Submit Manuscript

International Journal of Pharmacology

Year: 2021 | Volume: 17 | Issue: 5 | Page No.: 281-291
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
Research Article

Bupropion Inhibits Oxidant Status and Inflammation in Ethanol-Induced Chronic Gastritis in Rats

Ali Tureyen Ali Tureyen's LiveDNA and Sinan Ince

ABSTRACT

Background and Objective: Chronic gastritis, today, is a significant disorder amongst chronic gastritis digestive system diseases manifesting itself as anorexia and stomach ache. Despite it is known that dopamine antagonists induce ulcers and dopamine agonists to help to treat ulcers the protective effects of bupropion on ethanol-induced gastritis were not clarified completely. This study was conducted to assess the potential protective activity of bupropion on ethanol-induced chronic gastritis. Materials and Methods: Chronic gastritis model was established by administering 56% ethanol to rats for four weeks. Bupropion (30 and 60 mg kg–1) was orally administered for seven days to assess the healing effect. Results: At the end of the study, the changes in biochemical, histopathologic and proinflammatory cytokines showed that bupropion healed ethanol-induced gastritis. Conclusion: The study findings showed that bupropion suppressed lipid peroxidation and inflammatory response, on the other hand, relieves chronic gastritis effectively by increasing activation of the antioxidant system.
PDF Abstract XML References Citation
Copyright: © 2021. This is an open access article distributed under the terms of the creative commons attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.

INTRODUCTION

Alcohol consumption and use of nonsteroidal anti-inflammatory medicines increase bleeding risk in the upper parts of the digestive system1,2. Gastritis and gastric ulcers usually appear as a result of unbalancing between gastric mucosal protective factors and abrasive-aggressive factors mucus encountered. Gastric Hydrochloric Acid (HCL) secretion, reactive oxygen radicals, mucosal hypoperfusion and alcohol consumption may be given as samples amongst aggressive factors3. Amongst them, alcohol consumption is the most essential factor that contributes to gastric ulcer formation and excessive alcohol consumption increases the risk of gastric mucosal damage4. Alcohol intake intervenes in the secretion of cyclooxygenase (COX) in stomach mucus, cytokines and free radicals derived from oxygen and hence this damages stomach mucus directly and indirectly. For this reason, ethanol-induced gastric mucosal damage models is a model frequently used to investigate factors causing human gastric ulceration and materials having anti-ulcer activity5.

Antidepressant medications are used to treat various non-psychological disorders since the 1950s as well as psychiatric diseases6,7. Most antidepressant medications (fluoxetine, doxepin, maprotiline, mianserin, trimipramine, idazoxan, monoamine oxidase b inhibitors etc) has been shown experimentally to prevent ulcer in various ulcer models8-10. In addition, not only experimentally but also clinically antidepressant medications have been shown to prevent ulcers successfully11,12. Result of literature reviews tricyclic antidepressants opipramol, amitriptyline, imipramine has been reported to help to prevent ulcer. It has been reported that the medications included in the selective serotonin reuptake inhibitors group generally inflaming ulcer, fluvoxamine and fluoxetine to suppress ulcer exceptionally, moclobemide one of monoamine oxidase inhibitors and one type of antidepressant called tianeptine and mirtazapine having effects to help to heal and preventing ulcer. In light of this information, it has been reported that care should be taken on the selection of this group of medications other than especially fluoxetine and fluvoxamine in depression patients with ulcer, tricyclic antidepressant medications may be used safer. It has been emphasized to prefer mirtazapine and tianeptine that of atypical antidepressants in depression with ulcer incidences on suitable occasions13.

Bupropion is a reuptake inhibitor of selective dopamine and noradrenaline medications. It is a medication proven to suppress withdrawal symptoms stop-smoking induced despite effective in the treatment of depression and is a pharmacological agent other than nicotine validated to use for this purpose14. In the studies, despite dopamine antagonists induce ulcers, dopamine antagonists like bupropion, bromocriptine has been shown to help to heal the number of controls related to bupropion is limited15. Especially, a study that shows the effect of bupropion on gastritis was not found. For this reason, it was aimed to determine the effect on preventing stomach damage in bupropion administered rats with gastritis induced by alcohol.

MATERIALS AND METHODS

Study area: The study was carried out at the laboratories of Veterinary Faculty, Afyon Kocatepe University, Turkey, from February-May, 2021.

Chemicals: Bupropion HCl, omeprazole and 98% high purity ethanol used in the study were purchased from GlaxoSmithKline (Istanbul, Turkey), Sandoz Drug Industry (Istanbul, Turkey) and Sigma-Aldrich (MO, USA), respectively. Other chemicals to be used to determine parameters of analysis were purchased from commercial companies at high purity.

Animals and experimental design: In this study, 2 months (180-200 g) 36 Sprague Dawley type male rats were obtained from Afyon Kocatepe University Experimental Animal Application and Research Center. During the experiment, practices applied to animals were conducted in accordance with universal ethical principles and by the approval of Afyon Kocatepe University Experimental Animal Local Ethics Committee (Ethical number: 49533702/16). Care and feeding of the rats were conducted at 22±2°C room temperature, 55-60 humidity and with a photoperiod of 12:12 hrs. The rats in the working group were fed with standard rodent and fresh drinking water ad libitum. In addition, animals were kept without food before 24 hrs of alcohol treatment.

