Correlation Between Environmental and Intestinal Clostridium perfringens Isolated from Different Chicken Flocks

Bastamy, Mustafa; Raheel, Ismail; Yehia, Marwa; Hamoud, Mohamed; Noseir, Shahien; Khalifa, Rabab; Ibrahim, Samar; Hammad, Enas; Elebeedy, Lamiaa; Abdel-Latif, Mervat; Elbestawy, Ahmed; Orabi, Ahmed

ABSTRACT

Background and Objective: Clostridium perfringens is a major enteric pathogen of poultry causing necrotic enteritis (NE). Both clinical and subclinical forms of NE are associated with a huge economic loss, so it is very important to detect and study the correlation between environmental and intestinal C. perfringens isolated from different origins in poultry farms. Materials and Methods: A total of 20 intestinal samples were collected from 20 different commercially diseased poultry flock in Egypt, as well as 10 environmental samples from 10 of the 20 farms that had clinical NE. Statistical package for the social sciences was used for cluster analysis and dendrogram construction. Similarity index between all samples was calculated using the online tool. Results: The bacterial susceptibility patterns of both environmental and intestinal isolates showed high resistance index of 100% against streptomycin sulphate, sulfamethoxazole+trimethoprim, tetracycline and spectinomycin. The resistance reached 70 and 100% to ampicillin and cefotaxime: 50 and 80% to amoxicillin: 65 and 70% to bacitracin for intestinal and environmental C. perfringens isolates, respectively, while the lowest resistance (27%) was to penicillin V. Using cPCR, all isolates carried α toxin gene, while 60 and 25% of intestinal C. perfringens harbored netβ and β-lactamase (bla), meanwhile, 40 and 60% of environmental C. perfringens were positive for netβ and bla genes, respectively. Conclusion: The results of RAPD analysis, similarity index and dendrograms for 4 environmental and intestinal C. perfringens isolates (with bla gene) showed high similarity mainly with the same ancestor of environmental origin, which may explained that contamination with C. perfringens in the environment acts as a source of horizontal bla gene transfer between different C. perfringens strains within poultry farms.

PDF Abstract XML References Citation

INTRODUCTION

Poultry all over the world are susceptible to acute clinical or subclinical necrotic enteritis (NE) due to C. perfringens infection. In the global poultry sector, NE causes annual economic losses of US $6 billion¹. Acute NE increases broiler flock mortality by around 1% per day, especially during the last weeks of rearing. On the other side, the subclinical form increases the intestinal mucosal damage leading to significant reduction in digestion, absorption and body weight gain and increased feed conversion ratio (FCR)². Moreover, higher condemnation rates at processing plants are mostly associated with cholangiohepatitis during the subclinical coarse of NE. Also, one of the most frequently isolated bacterial pathogens in foodborne disease outbreaks in humans is C. perfringens of poultry origin that poses a risk for transmission to humans through the food chain³.

There are many sources of contamination associated with C. perfringens disease outbreaks such as feed, water, litter or environment of the broiler barns⁴. Not only, the presence of C. perfringens in the intestinal tract of broiler chickens or inoculation with high doses of C. perfringens are essential for the development of NE, but also one or several predisposing (stress) factors may be involved to elicit its clinical signs and lesions⁵. Among the toxigenic clostridial species (C. perfringens, C. botulinum, C. difficile and C. tetani), the sporulated form of C. perfringens is the paradigm species for genetic studies, because of its oxygen tolerance and fast growth rate (8-10 min generation time in optimal conditions). Many of the toxins and enzymes it produces have been studied and most of their structural genes have been cloned and sequenced. Other approaches, such as physical and genetic mapping, have also been used to elucidate the genomic structures of various C. perfringens strains⁶.

It is necessary to detect major toxins in the gut, blood stream, serous exudates of affected animals and culture supernatant fluids in order to determine the type of C. perfringens. In serum neutralization test, the standard assay is performed in guinea pigs or mice which is increasingly undesirable due to expense, complexity, disfavor on humanitarian ground and lack of sensitivity and specificity⁷. Recently, polymerase chain reaction (PCR) based DNA amplifications of the toxin genes, α, β, ε, ί and netβ, were developed for rapid and accurate diagnosis of enterotoxaemia and different types of C. perfringens⁸.

In literature research, it has been demonstrated that horizontal gene transfer via plasmids and other extra-chromosomal elements can convert nontoxigenic C. perfringens strains into toxin producers. Several studies have been conducted using the transformable C. perfringens strain to study the genetic regulation of the toxin genes. As compared to other well-studied pathogenic bacteria, the pathogenicity and physiology of C. perfringens is still poorly understood^4,6,9. So, the main goal of the present study was to investigate the correlation between C. perfringens isolates from environmental and intestinal origin, the presence of their toxin genes and to test their sensitivity to different antibiotics.

MATERIALS AND METHODS

Ethical approval: All tests and procedures were approved by the local legalization and ethics committee of the institutional animal care and use committee, complying with the general guidelines of Beni-Suef University. All efforts were made to minimize the suffering of animals under study (BSU-IACU/ http://www.bsu.edu.eg).

Clostridium perfringens characterization: Twenty intestinal (duodenal) samples from 20 different commercial diseased chicken flocks suffered from clinical NE in Egypt (10 from broilers, 7 from layers and 3 from breeders) as well as 10 environmental samples (litter n = 6 and ration n = 4) were randomly collected from 10 out of the 20 farms. Complete isolation and identification of C. perfringens was carried out on perfringens agar base with tryptose sulphite cycloserine (TSC) supplement^10,11.

