MATERIALS AND METHODS

Virus Isolation
Fifty samples of naturally infected cucumber plants (Collected from the open field of Faculty of Agriculture, Sohag University, Sohag, Egypt) generally showing mosaic, mottling and malformation were used for virus isolation. According to Koenig (1981) I-ELISA was performed on samples using polyclonal antibodies specific for CMV (Subgroup I) (purchased from Agdia Inc., USA) and zucchini yellow mosaic potyvirus (ZYMV) (purchased from AGERI, ARC, Egypt). Samples giving only CMV positive results were mechanically inoculated on Ch. amaranticolor. Local lesions produced were used as a source of single lesion isolation and virus was maintained in N. tabacum cv. White Burley under greenhouse conditions (26°C±2).

Preparing of Virus Infected Tissues
Healthy N. tabacum cv. White Burley plants (carrying 5 leaves) were mechanically inoculated with CMV isolate and kept under greenhouse conditions. Twenty days later, 200 g leaves (showing symptoms) were collected and kept at -20°C till used.

Healthy N. tabacum cv. White Burley callus cultures were prepared using 5x5 mm pieces from upper fully grown leaves as explants. Explants were disinfected (using 0.25% sodium hypochlorite) and cultured on MS medium [containing 1.0 mg benzyl adenine (BA), 2.0 mg naphthalene acetic acid (NAA), 30 g sucrose, 7.0 g agar per liter and pH was adjusted to 5.8] under conditions described by Murashige and Skoog (1962). Twenty days aged calli were inoculated with CMV tobacco infected clarified sap using sterilized syringe connected to Millipore® filter (0.45 μm). Tissues were collected 20 days post inoculation and 200 g was kept at -20°C for usage.

Virus Purification and Evaluation
CMV isolate was purified from both infected leaves and calli tissues (200 g for each) depending on a method described by Lot et al. (1972) with some modifications. Clarification step was omitted when callus tissues were used as a source for virus purification. Concerning leaves, chloroform was added to sap for clarification with rate of 1:1 (v/v) and centrifugation was performed at 3000 rpm/15 min. Supernatant was subjected to two cycles of differential centrifugation: 30000 rpm/1½ h and 3000 rpm/15 min at 4°C. Final pellets were resuspended using 2 mL of 0.005 M borate buffer containing 0.005 M EDTA (pH 9.0) for each purification source and kept at -20°C till used. Purified preparations were evaluated spectrophotometrically (using a Shimadzu UV 1201 spectrophotometer). Virus yields were estimated as described by Noordam (1973) using extinction coefficient of 5.0. Preparations were negatively stained with 2% phosphotungastic acid (PTA) according to Griffin (1990) and examined with JEOL JEM 100 CX 11 transmission electron microscope, at Electron Microscope Unite, Assiut Univ., Assiut, Egypt.

Antisera Production and Evaluation
Polyclonal antiserum produced in a New Zealand white rabbit by injecting purified virus preparation from each purification source depending on the method described by Madhubala et al. (2005) (1 mg of virus with Freund’s incomplete adjuvant, 1:1) intramuscularly six times at 10 days interval. The animal was bled 15 days after the last injection and the antiserum was collected.

Immunoglobulins G (IgGs) purification was carried out as mentioned by Clark and Adams (1977). Final dialyzed proteins were loaded on 10 mL of diethylaminoethyl (DEAE) cellulose column (Whatman Inc., USA), eluted using half strength Phosphate Buffer Saline (PBS) and collected in microtube. Absorption of fractions was measured at 280 nm and concentration of IgGs was adjusted to 1 mg mL^-1 (OD₂₈₀ = 1.46) using half strength PBS, then stored at 4°C. IgGs dilution end points were determined using I-ELISA against clarified infected tobacco sap and healthy tobacco sap was used as a control.

Confirmation of Antisera Specificity and Evaluating Detection of CMV Using IC-RT-PCR
The IC-RT-PCR was performed depending on infected tobacco leaf and callus tissues collected 20 days post virus inoculation. Immunocapturing and cDNA synthesis was carried out as described by Minafera and Hadidi (1994). The following primers (purchased from Invitrogen Corp., USA) were used for the isolation and amplification of CMV cp which were designed depending on CMV (Supgroup I) genes sequences data collected from PubMed (GeneBank) web site (http://www.ncbi.nlm.nih.gov): 5'ATGGACAAATCTGAATCAAC3' (Sense) and 5'TCAAACTGGGAGCACCCCAG3' (Antisense).

PCR was carried out according to Ghosh et al. (2002). Five microliter from resulting cDNA were transferred to tube containing 45 μL PCR reaction mixture contained primers (1 μM final concentration each), Taq DNA polymerase (1 unit), 200 μM of each dNTPs, 5 μL 10x PCR buffer (500 μM KCl, 15 mM MgCl₂, 100 mM Tris-HCl, pH 8.0), completed to 45 μL with Sterile deionized water and the reaction was overlaid with 50 μL sterilized mineral oil. PCR program was 94°C initial melting for 3 min followed by 35 cycles of 94°C/1 min, 55°C/1 min, 72°C/2 min and 72°C/10 min final extension (using PerkinElmer cetus thermal cycler, PerkinElmer Inc., USA).

