

Ovarian cancer is one of the cancers prevalent throughout the world with a very high mortality rate. It is most prevalent among non-Hispanic white women1. Ovarian cancer originates from both form epithelial and non-epithelial cells among which epithelial origin dominates2. A variety of factors contribute to the development of ovarian cancers which include, oral contraceptives, lack of pregnancy, delayed childbirth, pelvic inflammatory diseases, endometriosis, ovarian cysts, tubal ligation etc. A considerable number of ovarian cancers displays a germline mutation in BRCA, a gene that functions as tumour suppressor genes3. A variety of treatment strategies have been followed to treat ovarian cancer. Cisplatin, paclitaxel, doxorubicin is some chemotherapeutic agents being used for the treatment of ovarian cancer. However, ovarian cancer cells exhibit drug resistance as well. Drug efflux through ABC transporters and other non-ABC transporters results in the development of drug-resistant cancer cells. On the other hand, inducing apoptosis is another strategy followed to eliminate cancer cells.
Triphala churna is an Ayurvedic preparation in which three different fruit powders are mixed in equal proportion. The three plants include Emblica officinalis Gaertn., Terminalia bellerica Roxb. and Terminalia chebula Retz. Recent research on Triphala churna has revealed that the preparation is beneficial against a wide variety of diseases. Triphala churna has been shown to improve nephropathy by inhibiting TGFβ1 and recovering from oxidative stress in rodent model4. Triphala churna has been shown to have a strong anti-diabetic effect by improving the activities of pancreatic β cells. The treatment improved insulin secretion through glucose-dependent insulin-promoting polypeptide. Triphala churna also improves the activity of incretin-cAMP signaling5. Triphala churna has also been effective in ameliorating arthritis by suppressing the NfκB pathway in macrophages6.
Several strategies have been followed for treating ovarian cancers. PARP inhibitors7, aromatase inhibitors8, MEK inhibitors9 are some examples. In addition, anti-angiogenic agents such as monoclonal antibodies, small molecules are also effective against ovarian cancer. Radiotherapy is also being practised to control ovarian cancer. However, all these methods have a wide range of adverse effects. Natural products are being screened for their activity against ovarian cancer. Extracts of Camptotheca acuminate, Allium sativum, Quercus tinctoria asparagus racemosus, Curcuma longa, Saraca indica, Azadirachta indica, Carica papaya, Geissospermum vellosii, Vernonia calvoana have shown potent anti-cancer activity against ovarian cancer. Plant extracts tend to have very limited adverse effects. Therefore, this study aimed to evaluate the effect of Triphala on ovarian cancer.
Study area: The study was carried out at the Department of Operating Room, the People's Hospital of Jiyang, Jinan, Shandong Province and China from February-May, 2021.
Source of chemical and reagents: Dulbecco’s Modified Eagle’s Medium, streptomycin, penicillin-G, L-glutamine, phosphate-buffered saline, 3-(4,5 dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide, 2’7’diacetyl dichlorofluorescein, sodium dodecyl sulphate, trypan blue, trypsin-EDTA, ethylene diamine tetraacetic acid, acridine orange, ethidium bromide, rhodamine-123, triton X-100, ethanol, Dimethyl Sulfoxide (DMSO) and bovine serum albumin were purchased from Sigma Aldrich Chemicals Pvt. Ltd.
Preparation of Triphala: A total of 10 g of each of the plant powder (T. chebula, E. officinalis and T. bellerica) in a ratio of 1:1:1 was dissolved in 10 mL Sterile Milli Q water, boiled in the water bath at 100°C for 1 hr. The boiled extract was cooled and centrifuged at 5000 rpm for 10 min, the pellet was discarded and the supernatant was stored at 4°C for further assays.
Cell culture maintenance: Human ovarian cancer PA-1 cell line was procured from the Cell repository of American Type Culture Collection (ATCC). Dulbecco`s Modified Eagle Media (DMEM) supplemented with 10% Fetal Bovine Serum (FBS), Penicillin (100 U mL1) and streptomycin (100 μg mL1) was used for maintaining cell line. The cell line was maintained in a humidified environment with 5% CO2 at 37°C.
MTT assay: The cytotoxicity of Triphala on PA-1 cells was determined by the method of Sylvester10. Cell viability assay, PA-1 viable cells were harvested and counted using a hemocytometer (Winstar Co Ltd, Shenyang, Liaoning, China) diluted in DMEM medium to a density of 1×104 cells mL1 was seeded in 96 well plates for each well and incubated for 24 hrs to allow attachment. After PA-1 cells were treated with control and the containing different concentrations of Triphala (50-350 μg mL1) were applied to each well. PA-1 cells were incubated at 37°C in a humidified 95% air and 5% CO2 incubator for 24 hrs. After incubation, the drug-containing cells wash with a fresh culture medium and the MTT (5 mg mL1 in PBS) dye was added to each well, followed by incubation for another 4 hrs at 37°C. The purple formazan crystal formed was dissolved in 100 μL of DMSO was measured at 540 nm using a multi-well plate reader. The results were expressed at the percentage of viable cells to the control. The concentration of the drug that gives half-maximal inhibitory effect (IC50) values were calculated and the optimum doses were analyzed at different periods.