Ethanol16 and bupropion17-19 doses to be used in an experimental phase were identified following the study done as before. Animals were divided randomly into 5 groups each consisting of 6 male rats. These are the normal group, alcohol group (ethanol-induced gastritis model), group treated with moderate-dose bupropion (30 mg kg–1), group treated with high dose bupropion (60 mg kg–1) and omeprazole group (20 mg kg–1). The gastritis model was created with 56% ethanol. After 12 hrs fasting, rats were administered orally with 56% (8 g kg–1) ethanol two times a week. Normal and model groups were also orally administered with physiological saline following the same protocol. After four weeks, the chronic gastritis model was developed completely. All therapeutics were administered once a day for seven days and after 2 hrs of last administration the animals were taken under general anaesthesia (isoflurane inhalation anaesthesia 5% in air) and necessary tissue and blood samples were collected. To obtain serum from blood samples, blood was centrifuged at 600 g for 15 min. In addition, for homogenization of stomach tissues, the tissues were homogenized in 0.15 M Tris-HCL buffer (pH 7.4). Then, tissues were centrifuged at 4°C, 2500 rpm for 10 min. After centrifuge supernatants obtained were stored until they were analyzed at -20°C.

Determination of gastric damage
Macroscopic investigation of the stomach: After stomach tissue was extracted it was opened by cutting along the curvature line and was macroscopically displayed after rinsed in physiologic saline. Gastric lesions were assessed by blinded observers and scoring was (0, no lesion; 1-2 small lesions; 3-4 small ulcer; 5-6 big ulcer; 7 full ulcers)16,20.

Determination of gastric mucosa: The methods of Rujjanawate et al.21 and Ribeiro et al.22 were taken as the basis for the determination of gastric mucosa. For this purpose, some part of the stomach was immersed into the solution (pH 5.8) including 10 mL 0.02% Alcian blue and 0.16 M sucrose /0.05 M sodium acetate and was incubated at 25°C for 24 hrs and thereafter was centrifuged for 10 min at 3000 g and 4°C. The absorbance of supernatant taken was identified at 620 mm with a spectrophotometer and free mucus in the stomach content was calculated according to binding quantity (mg g–1 tissue) of Alcian blue.

Biochemical analysis: In the stomach tissue taken, malondialdehyde (MDA)23, reduced glutathione (GSH)24 levels, superoxide dismutase (SOD)25 and catalase (CAT)26 and protein27 levels were measured with Spectrophotometrically by Shimadzu 1601-UV spectrophotometer (Tokyo, Japan). In addition, in stomach homogeneous to identify PGE2 and NO the commercial BT-LAB (Shanghai, China) and Cayman (Michigan, USA) ELISA kits were used, respectively.

mRNA expressions of proinflammatory cytokines: Total RNA of the gastric was extracted and reversed transcribed using A.B.T.™ Blood/Tissue RNA Purification Kit (Atlas Biotechnology, Ankara, Turkey), respectively following the manufacturer’s protocols. Expression levels of nuclear factor (NFκB), cyclooxygenase-2 (Cox-2), inducible nitric oxide synthase (iNOS), tumour necrosis factor-α (TNF-α), interleukin 1β (IL1-β) and interleukin-6 (IL-6) mRNA inside the prepared gastric tissues were determined by real-time PCR (StepOnePlus, Applied Biosystems).

Table 1: Description of polymerase chain reaction primers (NF-κβ, Cox-2, iNOS, TNF-α, IL1-β, IL-6 and β-actin) and product size
Genes Primers
Product size (bp)
NF-κβ F: TGGACGATCTGTTTCCCCTC
R: CCCTCGCACTTGTAACGGAA
126
Cox-2 F: AAGGCGTTCAACTGAGCTGT
R: CAACACAGGAATCTTCACAAATGGA
122
iNOS F: ATTGGCACCATCTAACGCACT
R: TGGGGATTTTGTTCTGGGCAT
101
TNF-α F: CATCCGTTCTCTACCCAGCC
R: AATTCTGAGCCCGGAGTTGG
134
IL1-β F: AGGCTGACAGACCCCAAAAG
R: CTCCACGGGCAAGACATAGG
115
IL-6 F: TCTGGTCTTCTGGAGTTCCGT
R: GGAAGTTGGGGTAGGAAGGAC
144
β-actin F: ACAACCTTCTTGCAGCTCCTC
R: CTGACCCATACCCACCATCAC
154

Primers were ordered from Sentegen Biotechnology (Ankara, Turkey) and shown in Table 1. Each sample was analyzed in triplicate. Also, normalization was performed according to the housekeeping gene β-actin expression level. The results are stated as relative gene expression using the delta-delta CT method28.

Histopathological examination: Collected stomach tissues were fixed in 10% (v/v) solution and embedded in paraffin. Paraffin blocks were sectioned at 5 μm thickness using a microtome (RM-2125 RT; Leica, Nussloch, Germany). Tissue damage was investigated under the microscope (Nikon DS Fİ3, microscopic digital camera systems, Tokyo, Japan) by staining haematoxylin and eosin (H and E).

