symptoms induced in different citrus species (Derrick et al., 1988; Garcia et al., 1991a; Navas-Castillo et al., 1991, 1993; Garcia et al., 1994; Legarreta et al., 2000).

On the other hand, the three CPsV-EG isolates reacted with different responses at 28±2°C under greenhouse conditions on 5 host plants belonging to 3 families and they are differd in symptoms and incubation period.

The total RNA content values in the leaves of three CPsV-EG isolates compared with healthy are recorded where the highest value of 328 μg g-1 was recorded in ARC isolate, followed by the value of 300 μg g-1 in TB isolate. While the lowest value of 280 μg g-1 was recorded in TN isolate.

The total number of peroxidase isozyme in all samples (ARC, TB, TN and healthy) were 7 isozymes. The healthy plant has one pattern of peroxidase isozyme. The CPsV-EG isolates affect the fraction of peroxidase isozyme. The CPsV-EG isolates (ARC, TB and TN) appeared 2 isozymes but were differed in density of isozyme fractions. TB isolate near to TN isolate in RF but was differed in density of isozyme fractions. On the other hand, ARC isolate was differed from TB and TN isolates in RF value and density of isozyme fractions. These results indicated that, the number of peroxidase fractions increased in the infected plants and this due to the plant resistance could be due to increasing peroxidase fractions. Also, the level of peroxidase activity was found to be considerably higher in infected leaves than healthy ones. Whereas, the ARC isolate gave the highest level of peroxidase activity, then the TB isolate and the last TN isolate. These results are in harmony with Ali et al. (2006) who reported that, virus infection in hypersensitive host induced oxidative stress which enforces the host to produce high levels of Reactive Oxygen Species (ROS) which have high oxidative power activity to oxidize and attack any oxidisable material in infected cell and included organelles besides phenolic compounds in the cell. In addition, destroying membranes or organelles i.e., lysozyme causing flowing out of its contents due to hydrolytic enzymes which hydrolyze the bio-molecules in the cell. This finally, leads to cell death in infected area. Thus, increased cellular H2O2 levels and subsequent redox imbalances may be responsible for cell death in plants.

RT-PCR showed differences between CPsV-EG isolates of PCR products where base number of coat protein gene ARC isolate 571 bp; TB isolate 529 bp and TN isolate 546 bp. On the other hand, it was appeared different in height of peak 253, 255 and 252 and area under peak 2783, 5100 and 4536 for ARC, TB and TN isolates, respectively. These results indicated that, molecular variabilities between the three CPsV-EG isolates and this due to variability of CP and these are in harmony with Alioto et al. (2003) and Fahmy et al. (2003), who reported that, variability of the Coat Protein (CP) gene of Citrus psorosis virus (CpsV).

REFERENCES

  1. Ali, S.H., S.S. Eis and Kh. El-Dougdoug, 2006. Role of reactive oxygen species and anti-oxidants in hypersensitive local virus-infected plants. J. Agric. Sci. Mansoura Univ., 31: 6465-6480.


  2. Alioto, D., M. Malfitano, A. Troisi, A. Peluso, S. Martin, R.G. Milne, J. Guerri and P. Moreno, 2003. Variability of the coat protein gene of Citrus psorosis virus in Campania, southern Italy. Arch. Virol., 148: 2155-2166.
    Direct Link  |  


  3. Barthe, G.A., T.L. Ceccardi, K.L. Manjunath and K.S. Derrick, 1998. Citrus psorosis virus: Nucleotide sequencing of the coat protein gene and detection by hybridization and RT-PCR. J. Gen. Virol., 79: 1531-1537.


  4. Clark, M.F. and A.N. Adams, 1977. Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol., 34: 475-483.
    CrossRef  |  PubMed  |  Direct Link  |  


  5. Da Graca, J.V., R.F. Lee, P. Moreno, E.L. Civerolo and K.S. Derrick, 1991. Comparison of Citrus ringspot, psorosis and other viruslike agents of citrus. Plant Dis., 75: 616-619.


  6. Derrick, K.S., R.H. Brlansky, J.V. Da Graca, R.F. Lee, L.W. Timmer and T.K. Nguyen, 1988. Partial characterization of a virus associated with Citrus ringspot. Phytopathology, 78: 1293-1301.


  7. Djelouah, K., O. Potere, D. Boscia, A.M. D'Onghia and V. Savino, 2000. Production of monoclonal antibodies to Citrus psorosis associated virus. Proceedings of the 14th Conference on IOCV, (IOCV'00), Riverside, CA., pp: 152-158


  8. Duran-Vila, N., V. Medina, J.A. Pina, C. Ortega, M.I. Molins and L. Navarro, 1991. Growth and morphogenesis of citrus tissue culture infected with psorosis, vein enation and cachexia. Phytopathology, 81: 824-831.


  9. El-Dougdoug, K.A., A. Dawlat Salama and N.A. Attia, 1993. Detection of stubborn disease in some orange cultivars by Diene's stain and SDS-PAGE. Ann. Agric. Sci., Ain-Shams Univ., 38: 87-99.


  10. El-Shorbagy, A.E., 2007. Studies on some virus and virus-like diseases in citrus. M.Sc. Thesis, Fac. of Agriculture Al-Azhar University.


  11. Fahmy, H., A.M. Abouzeid, A.M. D'Onghia, K. Djelouah, A. Camacho and G.P. Martelli, 2002. Main graft transmissible pathogens of citrus in Egypt. Proceedings of the 3rd Workshop Gruppo di lavoro sol Miglioramento Gentetico, (GlsMG'02), Istituto Agronomico Mediterraneo di Bari, Valenzano, Italy -


  12. Fahmy, H., M. Malfitano, K. Djelouah, A.M. D'Onghia and D. Alioto, 2003. Studi di Variabilita del Gene Della Protean del Capside del Virus Della Psorosi Degli Agrumi (Cpsv) nel Miditerraneo. SOPAV., Italy


  13. Fawcett, H.S. and L.J. Klotz, 1938. Types and symptoms of psorosis and psorosis-like diseases of cirtrus. Phytopathology, 28: 670-670.