![]() |
The IC50 values were determined from the Triphala dose-responsive curve where inhibition of 50% cytotoxicity compared to control cells. All experiments were performed three times in triplicate.
Measurement of reactive oxygen species (ROS): Intracellular ROS level was measured by Dichloro-Dihydro-Fluorescein Diacetate (DCFH-DA) assay. DCFH-DA is a lipophilic, cell-permeable compound that is deacetylated in the cytoplasm to FDCF by cellular esterase11. DCF was oxidized by radicals such as hydroxyl, peroxyl, alkoxyl, nitrate and carbonate to a fluorescent molecule at excitation 530 nm and emission 485 nm. DCF was not oxidized by hydrogen peroxide or superoxide radical. After PA-1 cells were seeded in 6 well plates (2×106 cells well1) for 24 hrs before exposure and different concentrations of the Triphala (200 and 250 μg mL1) and untreated cells were maintained at 37°C (5% CO2). Overnight grown PA-1 cells were transferred to 24 well plates for 24 hrs. After exposure of Triphala (200 and 250 μg mL1) to PA-1 cells were washed by PBS and loaded with 25 μM DCFH-DA in DMEM for 30 min at 37°C. The treated cells were washed with DMEM and fluorescent was recorded every 5 min in over 30 min at excitation 485 nm and emission 535 nm by spectrofluorimetry at 37oC. ROS increase was calculated by mean slope per min of treated cells and normalized to control.
Measurement of apoptotic induction using acridine orange/ethidium bromide (AO/EB) dual staining method: The fluorescence microscopic analysis of apoptotic cell death was carried out by combining the methods explained by Mironova12 and Smith et al.13 PA-1 cells were seeded at 5×104 cells well1 in a 6 well plate and incubated for 24 hrs. At the end of treatment with Triphala, the cells were collected and washed three times with PBS.
Table 1: List of primers and sequence | |||||
Forward (5'–3') | Reverse (5' –3') | ||||
cMyc | TCTCCGTCCTCGGATTCTCT | TGAGCTCCCAAATCTCTCCAG | |||
BAX | CGTGTCTGATCAATCCCCGA | GAGGCCAGAAGGCAGGATTG | |||
B-actin | TCAAGGTGGGTGTCTTTCCTG | ATTTGCGGTGGACGATGGAG |
The plates were stained with acridine orange/ethidium bromide (AO/EB 1:1 ratio; 100 μg mL1) for 5 min and examined immediately under fluorescent microscope 40x magnification. The numbers of apoptotic cells were counted in the field.
Cell adhesion assay: Cells were treated with different doses of Triphala for 48 hrs and gently washed and stained with 0.2% of crystal violet in 10% formalin solution. After the removal of the staining solution, the cells were washed 3X with Phosphate-Buffered Saline (PBS) and air-dried and observed under an inverted microscope14 (Biobase Meihua trading Co. Ltd., Jinan, Shandong, China).
Polymerase chain reaction: DNA isolation was done using a Nucleospin DNA isolation kit (MACHEREY-NAGEL GmbH and Co. KG, Duren, Germany) following the manufacturer’s instructions. PCR was performed using thermal cycler gradient PCR (Hangzhou Bioer Technology Co., Ltd, Hangzhou, Zhejiang, China). Reactions were performed in a volume of 25 μL with the following constituents: 4.5 μL of template DNA, 12.5 μL of 1XPCR Emerald master mixture. About 1 μL each of the specific primers were added and made up with the remaining volume of Milli Q water. The amplification program consisted of 1 cycle at 95°C for 2 min for initial denaturation, 95°C for 1 min for DNA denaturation followed by annealing at respective temperatures (β-Actin: 54°C; cMyc: 59.6°C; Bax 54.3°C) for 30 sec for annealing and 72°C for 1 min for extension of two strands, 72°C for 5 min for a final extension. The same condition followed for 34 cycles. The list of primers and their sequence is given in Table 1. The PCR products were analysed on a 1.0 % agarose gel containing 1 mg mL1 ethidium bromide, 6 μL of the PCR products with 4 μL of 6X gel loading dye were loaded into wells and electrophoresis was performed in 1 X TAE buffer at 50 V for 2 hrs. The gel was visualized under UV and photographed.