Statistical analysis: Statistical analyses of data were performed using the SPSS software version 22.0 (SPSS Inc., Chicago, IL, USA) and data are expressed as mean±standard deviation (n: 6 per group). Data were analyzed by one-way analysis of variance (ANOVA) followed by post hoc Duncan’s multiple range test. The p-values less than 0.05 were considered significant. Significant differences were pointed with different alphabetical letters.

RESULTS

Changes in gastric mucosa: In the stomach mucosa of the rats exposed to ethanol treatment in Fig. 1b hemorrhagic areas were found while no macroscopic changes were observed in the stomach mucosa of the rats in control groups in Fig. 1a. When gastric mucosa of the group treated with omeprazole was investigated it was determined that the medicine had a protective effect for the alcohol-induced gastric damage in Fig. 1c.

Image for - Bupropion Inhibits Oxidant Status and Inflammation in Ethanol-Induced Chronic Gastritis in Rats
Fig. 1(a-e): Macroscopic evaluation of the effect of bupropion on ethanol-induced gastritis in rats
(a) Rats were treated with physiologic saline (p.o.), (b) 2 hrs before of the administration of 56% ethanol (8 g kg–1; p.o.), (c) Omeprazole (20 mg kg–1; p.o.), (d) 30 and (e) 60 mg kg–1 bupropion (p.o.)

However, gastric damage in rats administered with bupropion in the dose of 30 mg kg–1 Fig. 1d and with bupropion in the dose of 60 mg kg–1 in Fig. 1e was significantly decreased compared to the alcohol group. By scoring the Fig. 2a it was found that gastric mucosal damage in the alcohol group (4.66±0.8 mm2) were more compared to the normal control group (0.16±0.4 mm2), however, the oral administration of bupropion in doses of 30 (3.83±0.9 mm2) and 60 (2.33±0.5 mm2) mg kg–1 decreased the gastric mucosal damage when comparing with alcohol group (p<0.001). Also, omeprazole as a positive control decreased mucosal damage (1.50±0.5 mm2). When comparing mucosal context in Fig. 2b to normal control rats (3.77±0.4 mg g–1 tissue) it was observed that gastric mucosal content of the alcohol group (0.48±0.2 mg kg–1 tissue) was significantly decreased (p<0.001); but gastric mucosal content for the groups administered with bupropion in doses of 30 mg kg–1 (1.16±0.4 mg kg–1 tissue) and 60 mg kg–1 (2.37±0.6 mg kg–1 tissue) was higher than alcohol group (p<0.001). Also, mucosal content was found to be a high level (3.37±0.4 mg kg–1 tissue) in the omeprazole group.

Changes in biochemical parameters: It was found that the alcohol treatment increased MDA levels (7.76±1.0 nmol g–1 tissue) in Fig. 3a in gastric tissue compared with the control group (3.32±0.4 nmol g–1 tissue; p<0.001). In addition, moderate (5.92±0.7 nmol g–1 tissue ) and high dose (4.96±0.4 nmol g–1 tissue) of bupropion and omeprazole (3.71±0.4 nmol g–1 tissue) treatments decreased the MDA levels compared with the alcohol group (p<0.001). On the other hand, it was found that the alcohol treatment decreased (5.06±1.5 nmol g–1 tissue; p<0.001) GSH levels in gastric tissue in Fig. 3b when compared with the control group (12.48±1.7 nmol g–1 tissue), nevertheless the 30 (7.76±1.3 nmol g–1 tissue) and 60 (9.42±0.4 nmol g–1 tissue) mg kg–1 bupropion and omeprazole (10.07±0.5 nmol g–1 tissue) treatments increased the GSH levels (p<0.001) when compared to an alcohol group. In addition of these, in Fig. 3c; the alcohol treatment decreased SOD activity (7.20±1.1 U μg–1 protein) in gastric tissue when compared with the control group (30.42±2.8 U μg–1 protein; p<0.001); the 30 (13.59±1.3 U μg–1 protein) and 60 (16.80±2.3 U μg–1 protein) mg kg–1 bupropion and omeprazole (21.38±2.7 U μg–1 protein) treatments improved SOD activity when compared with alcohol group (p<0.001). Also, it was observed that in Fig. 3d the alcohol treatment decreased CAT (24.41±2.9 U μg–1 protein) activities in gastric tissue when compared with control group (57.05±4.0 U μg–1 protein; p<0.001); the 30 (37.03±4.6 U μg–1 protein) and 60 (43.43±7.5 U μg–1 protein) mg kg–1 bupropion and omeprazole (47.03±3.0 U μg–1 protein) treatments improved CAT activities when compared with alcohol group (p<0.001). It was found that alcohol treatment decreased gastric PGE2 in Fig. 3e levels (4.47±0.8 ng g–1 protein) when compared with control (10.29±1.3 ng g–1 protein; p<0.001) but, the bupropion treatments at doses of 30 (5.75±1.1 ng g–1 protein) and 60 (6.87±1.1 ng g–1 protein) mg kg–1 treatments increased PGE2 levels when compared with alcohol (p<0.001).

