Identification of Egyptian Goat α S1-casein Alleles Using PCR-RFLP Method

MATERIALS AND METHODS

Genomic DNA Extraction
Genomic DNA was extracted from whole blood by phenol-chloroform method with minor modification (John et al., 1991). Ten milliliter of blood taken on EDTA was mixed with 25 mL cold sucrose-triton and the volume was completed to 50 mL by autoclaved double distilled water. The solution was mixed well and the nuclear pellet was obtained by spin and discarding the supernatant. The nuclear pellet was suspended in lysis buffer (10 mM Tris base, 400 mM NaCl and 2 mM sodium EDTA) pH 8.2, with 20% Sodium Dodecyl Sulfate (SDS) and proteinase K (10 mg mL^-1) and incubated overnight in a shaking water-bath at 37°C.

Nucleic acids were extracted once with phenol, saturated with Tris-EDTA (TE) buffer (10 mM Tris, 10 mM NaCl and 1mM EDTA), followed by extraction with phenol-chloroform-isoamyl alcohol (25:24:1) until there was no protein at the interface. This was followed by extraction with chloroform-isoamyl alcohol (24:1).

To each extraction, equal volumes of the solvent were added, followed by thorough mixing and centrifugation for 10 min at 2000 rpm. The top layer was carefully transferred to another Falcon tube for the next extraction. To the final aqueous phase, 0.1 volume of 2.5 M Na acetate and 2.5 volume of cold 95% ethanol were added. The tubes were agitated gently to mix the liquids and a fluffy white ball of DNA was formed. The DNA was picked up with a heat-sealed Pasteur pipette and washed briefly in 70% ethanol.

The DNA was finally dissolved in an appropriate volume of 1X TE buffer. DNA concentrations were determined and diluted to the working concentration of 50 ng μL^-1, which is suitable for polymerase chain reaction.

Polymerase Chain Reaction (PCR)
The primer used in this study was synthesized from published nucleotide sequence of goat α S1-casein gene (forward: 5´ TTCTAAAAGTCTCAGAGGCAG 3´), (reverse: 5´ GGGTTGATAGCCTTGTATGT 3´) (Ramunno et al., 2000). Its PCR product enable us to detect 10 genetic variants of αS1-casein after digestion with a specific restriction enzyme.

A PCR cocktail consists of 1.0 (μM upper and lower primers and 0.2 mM dNTPs, 10 mM Tris (pH 9), 50 mM KCl, 1.5 mM MgCl₂, 0.01% gelatin (w/v), 0.1% Triton X-100 and 1.25 units of Taq polymerase. The cocktail was aliquot into tubes with 100 ng DNA of goat. The reaction mixture was overlaid with sterile mineral oil and is run in a Coy Temp Cycler II (Coy Corporation, MI, USA) the amplification protocol consisted of 30 cycles of 94°C for 1 min, 60°C for 1 min and 72°C for 2 min.

RFLP and Agarose Gel Electrophoresis
Twenty microliter of PCR product were digested with 10 units of restriction enzyme XmnI used in a final reaction volume 25. The reaction mixture was incubated at 37°C in water bath over night. After restriction digestion, the restricted fragments were analyzed by electrophoresis on 2.5% agarose/1X TBE gel stained with ethidium bromide. The 100 bp ladder was used as molecular size marker. The bands were visualized under UV light and photographed with yellow filter on black and white film.

Results and Discussion

Forty four animals used for detecting the presence of 10 polymorphisms of goat αS1-casein. The PCR products were digested by restriction enzyme XmnI and resolved using gel electrophoresis. The restriction fragment length polymorphism determined by XmnI allowed to identify the genotypes a/a at 150 bp, b/b at 161 bp, c/c at 212 bp, d/d at 223 bp.

Table 1:	Genotype frequencies of α S1-casein after XmnI digestion of fragment obtained by PCR products of Egyptian goat DNA

Table 2:	Genotype frequencies of α S1-casein among different Egyptian goat breeds

Fig. 1:	DNA electrophoretic pattern obtained after digestion of PCR amplified of goat casein α 1 (CSN1S1) products with XmnI, M: 100-bp ladder marker, Lane 1: homozygous a/a genotype, Lane 2: homozygous b/b genotype, Lane 3: heterozygous b/d genotype, Lane 4: heterozygous a/c genotype

Fig. 2:	DNA electrophoretic pattern obtained after digestion of PCR amplified of goat casein α 1 (CSN1S1) products with XmnI, M: 100-bp ladder marker, Lane 1: heterozygous a/c genotype, Lane 2: heterozygous b/d genotype, Lane 3: homozygous d/d genotype

The presence of a/b should be illustrated by two fragments at 150 and 161 bp, a/c by two fragments at 150 and 212 bp, a/d by two fragments at 150 and 223 bp, b/c by two fragments at 161 and 212 bp, b/d by two fragments at 161 and 223 bp, c/d by two fragments at 212 and 223 bp (Table 1).

Among different breeds (Table 2), the results of genetic variants showed that the Damascus breed has five different genotypes a/a, b/b, d/d, a/c, b/d (Fig. 1 and 2), the Sahrawi breed has a/c with high frequency 90.9%, while the Baladi breed carries two different genotypes with different frequencies (Table 2). In Zaraibi breed, the genotype b/d is the most common by 80%.

In caprine breeds, four types of alpha S1-casein alleles are identified and associated with various amounts of protein in milk. The A, B and C are strong alleles associated with a high level of αS1-casein in milk (3.5 g L^-1). The D and E alleles with a medium level (1.1 g L^-1), the F and G alleles with a low level (0.45 g L^-1). The contribution of null allele is very low or non existent of α S1-casein (Ramunno et al., 2000). The quantity of total caseins in caprine milk is positively correlated with the amount of α S1-casein. Therefore, milk from animals possessing strong alleles contain significantly more total caseins than milk from animals without those alleles. This is important because animals with mild alleles can be employed to produce milk for allergic subjects, while the other animals can be used to produce milk for the dairy industry (Martin et al., 1999; Leroux et al., 1990; Roncada et al., 2002).

Present results revealed that Egyptian goat breeds showed low percentage of homozygous strong alleles A (4.5%) and B (6.8%) of milk casein used for cheese industry. The mild allele D recorded very low percentage 2.3%. This allele associated with medium level 1.1 g L^-1 of milk protein favorable for allergic subject (nutritional purposes) especially the infant diet where the goat milk with low casein is reported less allergenic than cow’s milk (Roncada et al., 2002). These results indicated that alleles require for economic milk industry present with low percentage in Egyptian goat breeds.

In conclusion, the alleles frequencies and identification for animals α S1-casein are important for identifying animals carrying the strong and mild alleles needed for improving a given trait depend on the frequency of favorable allele. The more will gained by selecting for strong and mild alleles of α S1-casein. So that, the breeding strategies should be changed toward milk protein alleles required for economic milk industry.

ACKNOWLEDGMENTS

Especial thanks to Prof. Dr. Soheir M. El Nahas and Dr. Othman E. Othman for their support. This research was conducted as a part of the project Genetic polymorphism of some genes related to quantitative traits in different breeds of goat in Egypt (2002-2005), which was supported from the National Research Center (Egypt).