Cell viability: Triphala being an Ayurvedic preparation we attempted to evaluate its effect on ovarian cancer cells in vitro. To evaluate the effect of Triphala MTT assay was performed. Ovarian carcinoma cells were treated with various concentrations of Triphala. (50, 100, 150, 200, 250, 300 and 350 μg) Cell viability decreased with increasing concentrations of Triphala (Fig. 1). A dose-dependent decrease in cell viability proved the anti-cancer potential of Triphala.
![]() |
Fig. 1: | Cell viability in control and Triphala treated human ovarian cancer PA-1 cells for 24 hrs A dose-dependent decrease in cell viability proved the anti-cancer potential of Triphala |
![]() |
Fig. 2(a-c): | Morphological changes in control and Triphala treated human ovarian cancer PA-1 cells for 24 hrs Above-mentioned features are a typical characteristic of apoptosis. The same features could also be observed in the same cell lines which were treated with Triphala at a concentration of 200 μg mL1 for 24 hrs but to a lesser extent than 250 μg mL1. The number of cells also decreased in a dose-dependent manner |
Morphometry: Cell viability assay revealed its strong anti-cancer activity. The anticancer activity is through induction of apoptosis. Apoptosis is apparent from the morphological changes in an ovarian cancer cell line. Treatment of PA-1 cells with Triphala at a concentration of 250 μg mL1 for 24 hrs, could induce characteristic changes in morphology. The cells underwent shrinkage and subsequently got detached. Moreover, membrane blebbing was also visible under a light microscope (Fig. 2a-c). The above-mentioned features are typical characteristics of apoptosis. The same features could also be observed in the same cell lines which were treated with Triphala at a concentration of 200 μg mL1 for 24 hrs but to a lesser extent than 250 μg mL1. The number of cells also decreased in a dose-dependent manner.
Measurement of ROS: To evaluate if there is any involvement of reactive oxygen species did a qualitative assay for the presence of ROS. The cells were stained with fluorescent dye DCFH-DA and visualized under a microscope. Treatment of PA-1 cells with Triphala induces ROS accumulation in the cells. Figure 3a-c, there was a dose-dependent increase in the intensity of fluorescence within the cells. The intensity of fluorescence is directly proportional to the amount of ROS.
![]() |
Fig. 3(a-c): | Effects of Triphala on the intracellular ROS generation in PA-1 cells by DCFH-DA staining assay There was a dose-dependent increase in the intensity of fluorescence within the cells. The intensity of fluorescence is directly proportional to the amount of ROS |
![]() |
Fig. 4(a-c): | Effect of Triphala on on the apoptotic incidence in PA-1 cells Dense green spots indicate nuclear condensation which is an indication of apoptosis |
![]() |
Fig. 5(a-c): | Effects of Triphala on the Cell adhesion of PA-1 cells These results imply that the adherence of cells was abrogated by the treatment with Triphala |
Induction of apoptosis by Triphala: To evaluate whether Triphala induces apoptosis we performed AO/EB staining. The control cells stained uniformly green with sporadic orange colours indicating that most of the cells are alive and healthy with occasional necrotic cells. At a 200 μg mL1 concentration of Triphala more cells stained with dense green spots could be observed. Further, at 250 μg mL1 concentration of Triphala, intensely stained green coloured cells could be seen with a few orange colour stained cells (Fig. 4a-c). Dense green spots indicate nuclear condensation which is an indication of apoptosis.
![]() |
Fig. 6(a-c): | Effect of Triphala on apoptotic related gene expression of PA-01 cell line, (a) Bax gene, (b) c-Myc and (c) Beta-actin. The expression cMyc was inhibited by Triphala in a dose-dependent manner. On the other hand, pro-apoptotic gene Bax was overexpressed by Triphala in a dose-dependent manner |
Effect of Triphala on cell adhesion: The cells upon treatment with Triphala lost the ability to adhere to the surface of the wells in 96 well plates. The number of cells attached to the surface of the plate decreased in a dose-dependent manner. Less number of cells stained with crystal violet was observable in the cells treated with Triphala at a concentration of 200 μg mL1. The cells treated with 250 μg mL1 of Triphala had a much lesser number of stained cells (Fig. 5a-c). These results imply that the adherence of cells was abrogated by the treatment with Triphala.
Evaluation of molecular mechanism of apoptosis by Triphala: Assessment of the mechanism of anti-cancer activity and induction of apoptosis was done by PCR. Gene-specific primers were used for amplifying the genes. The expression pro-apoptotic gene Bax was overexpressed by Triphala in a dose-dependent manner (Fig. 6a). On the other hand, cMyc was inhibited by Triphala in a dose-dependent manner (Fig. 6b).