Image for - Bupropion Inhibits Oxidant Status and Inflammation in Ethanol-Induced Chronic Gastritis in Rats
Fig. 2(a-b): (a) Effect of bupropion on gastric injury score and (b) Mucus content against ethanol-induced gastritis in rats
Rats were treated with physiologic saline, 30 and 60 mg kg–1 bupropion; p.o., or omeprazole (20 mg kg–1; p.o.) 2 hrs before the administration of 56% ethanol (8 g kg–1; p.o.). The results are presented as the Mean±SD 6 rats per group. Letters (a, b, c, d and e) show statistically significant differences between all groups and the control group (p<0.001)

In addition, it was observed that omeprazole (8.51±0.9 ng g–1 protein) treatment when compared with control returned these parameters to control. It was found that alcohol treatment (4.09±0.8 μmol g–1 protein) decreased gastric NO in Fig. 3f level when compared with control (13.34±1.6 μmol g–1 protein; p<0.001) but, the 30 (7.26±1.4 μmol g–1 protein) and 60 (8.14±0.6 μmol g–1 protein) mg kg–1 bupropion treatment increased NO levels when compared with alcohol (p<0.001). In addition, it was observed that omeprazole treatment (9.84±1.9 μmol g–1 protein) when compared with control returned these parameters to control.

mRNA expression levels in gastric tissue: When gastric mRNA expression fold increases were investigated; NF-κβ in Fig. 4a, Cox-2 in Fig. 4b, iNOS in Fig. 4c, TNF-α in Fig. 4d, IL1-β in Fig. 4e and IL-6 in Fig. 4f mRNA expression levels were found at 4.7, 3.5, 3.3, 3.2, 2.2 and 4.1as nearly increased fold changes in alcohol group compared to normal control groups (p<0.001), respectively. However, it was found that mRNA expressions of these genes in groups administered with bupropion in doses of 30 (3.9, 2.6, 2.5, 2.4, 1.6 and 3.4 as nearly increased fold changes, respectively) and 60 (3.6, 2.2, 2.2, 2.0, 1.4 and 2.5 as nearly increased fold changes, respectively) mg kg–1 were decreased compared to alcohol group (p<0.001). In addition, in the group administered with omeprazole (2.1, 1.4, 1.6, 1.4, 1.1 and 2.0 as nearly increased fold changes, respectively)the fold increases of these genes were found to be returned to control.

Histopathological changes: Ethanol/HCl treatment caused chronic surface epithelial damage in gastric mucosa, bleeding, mononuclear cell infiltration and significant changes in the mucosa in Fig. 5b (p<0.001) compared to the control group in Fig. 5a. Oedema and bleeding in gastric tissue mucosa of alcohol group rats were followed distinctively. On the other hand, the gastric surface mucosal layer of rats in groups administered with 30 and 60 mg kg–1 bupropion and omeprazole in Fig. 5d, e and c respectively, was healthy and oedema in the mucosa was lesser. In addition, it was determined by the statistical method that, damages in groups administered with omeprazole and bupropion (30 and 60 mg kg–1) were significantly decreased (p<0.001).

DISCUSSION

Chronic gastritis is a disease showing clinical effects of anorexia, loss in weight, stomachache and diarrhoea as well as a specific effect like a damage in stomach mucosa depending on long term alcohol intake29. On the other hand, current treatments applied to alcohol-induced chronic gastritis accompany side effects clinically30,31. For this purpose, researchers are studying new approaches to reveal and improve the mechanisms of ethanol-induced chronic gastritis. Bupropion is known as with another name as amfebutamone is a typical type of anti-depressant medicine and indicates its effect by providing norepinephrine and dopamine neuronal reuptake inhibition32.

Image for - Bupropion Inhibits Oxidant Status and Inflammation in Ethanol-Induced Chronic Gastritis in Rats
Fig. 3(a-f): Effect of bupropion on, (a) Malondialdehyde (MDA), (b) Reduced glutathione (GSH), (c) Superoxide dismutase (SOD), (d) Catalase (CAT), (e) Prostaglandin E2 (PGE2) and (f) Nitric oxide (NO) levels against ethanol-induced gastritis in rats
Rats were treated with physiologic saline, 30 and 60 mg kg–1 bupropion; p.o., or omeprazole (20 mg kg–1; p.o.) 2 hrs before the administration of 56% ethanol (8 g kg–1; p.o.). The results are presented as the Mean±SD 6 rats per group. Letters (a, b, c, d and e) show statistically significant differences between all groups and the control group (p<0.001)

Studies were reported that bupropion decreased the levels of inflammatory cytokines like TNF-α and interferon-gamma (INF-γ)33-35. In another study, it was reported that bupropion relieved inflammation by decreasing expressions of Toll-like receptors (TLR3 and TLR4) in patients with major depressive disorders36. For this reason, in our study, it was significant that bupropion showed significant therapeutic effects on ethanol-induced gastritis. But the mechanisms playing role in ulcer protective activity of bupropion were not illuminated before. For this reason, the current study for the first time clarified the potential gastroprotective activity of bupropion in rats against ethanol-induced gastritis.