For PCR product analysis, 1.5% agarose gel was used and electrophoresis was carried out in Sub-Cell DNA apparatus (Bio-Rad Lab., USA) at 80V. The gel was photographed under UV-transilluminator using a gel documentation system, band size was determined from the gel photograph using Gel-Pro Analyzer software (Media Cybernetics, USA).

RESULTS

Virus Isolation
CMV of subgroup I was isolated from naturally infected cucumber plants showing mosaic, mottling and malformation (Fig. 1A). Samples gave positive I-ELISA results ranging from 0.946 to 1.079 were mechanically inoculated on Ch. Amaranticolor leaves and gave chlorotic local lesions (Fig. 1B). Lesions were extracted and inoculated on N. tabacum cv. White Burley for propagation.

Virus Purification and Evaluation
UV absorption data show that A₂₆₀/A₂₈₀ ratio for virus purified from leaves and calli were 1.10 and 1.25, respectively. Yields were 1.74 and 2.4 mg virus/200 g infected leaves and calli, respectively.

Electron micrographs show spherical virus particles of about 30 nm in diameter (Fig. 2A and B).

Antisera Production and Evaluation
The highest titers were 1:128 and 1:512 for antisera produced using virus purified from leaves and calli, respectively (Table 1). It was observed that purified antiserum prepared from healthy leaves gave slightly higher I-ELISA readings with tobacco healthy sap compared with that of virus purified from calli.

Confirmation of Antisera Specificity and Evaluating Detection of CMV Using IC-RT-PCR
By analysis the PCR products on agarose gel, bands with the expected size of 657 bp were observed representing CMV cp (Fig. 3). Results indicated that bands produced from callus infected tissues were slightly higher in intensity compared with those of tobacco infected leaves.

Fig. 1:	CMV infected Cucumber leaf showing mosaic, mottling and malformation (A), chlorotic local lesions produced on Ch. Amaranticolor leaf 15 days post inoculation with CMV infected cucumber sap (B)

Fig. 2:	Electron micrographs of negatively stained purified virus preparations obtained from infected tobacco leaves (A) and calli (B)

Table 1:	CMV IgGs evaluation against infected and healthy tobacco sap
*Each ELISA result (R) was the average of three readings.**Reaction of crude purified virus from leaves (1) and calli (2) with crude antiserum. Reaction of infected (I) and healthy (H) tobacco leaves sap with anti-sera produced by rabbit immunization with CMV purified from leaves (IgGs1) and from calli (IgGs2) + Positive reaction, - Negative reaction

Fig. 3:	IC-RT-PCR for amplification of CMV cp from tobacco infected leaves (lanes 1 and 2) or callus (Lanes 4 and 5) tissues. Healthy leaves (Lane 3) and callus (Lane 6) as a controls. M: Lambda DNA/EcoRI+HindIII marker (Promega, USA)

DISCUSSION

CMV has a relatively wide host range, giving systemic symptoms on cucumber plants and can be isolated from single local lesions produced on mechanically inoculated Chenopodium leaves (Palukaitis et al., 1992; Madhubala et al., 2005). Also ELISA and electron microscopy can be used as a helpful tool to confirm isolation success after biological studies (Honda and Matsui, 1973; Raj et al., 2002; Madhubala et al., 2005).

Tissue culture has one valuable advantage as it can be used for propagation and preservation of plant viruses, avoiding isolates contamination under greenhouse conditions (El-Afifi et al., 2003 b).

The virus under study was purified from tobacco leaves and calli, results showed that purified preparation obtained from calli was relatively higher in both purity and yield. It was found that CMV can be purified from tobacco callus tissues without passing with the clarification step representing another advantage of tissue culture in virus studies. Also less plant components were observed in electron micrographs of calli purified CMV preparations compared with that purified from leaves. Such results were in harmony with those of PVY and ToMV found by El-Afifi et al. (2003 a,b).

Callus is a less complicated plant tissue compared with leaves, containing less plant inhibitors and components (Kassanis, 1967). Ikeda et al. (1987) found that roots, leaves and stems of Mirabilis jalapa showed high inhibitory activity against plant viruses compared with cultured cells. Duran-Vila et al. (1989) proved that infected citrus callus is a good host system for virus replication and purification.

Data of antisera production showed that antiserum produced from calli purified viral preparation was highly specific since it gave much weaker reaction with healthy tobacco sap. Antiserum of callus viral preparation has higher titer (1:512) compared with antiserum of leaves viral preparation which has a titer of 1:128. Similar trend was also found by Lyal and Gorbunova (1992) as they succeeded in producing highly specific antiserum for soybean mosaic virus using clarified sap of infected soybean tissue culture. El-Afifi et al. (2003b) produced antisera of higher titer and specificity for PVY and ToMV which were purified from infected tobacco callus tissues.

CMV infected tobacco callus culture can gave a clean medium for viral molecular studies, genes isolation and amplification. The cp gene of CMV was successfully amplified from infected tobacco callus tissues by IC-RT-PCR. Agarose gel electrophoresis result revealed the expected band size of 657 bp representing CMV cp gene. Some investigators detected virus genes in plant tissue culture by means of molecular protocols (Eggenberger et al., 1989; Covey and Turner, 1993; Pelah et al., 1994).