Antibiotic resistance profile: The susceptibility of the C. perfringens isolates to 16 antimicrobials was demonstrated based on the agar disc diffusion method. Single colonies were inoculated in Robertson's Cooked Meat Medium (RCM) with paraffin liquid seal and kept at 41°C. Three hundred microliter of the supernatant bacterial culture was spread evenly on Mueller-Hinton agar (MHA) (Oxoid, Hampshire, UK) and 16 antibiotic susceptibility discs (Oxoid, Hampshire, UK) were placed on the medium, cultured anaerobically at 41°C for 24 hrs. The antimicrobials used included cefotaxime (30 μg), amoxycillin (10 μg), ampicillin (10 μg), penicillin V (10 UI), erythromycin (15 μg), tylosin (30 μg), kanamycin (30 μg), streptomycin (10 μg), tetracycline (30 μg), lincomycin (10 μg), spectinomycin (10 μg), bacitracin (10 UI), difloxacin (5 μg), flumequine (30 μg), metronidazole (5 μg) and sulfamethoxazole+trimethoprim (25 μg). Diameters of the inhibition zones were measured and the determination criteria as described by Wu et al.¹² for drug resistance was shown in supplementary Table S1.

Toxins and β-lactamase genes screening using uniplex conventional polymerase chain reaction (cPCR): After DNA extraction of all the 30 samples by boiling¹³, Alpha toxin primer sequence F: GTTGATAGCGCAGGACATGTTAAG, R: CATGTAGTCATCTGTTCCAGCATC¹⁴ and netβ toxin primers sequence F: CGCTTCACATAAAGGTTGGAAGGC, R: TCCAGCACCAGCAGTTTTTCCT¹⁵, bla (β-lactamase resistance genes) primer sequence F: ATGAAAGAAGTTCAAAA ATATTTAGAG, R: TTAGTGCCAATTGTTCATGATGG were used¹⁶. Bands were fractionated by electrophoresis on a 1.2% agarose gel (2 hrs, 5V cm^–1, 0.5XTris-borate buffer) and visualized by ethidium bromide staining.

Random amplification of polymorphic DNA (RAPD) analysis of environmental and intestinal C. perfringens isolates: According to Xiao et al.¹⁷, RAPD primer sequence: GTGGTGGTGGTGGTG, uniplex PCR was used for studying the molecular relation between 4 environmental and 4 intestinal C. perfringens that were carrying bla gene. Enterobacterial repetitive intergenic consensus (ERIC) fingerprinting data were transformed into a binary code depending on the presence or absence of each band.

Dendrograms were generated by the unweighted pair group method with arithmetic average (UPGMA) and Ward’s hierarchical clustering routine. Dendrogram produced by cluster analysis of ERIC-PCR sequences was used as a simple tool for molecular epidemiology of clostridium isolates. Statistical package for the social sciences (SPSS), version 22 (IBM 2013) was used for cluster analysis and dendrogram construction¹⁸. Similarity index generated by the unweighted pair group method with arithmetic average (UPGMA) and Ward’s hierarchical clustering routine. Dendrogram produced by cluster analysis of ERIC-PCR sequences was used as a simple tool for molecular(Jaccard/Tanimoto Coefficient and number of intersecting elements) between all samples was calculated using the online tool https://planetcalc.com/1664/).

RESULTS

There was a high resistance index of 100% against streptomycin sulphate, sulfamethoxazole+trimethoprim, tetracycline and spectinomycin in the examined intestinal and environmental C. perfringens type A isolates. Resistance to lincomycin, erythromycin, flumequine and difloxacin were 100% in all the environmental isolates and the intestinal isolates from breeder chickens only. Regarding ampicillin and cefotaxime, the resistance reached 70, 100%, 50, 80% to amoxicillin and 65, 70% to bacitracin for intestinal and environmental C. perfringens isolates, respectively; while for tylosin, the resistance reached 40, 33% for intestinal isolates from broilers and broiler breeders, respectively as compared to 100% for both environmental and intestinal C. perfringens isolates from layer chickens. However, the intestinal and most of the environmental isolates were highly sensitive to penicillin V (73%) (n = 22/30) followed by moderate sensitivity to kanamycin (50%) (n = 15/30) and metronidazole (47%) (n = 14/30), (Table 1-3).

On the other hand, the results of toxins and β-lactamase genes screening using uniplex cPCR revealed that 100% of intestinal and environmental C. perfringens isolates have α toxin gene, while 60% of intestinal C. perfringens carried netβ (n = 12/20) and 25% had bla gene (n = 5/20). Meanwhile, 40% of environmental C. perfringens had harbor netβ (n = 4/10) and 60% had harbor bla gene (n=6/10) as mentioned in Table 4. Figure 1 and 2 showed high similarity between A/C (broiler origin isolate code 1/ layers origin isolate code 15), B/E (broiler origin isolate code 6/ litter origin isolate code 4) and F/G/H (litter origin isolate code 6/ ration origin isolate code 7/ ration origin isolate code 10), mainly with the same ancestor which originated from environmental source.

International Journal of Poultry Science

Research Article

**Correlation Between Environmental and Intestinal Clostridium perfringens Isolated from Different Chicken Flocks**

ABSTRACT

How to cite this article

Search

INTRODUCTION

MATERIALS AND METHODS

RESULTS