Image for - Bupropion Inhibits Oxidant Status and Inflammation in Ethanol-Induced Chronic Gastritis in Rats
Fig. 4(a-f): Effect of bupropion on, (a) mRNA expression levels of NF-κβ, (b) Cox-2, (c) iNOS, (d) TNF-α, (e) IL1-β and (f) IL-6 against ethanol-induced gastritis in rats
Rats were treated with physiologic saline, 30 and 60 mg kg–1 bupropion; p.o., or omeprazole (20 mg kg–1; p.o.) 2 hrs before the administration of 56% ethanol (8 g kg–1; p.o.). The results are presented as the Mean±SD 6 rats per group. Letters (a, b, c, d and e) show statistically significant differences between all groups and the control group (p<0.001)

The stomach mucosa layer is the first defensive line for protecting the stomach mucosa. Studies conducted showed that excessive alcohol intake may decrease significantly the thickness of the stomach mucosal layer and hence the protective effect of the stomach mucosa may be decreased37,38. The results of this study presented similarly showed that excessive alcohol intake may decrease the content of mucosa and in the end may cause stomach mucosal damage.

Image for - Bupropion Inhibits Oxidant Status and Inflammation in Ethanol-Induced Chronic Gastritis in Rats
Tissue Histopathological changes Control Ethanol Omeprazole Bupropion 30+Ethanol Bupropion 60+Ethanol
Fundus Epithelial loss 0.00±0.00c 2.10±0.02a 0.16±0.04c 1.06±0.93b 0.70±1.08bc
Hemorrhage 0.00±0.00c 2.26±0.41a 0.33±0.05bc 1.05±1.15b 0.88±1.03bc
Mononuclear cell infiltration 0.00±0.00c 1.75±0.85a 0.16±0.04c 1.23±1.03ab 0.70±1.08bc
Edema 0.00±0.00c 2.10±0.01a 0.16±0.04bc 1.06+0.93b 1.05±1.15b
Fig. 5(a-e):
Histopathological and statistical evaluation of the effect of bupropion on ethanol-induced gastritis in rats
(a) Rats were treated with physiologic saline (p.o.), (b) 2 hrs before of the administration of 56% ethanol (8 g kg–1; p.o.), © Omeprazole (20 mg kg–1; p.o.), (d) 30 and (e) 60 mg kg–1 bupropion; p.o. Representative figures were stained with hematoxylin and eosin. The original magnification was ×4 and the scale bars represent 500 μm. Bold, thin and curved arrows and arrowheads indicate epithelial loss, haemorrhage, areas of mononuclear cell infiltration and oedema, respectively

It was determined that the long-term alcohol treatment causes free radicals to be produced in gastric tissue, together with increasing lipid peroxidation products the GSH levels known as protective effects against damages induced by oxidative stress and antioxidants like SOD and CAT were decreased39-41. Similarly, in the current study, it was found that MDA was increased in the rats administered with alcohol nevertheless GSH level and SOD and CAT activities were inhibited. But it was observed that the bupropion treatment improved increased lipid peroxidation induced by alcohol and decreased antioxidant effect. These results show that bupropion suppresses antioxidant enzymes and prevent oxidative damage. It is known that PGE2 increases mucosal blood flow by inducing gastric mucosal secretion, protects mucosal cells against ulcers and speeds up mucosal healing42,43. On the other hand, ethanol treatment decreases gastric mucosal PGE2 content44. In addition, it was reported that bupropion increases inflammation and TNF-α level in psoriasis and atopic dermatitis, hepatitis B, Crohn and decreases inflammation in some diseases like chronic lymphocytic leukaemia and multiple myeloma30. In this study, bupropion treatment improved alcohol-induced effects in PGE2 levels. These results indicate that bupropion increases PGE2 quantity and has protective effects against gastritis. It was reported that NO can protect the mucous layer by increasing the secretion of mucous and bicarbonate in gastrointestinal mucus, improving gastric blood flow and circulation and decreasing neutrophil infiltration39. In the study conducted in line with other studies39-40 related to NO levels in gastric tissues, it was found that NO levels were decreased significantly by the alcohol treatment. On the other hand, NO level was increased significantly in the rats administered with bupropion. These results show that bupropion treatment can increase NO level by improving the antioxidant defence system and by modulating dopaminergic and L-arginine-nitric oxide-cyclic guanosine monophosphate signal pathway.