  14. Fawcett, H.S., 1932. New angles on treatment of bark diseases of citrus. Calif. Citograph, 17: 406-408.


  15. Garcia, M.L., N.B. Costa, C.M. Casafus and A.N. Sarachu, 1991. Evaluation of different citrus as psorosis disease indicators and as psorosis virus propagation hosts. Proceedings of the 11th Conference of IOCV, Florida, (IOCV'91), University of California, pp: 380-385


  16. Garcia, M.L., E. Dal Bo, O. Grau and R.G. Milne, 1994. The closely related Citrus ringspot and Citrus psorosis viruses have particles of novel filamentous morphology. J. Gen. Virol., 75: 3585-3590.


  17. Garcia, M.L., O. Grau and A.N. Sarachu, 1991. Citrus psorosis is probably caused by a bipartite ssRNA virus. Res. Virol., 142: 303-311.


  18. Garnsey, S.M., T.A. Permar, M. Cambra and C.T. Henderson, 1993. Direct tissue- blot immuno-assay (DTBIA) for detection of Citrus tristeza virus (CTV). Proceedings of the 12th Conference of IOCV, India, (IOCV'93), University of California, pp: 39-50


  19. Gottlieb, L.D., 1977. Electrophoretic evidence and plant systematics. Ann. Missouri Bot. Gardens, 64: 161-180.


  20. Hammerschmidt, R., E.M. Nukles and J. Kuc, 1982. Association of enhanced peroxidase activity with induced resistance of cucumber to Colletotrichum lagenarium. Physiol. Plant Pathol., 20: 73-82.


  21. Legarreta, G.G., M.L. Garcia, N. Costa and O. Grau, 2000. A highly sensitive heminested RT-PCR assay for the detection of Citrus psorosis virus targeted to a conserved region of the genome. J. Virological Meth., 84: 15-22.
    Direct Link  |  


  22. Marmur, G., 1961. A procedure for isolation of DNA from microorganisms. J. Mol. Biol., 3: 208-215.


  23. Martin, S., D. Alioto, R.G. Milne, J. Guerri and P. Moreno, 2002. Detection of Citrus psorosis virus in field trees by direct tissue blot immunoassay in comparison with ELISA, symptomatology, biological indexing and cross-protection tests. Plant Pathol., 51: 134-141.
    Direct Link  |  


  24. Martin, S., D. Alioto, R.G. Milne, S.M. Garnsey, M.L. Garcia, O. Grau, J. Guerri and P. Moreno, 2004. Detection of Citrus psorosis virus by ELISA, molecular hybridization, RT-PCR and immunosorbent electron microscopy and its association with Citrus psorosis disease. Eur. J. Plant Pathol., 110: 747-757.
    Direct Link  |  


  25. Milne, R.G., M.L. Garcia and O. Grau, 2000. Genus Ophiovirus. In: Virus Taxonomy- Seventh Report of the International Committee on Taxonomy of Viruses, Van Regenmortel, M.H.V. (Ed.). Academic Press, New York


  26. Mohamed, Y. and L. Capensius, 1980. Wirkuj Jvongibber ellinsame und fddilrd der ENA Wahrened des strechuj Swachstuns con Pisum sativus ZBH. Anzzenbhciol, 98: 15-23.


  27. Navas-Castillo, J. and P. Moreno, 1995. Filamentous flexuous particles and serologically related proteins of variable size associated with Citrus psorosis and ringspot diseases. Eur. J. Plant Pathol., 101: 343-348.


  28. Navas-Castillo, J., P. Moreno, J.F. Ballester-Olmos, J.A. Pina and A. Hermosa de Mendosa, 1991. Detection of a necrotic strain of Citrus ringspot in Star Ruby grapefruit in Spain. Proceedings of the 11th Conference International Org., September 7-9, 1991, Citrus Virol, pp: 345-351


  29. Navas-Castillo, J., P. Moreno, M. Cambra and K.S. Derrick, 1993. Partial purification of a virus associated with a Spanish isolate of Citrus ringspot. Plant Pathol., 42: 339-346.


  30. Roistacher, C.N., 1991. Graft-transmissible Diseases of Citrus. Handbook for Detection and Diagnosis, Rome


  31. Roistacher, C.N., 1993. Psorosis-A review. Proceedings of the 12th Conference of IOCV, (IOCV'93), CA., pp: 139-154


  32. Sambrook, J., E.F. Fritsch and T.A. Maniatis, 1989. Molecular Cloning: A Laboratory Manual. 2nd Edn., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA., ISBN-13: 9780879695774, Pages: 397
    Direct Link  |  


  33. Schneider, W.C., 1957. Colouremetric analysis of sugar. Meth. Enzymol., 3: 73-107.


  34. Praveen, S., G.A. Barthe, K.S. Derrick and Y.S. Ahlawat, 2003. Comparison of isolates of Indian Citrus ringspot virus and Citrus psorosis virus. Ind. Phytopathol., 56: 230-232.
    Direct Link  |  


  35. Stegemann, H., W. Brgermeister, A. Shah, H. Francksen and E. Krogerrechlenfort, 1988. Gel Electrophoresis Between Glass Plates in Polyacrylamide or other Gels. Righetti Vanoss, Vanderrhoffdes, Elsevier, Amesterdam


©  2022 Science Alert. All Rights Reserved