Ovarian cancer is one of the most prevalent cancers. Though a variety of treatment strategies are being followed, adverse effects limit the effective clinical applications of the current treatment regimen. Plant extracts and preparations of folk medicines are being attempted for re-purposing against cancers and other diseases since they have limited adverse effects15,16. Ayurveda is one of the oldest medical practices having its origin in India. Triphala is one of the Ayurvedic preparations which are a combination of three different plants which has a wide application. In the current work, we attempted to evaluate the effect of Triphala against ovarian cancer. We used PA-1, an ovarian cancer cell line to study the effect of the preparation, for its anti-cancer potential.
MTT assay revealed that Triphala had strong inhibitory activity against the PA-1 cancer cell line. Triphala preparation showed inhibitory activity in a dose-dependent manner (Fig. 1). Only 28% of the cells were viable at a concentration of 350 μg mL1. At concentrations of 200 and 250 μg mL1 54 and 46% of the cells were viable receptively. Therefore, we took these two concentrations for our further studies as these two concentrations are near to IC50.
Microscopic examination was done for the above-mentioned concentrations for the morphological changes. In line with the results from the MTT assay, there were morphological changes indicative of apoptosis was observable. The number of cells declined in a dose-dependent manner and parallel morphological changes could also be observed. Shrinkage of cells, blebbing of the cell membrane, cellular detachment and distorted cell shape were the changes in a cell in response to Triphala treatment. Overall, these morphological changes indicated the possible involvement of apoptosis. In addition, we also observed the loss of adhesion of PA-1 cells upon treatment with Triphala (Fig. 5). Loss of adhesion could also trigger apoptosis.
To further confirm the involvement of apoptosis we performed AO/EB staining. Acridine orange stains the nucleic acid and reveals the integrity of the nucleus of the target cell. The control cells displayed a normal staining pattern which could be interpreted that the cells are alive and healthy. On the other hand, cells undergoing apoptosis loses the integrity of the nuclear membrane and chromatin condensation. Triphala treatment-induced chromatin condensation and allowed the passage of ethidium bromide which was stained in orange colour which was much pronounced in 250 μg mL1 of Triphala. Therefore, it is confirmed that the Triphala induced cell death through triggering apoptosis.
Since Triphala induced cell death via apoptosis we investigated the cause. Accumulation of ROS is one of the triggering factors for apoptosis. Therefore, we assessed the involvement of ROS by staining the cells with DCHF-DA and observed them under the fluorescence microscope.
Interestingly, we observed moderate fluorescence at 200 μM of Triphala and a much stronger green fluorescence at 250 μM of Triphala. Overall, staining with DCHF-DA revealed the involvement of reactive oxygen species in a dose-dependent manner. Triphala-induced apoptosis in ovarian cancer cells could likely have been mediated by elevated reactive oxygen species. This view is in line with earlier findings that ROS could mediate apoptosis17-19.
We further evaluated the mechanism of Triphala mediated cancer arrest. Gene expression analysis was done to elucidate the molecular mechanism of action of Triphala on ovarian cancer. cMyc is a proto-oncogene and activates several transcription factors. This gene is involved in triggering several cancers including ovarian cancer. This gene is also involved in the maintenance of cancer20. One of the strategies of targeting cancer is through suppression of cMyc21. Therefore, we checked for the expression level of the cMyc gene by PCR. Our results revealed the dose-dependent suppression of cMyc. cMyc was strongly down-regulated by a higher dose of Triphala whereas a milder suppression of the gene was observable in a low dose of Triphala.
To further evaluate if Triphala triggers apoptosis in cancer cells, we estimated the expression of the Bax (Bcl-2 associated protein X) gene. Bax is one of the pro-apoptotic genes belonging to the Bcl2 gene family. Bax interacts with Bid (BH3 interacting-domain death agonist) to result in apoptosis22. Triggering of apoptosis is essential for an anti-cancer agent since it does not trigger an inflammatory response. Our results indicate that Triphala induces Bax to cause apoptosis.
Our results indicate that Triphala could be a potential anti-cancer drug, especially for ovarian cancer. Our MTT assay revealed that the Ayurvedic preparation causes cell death in ovarian cancer cells. Further, morphological changes indicated the involvement of apoptosis and fluorescence imaging demonstrated the induction of oxidative stress in a dose-dependent manner. AO/EB staining confirmed the involvement of typical signs of induction of apoptosis. Moreover, treatment with Triphala inhibited cell adhesion as revealed by the light microscopy. At the molecular level, suppression of cMyc by Triphala was confirmed while induction of Bax. Overall, our study reveals Triphala could be used for treating ovarian cancer.
The present work explored the effect of Triphala, an Ayurvedic preparation, on ovarian cancer. Triphala significantly induced apoptosis in ovarian cancer cells in vitro as evidenced by elevated expression of Bax. Triphala-mediated oxidative stress contributed to the induction of apoptosis.