Depending on long term or excessive alcohol intake, it was reported that immune responses were shaped and proinflammatory cytokine levels were increased16. NF-κβ activation is shaped in mucosal inflammation induced by gastritis. NF-κβ activation in the presence of itself, induces Cox-2, IL-1β, IL-6, TNF-α and iNOS expressions and causes inflammatory reactions to occur16,45. On the other hand, it was reported that in the acetic acid-induced rat colitis model, 40, 80 and 160 mg kg–1/p.o bupropion treatment for 5 days inhibited TLR4 and NF-κβ signal pathway, hence activation of inflammatory cytokines (such as IL-1, IL-6, IL-8, IL-27 and TNF-α) was decreased46. Again, in a study where the effects of bupropion were investigated on femoral bones; it was emphasized that in ovariectomized rats administered orally with bupropion (30 and 60 mg kg–1/day) for six weeks decreased serum TNF-α, IL-1β and IL-6 levels17. In the current study, it was found that gastric NF-κβ, Cox2, IL-1β, IL-6, TNF-α and iNOS mRNA expression levels were increased significantly in rats exposed to alcohol. On the other hand, it was found that in the groups administered with bupropion there were significant downstream regulations in gastric NF-κβ, Cox2, IL-1β, IL-6, TNF-α and iNOS mRNA expression levels compared with the alcohol group. Current results show that bupropion treatment may have an anti-inflammatory effect by modulating the NF-κβ signal pathway.

In line with other studies16,45, after ethanol treatment, it was found histopathologically acute surface epithelium damage, bleeding, mononuclear cell infiltration in the fundus and oedema in the mucosa. Contrary to this, it was found that alcohol-induced microscopic lesions were decreased distinctively by the bupropion treatment. These results describe that bupropion has a protective effect against an alcohol-induced gastric ulcer in the rat model.

CONCLUSION

As a result, it was determined that bupropion has a therapeutic effect in gastritis by balancing oxidant status and by regulating downstream NF-κβ mediated cytokine production against chronic gastritis developed depending on alcohol intake.

SIGNIFICANCE STATEMENT

This study revealed that bupropion blocking dopamine and noradrenaline reuptake and having a non-competitive antagonistic effect to central nicotinic acetylcholine receptors had a healing effect on gastritis. Through this study’s findings, it may be possible to approach that bupropion may have potential use as a gastroprotective agent as well as antidepressant effect and other effects.

ACKNOWLEDGMENT

The authors wish to thanks Pathologist Dr. Hasan Huseyin DEMIREL for technical assistance in histopathological evaluation.

REFERENCES

  1. Aihara, T., E. Nakamura, K. Amagase, K. Tomita, T. Fujishita, K. Furutani and S. Okabe, 2003. Pharmacological control of gastric acid secretion for the treatment of acid-related peptic disease: Past, present, and future. Pharmacol. Ther., 98: 109-127.
    CrossRefDirect Link
  2. Behrman, S.W., 2005. Management of complicated peptic ulcer disease. Arch. Surg., 140: 201-208.
    CrossRefDirect Link
  3. Ham, M. and J.D. Kaunitz, 2007. Gastroduodenal defense. Curr. Opin. Gastroenterol., 23: 607-616.
    CrossRefDirect Link
  4. Franke, A., S. Teyssen and M.V. Singer, 2005. Alcohol-related diseases of the esophagus and stomach. Digestive Dis., 23: 204-213.
    CrossRefDirect Link
  5. Liu, Y., X. Tian, L. Gou, X. Fu, S. Li, N. Lan and X. Yin, 2012. Protective effect of L-citrulline against ethanol-induced gastric ulcer in rats. Environ. Toxicol. Pharmacol., 34: 280-287.
    CrossRefDirect Link
  6. Naqvi, S.S., J. Pollok, J.E. van Agteren, Z.A. Usmani, K.V. Carson, B.J. Smith and J. Licinio, 2016. Pharmacological interventions for the treatment of depression in chronic obstructive pulmonary disease. Cochrane Database Syst. Rev., Vol. 19.
    CrossRefDirect Link
  7. Beck, A.T., 2005. The current state of cognitive therapy: A 40-year retrospective. Arch. Gen. Psychiatry, 62: 953-959.
    CrossRefDirect Link
  8. Suleyman, H., E. Cadirci, A. Albayrak, B. Polat and Z. Halici et al., 2009. Comparative study on the gastroprotective potential of some antidepressants in indomethacin-induced ulcer in rats. Chem. Biol. Interact., 180: 318-324.
    CrossRefPubMedDirect Link
  9. Ji, C.X., D.S. Fan, W. Li, L. Guo, Z.L. Liang, R.M. Xu and J.J. Zhang, 2012. Evaluation of the anti-ulcerogenic activity of the antidepressants duloxetine, amitriptyline, fluoxetine and mirtazapine in different models of experimental gastric ulcer in rats. Eur. J. Pharmacol., 691: 46-51.
    CrossRefDirect Link
  10. Gabry, K.E., G.P. Chrousos, K.C. Rice, R.M. Mostafa and E. Sternberg et al., 2002. Marked suppression of gastric ulcerogenesis and intestinal responses to stress by a novel class of drugs. Mol. Psychiatry, 7: 474-483.
    CrossRefDirect Link
  11. Zabihi, M., V. Hajhashemi, A. Talebiand and M. Minaiyan, 2017. Evaluation of central and peripheral effects of doxepin on acetic acid-induced colitis in rat and the involved mechanisms. EXCLI J., 16: 414-425.
    Direct Link
  12. Saxena, B. and S. Singh, 2011. Investigations on gastroprotective effect of citalopram, an antidepressant drug against stress and pyloric ligation induced ulcers. Pharmacol. Rep., 63: 1413-1426.
    CrossRefDirect Link
  13. Güneş, M., E. Yazıcı, A. Yazıcı, I. Ferah and E. Çadırcı, 2013. The effects of antidepressants on gastric ulcer. Dicle Med. J., 40: 691-699.
    CrossRefDirect Link
  14. Dedeoğlu, E., B. Bayram, A.U. Kızıler and B. Dedeoğlu, 2011. Generalized tonic-clonic seizure induced by the extended- release bupropion hydrochloride formulation.
    Bull. Clin. Psychopharmacol., 21: 362-363.
    CrossRefDirect Link
  15. Rashid, N., A. Ahmad, N. Singh, P. Singh and V. Mishra et al., 2010. Differential response of A 68930 and sulpiride in stress-induced gastric ulcers in rats. Eur. J. Pharmacol., 643: 121-128.
    CrossRefPubMedDirect Link
  16. Ji, W., K. Liang, R. An and X. Wang, 2019. Baicalin protects against ethanol-induced chronic gastritis in rats by inhibiting Akt/NF-κB pathway. Life Sci., Vol. 239.
    CrossRefDirect Link
  17. Abuohashish, H.M., M.M Ahmed, S.S. Al-Rejaie and K.E.H. Eltahir, 2015. The antidepressant bupropion exerts alleviating properties in an ovariectomized osteoporotic rat model. Acta Pharm. Sin., 36: 209-220.
    CrossRefDirect Link
  18. Lee, H.J., J.S. Rao, L. Chang, S.I. Rapoport and H.W. Kim, 2010. Chronic imipramine but not bupropion increases arachidonic acid signaling in rat brain: Is this related to ‘switching’ in bipolar disorder? Mol. Psychiatry, 15: 602-614.
    CrossRefDirect Link
  19. Reichel, C.M., J.E. Murray, K.M. Grant and R.A. Bevins, 2009. Bupropion attenuates methamphetamine self-administration in adult male rats. Drug Alcohol Depend., 100: 54-62.
    CrossRefDirect Link
  20. Byeon, S., J. Oh, J.S. Lim, J.S. Lee and J.S. Kim, 2018. Protective effects of Dioscorea batatas flesh and peel extracts against ethanol-induced gastric ulcer in mice. Nutrients, Vol. 10.
    CrossRefDirect Link
  21. Rujjanawate, C., D. Kanjanapothi, D. Amornlerdpison and S. Pojanagaroon, 2005. Anti-gastric ulcer effect of Kaempferia parviflora. J. Ethnopharmacol., 102: 120-122.
    CrossRef
  22. Ribeiro, A.R.S., J.D. do Nascimento Valença, J. da Silva Santos, T. Boeing and L.M. da Silva et al., 2016. The effects of baicalein on gastric mucosal ulcerations in mice: Protective pathways and anti-secretory mechanisms. Chem. Biol. Interact., 260: 33-41.
    CrossRefDirect Link
  23. Ince, S., I. Kucukkurt, U. Acaroz, D. Arslan-Acaroz and N. Varol, 2019. Boron ameliorates arsenic-induced DNA damage, proinflammatory cytokine gene expressions, oxidant/antioxidant status, and biochemical parameters in rats. J. Biochem. Mol. Toxicol., Vol. 33.
    CrossRefDirect Link
  24. Ince, S., I. Kucukkurt, H.H. Demirel, D.A. Acaroz, E. Akbel and I.H. Cigerci, 2014. Protective effects of boron on cyclophosphamide induced lipid peroxidation and genotoxicity in rats. Chemosphere, 108: 197-204.
    CrossRefDirect Link
  25. Acaroz, U., S. Ince, D. Arslan-Acaroz, Z. Gurler and I. Kucukkurt et al., 2018. The ameliorative effects of boron against acrylamide-induced oxidative stress, inflammatory response and metabolic changes in rats. Food Chem. Toxicol., 118: 745-752.
    CrossRefDirect Link
  26. Renugadevi, J. and S.M. Prabu, 2010. Cadmium-induced hepatotoxicity in rats and the protective effect of naringenin. Exp. Toxicol. Pathol., 62: 171-181.
    CrossRefDirect Link
  27. Ince, S., D. Arslan-Acaroz, H.H. Demirel, N. Varol, H.A. Ozyurek, F. Zemheri and I. Kucukkurt, 2017. Taurine alleviates malathion induced lipid peroxidation, oxidative stress, and proinflammatory cytokine gene expressions in rats. Biomed. Pharmacother., 96: 263-268.
    CrossRefDirect Link
  28. Pfaffl, M.W., G.W. Horgan and L. Dempfle, 2002. Relative Expression Software Tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res., Vol. 30, No. 9e36.
    CrossRefDirect Link
  29. Shin, J.H., C.W. Lee, S.J. Oh, J. Yun and K. Lee et al., 2013. Protective effect of silymarin against ethanol-induced gastritis in rats: Role of sulfhydryls, nitric oxide and gastric sensory afferents. Food Chem. Toxicol., 55: 353-357.
    CrossRefDirect Link
  30. Bandyopadhyay, D. and A. Chattopadhyay, 2006. Reactive oxygen species-induced gastric ulceration: Protection by melatonin. Curr. Med. Chem., 13: 1187-1202.
    CrossRefDirect Link
  31. Luiz-Ferreira, A., A.C.A. de Almeida, M. Cola, V. Barbastefano and A.B.A. de Almeida et al., 2010. Mechanisms of the gastric antiulcerogenic activity of Anacardium humile St. Hil on ethanol-induced acute gastric mucosal injury in rats. Molecules, 15: 7153-7166.
    CrossRefDirect Link
  32. Eisenberg, M.J., S.M. Grandi, A. Gervais, J. O'Loughlin and G. Paradis et al., 2013. Bupropion for smoking cessation in patients hospitalized with acute myocardial infarction: A randomized, placebo-controlled trial. J. Am. Coll. Cardiol., 61: 524-532.
    CrossRefDirect Link
  33. Brustolim, D., R. Ribeiro-dos-Santos, R.E. Kast, E.L. Altschuler and M.B.P. Soares, 2006. A new chapter opens in anti-inflammatory treatments: The antidepressant bupropion lowers production of tumor necrosis factor-alpha and interferon-gamma in mice. Int. Immunopharmacol., 6: 903-907.
    CrossRefDirect Link
  34. Kast, R.E., 2003. Anti- and pro-inflammatory considerations in antidepressant use during medical illness: Bupropion lowers and mirtazapine increases circulating tumor necrosis factor-alpha levels. Gen. Hospital Psychiatry, 25: 495-496.
    CrossRefDirect Link
  35. Kane, S.V., E.L. Altschuler and R.E. Kast, 2003. Crohn’s disease remission on bupropion. Gastroenterology, Vol. 125.
    CrossRefDirect Link
  36. Hung, Y.Y., K.W. Huang, H.Y. Kang, G.Y.L. Huang and T.L. Huang, 2016. Antidepressants normalize elevated toll-like receptor profile in major depressive disorder. Psychopharmacology, 233: 1707-1714.
    CrossRefDirect Link
  37. Sun, Y.X., H.B. Dong, A.J. Zhan, W.H. Wang and Y.F. Duan et al., 2020. Protection of teprenone against hypoxia and reoxygenation stress in stomach and intestine of Lateolabrax maculatus. Fish Physiol. Biochem., 46: 575-584.
    CrossRefDirect Link
  38. Ning, J.W., G.B. Lin, F. Ji, J. Xu and N. Sharify, 2012. Preventive effects of geranylgeranylacetone on rat ethanol-induced gastritis. World J. Gastroenterol., 18: 2262-2269.
    CrossRef
  39. Al-Sayed, E. and R.N. El-Naga, 2015. Protective role of ellagitannins from Eucalyptus citriodora against ethanol-induced gastric ulcer in rats: Impact on oxidative stress, inflammation and calcitonin-gene related peptide. Phytomedicine, 22: 5-15.
    CrossRefDirect Link
  40. Zhao, W., F. Zhu, W. Shen, A. Fu and L. Zheng et al., 2009. Protective effects of DIDS against ethanol-induced gastric mucosal injury in rats. Acta Biochim. Biophys. Sin., 41: 301-308.
    CrossRefPubMedDirect Link
  41. Wallace, J.L., 2006. Nitric oxide, aspirin-triggered lipoxins and NO-aspirin in gastric protection. Inflammation Allergy Drug Targets, 5: 133-137.
    CrossRefDirect Link
  42. Yoo, J.H., J.S. Lee, Y.S. Lee, S. Ku and H.J. Lee, 2018. Protective effect of bovine milk against HCI and ethanol-induced gastric ulcer in mice. J. Dairy Sci., 101: 3758-3770.
    CrossRefDirect Link
  43. Alirezaei, M., O. Dezfoulian, S. Neamati, M. Rashidipour, N. Tanideh and A. Kheradmand, 2012. Oleuropein prevents ethanol-induced gastric ulcers via elevation of antioxidant enzyme activities in rats. J. Physiol. Biochem., 68: 583-592.
    CrossRefDirect Link
  44. Takeuchi, K. and K. Amagase, 2018. Roles of cyclooxygenase, prostaglandin E2 and Ep receptors in mucosal protection and ulcer healing in the gastrointestinal tract. Curr. Pharm. Des., 24: 2002-2011.
    CrossRefDirect Link
  45. Al-Quraishy, S., M.S. Othman, M.A. Dkhil and A.E. Abdel Moneim, 2017. Olive (Olea europaea) leaf methanolic extract prevents HCl/ethanol-induced gastritis in rats by attenuating inflammation and augmenting antioxidant enzyme activities. Biomed. Pharmacother., 91: 338-349.
    CrossRefDirect Link
  46. Rashidian, A., P. Dejban, K.K. Fard, A. Abdollahi, M. Chamanara, A. Dehpour and A. Hasanvand, 2020. Bupropion ameliorates acetic acid–induced colitis in rat: The involvement of the TLR4/NF-kB signaling pathway. Inflammation, 43: 1999-2009.
    CrossRefDirect Link

Leave a Comment

Your email address will not be published. Required fields are marked *