Subscribe Now Subscribe Today
Research Article
 

Screening, Isolation and Characterization of a Novel Antimicrobial Producing Actinomycete, Strain RAF10



Forar Laidi Rabah, Ali Elshafei, Mahmoud Saker, Bengraa Cheikh and Hacene Hocine
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

A novel actinomycete strain designated RAF10, producing antimicrobial substances was isolated from an Egyptian soil. Morphological and chemical studies indicated that strain RAF10 belonged to the genus Streptomyces. The comparison of its physiological characteristics with those of known species of Streptomyces showed some differences with the nearest species Streptomyces enissocaesilis. Analysis of the 16S rDNA sequence of strain RAF10 showed a similarity level ranging between 97.22 and 98.37% within Streptomyces species, with S. enissocaesilis the most closely related. However, the phylogenetic analysis indicated that strain RAF10 represent a distinct phyletic line suggesting a new genomic species. This novel strain was active against Gram-positive and Gram-negative Bacteria, yeasts and filamentous fungi. The highest antibiotic formation was obtained when using (ISP 4) broth medium with some modifications, for 120 h at 28°C in New Brunswick Scientific Shaker at 200 rpm.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Forar Laidi Rabah, Ali Elshafei, Mahmoud Saker, Bengraa Cheikh and Hacene Hocine, 2007. Screening, Isolation and Characterization of a Novel Antimicrobial Producing Actinomycete, Strain RAF10. Biotechnology, 6: 489-496.

DOI: 10.3923/biotech.2007.489.496

URL: https://scialert.net/abstract/?doi=biotech.2007.489.496

INTRODUCTION

The search for new antibiotics continues to be of extreme importance in research programs around the world because of the increase of resistant pathogens and toxicity of some used antibiotics (Berdy, 1989). The history of new drug discovery processes shows that novel skeletons have, in the majority of cases, come from natural sources (Bevan et al., 1995). This involves the screening of microorganisms and plant extracts (Shadomy, 1987). Among microorganisms, actinomycetes are one of the most attractive sources of antibiotics and other biologically active substances of high commercial value and from which, Streptomyces spp. has been the most fruitful source of all types of bioactive metabolites that have important applications in human medicine as anti-viral and anti-cancer compounds and in agriculture as herbicides, insecticides and antiparasitic compounds (Watve et al., 2001). Thus, screening and isolation of promising strains of actinomycetes with potential antibiotics is still a thrust area of search by our group from many years (Hacène and Lefebvre, 1996; Hacène et al., 1998, 2000; Forar et al., 2006a, b).

In the present study, we describe the isolation of a new actinomycete strain from an Egyptian soil having antimicrobial activities against Gram-positive and Gram-negative bacteria, yeasts and filamentous fungi and its identification by conventional and molecular methods as well as the optimal conditions for antimicrobial formation.

MATERIALS AND METHODS

Soil sampling, isolation and screening of Streptomyces spp.: Several soil samples were randomly collected from and around Cairo, during 2005-2006, using an open-end soil borer (20 cm depth and 2.5 cm diameter) from a depth of 10-20 cm then air-dried, mixed thoroughly with CaCO3 (10% w/w) and incubated at 28°C for 10 days before use, (El-Nakeeb and Lechevalier, 1963; Tsao et al., 1960). Isolation and enumeration of actinomycetes present in the soil sample was performed by serial dilution plate technique using starch casein nitrate agar (El-Nakeeb and Lechevalier, 1963; Kuster and Williams, 1964). Promising isolates were maintained as suspension of spores and mycelia in YEME supplemented with 40% (v/v) glycerol (Hopwood et al., 1985). This study was conducted in the Laboratory of Microbial Chemistry, NRC-Dokki, Cairo, Egypt.

Morphological and cultural characteristics: The morphological and cultural characteristics of the bacterium were determined by naked eyes examination of 7, 14 and 21 days old cultures grown on various International Streptomyces Project (ISP) media recommended by Shirling and Gottlieb (1966). Colors of aerial and substrate mycelia were monitored with the ISCC-NBS centroid color charts (Kenneth, 1958). The spore chains and spore surface ornamentation were examined according to Tresner et al. (1961) using Em10 Karl-Zeiss electron microscope. Composition of the cell wall was carried out according to the methods of Becker et al. (1964) and Lechevalier and Lechevalier (1970).

Physiological characteristics: Several tests were considered for this study, including the utilization of the carbohydrate compounds evaluated on C1 medium (Pridham and Gottlieb, 1948; Nonomura, 1974), different nitrogen sources, the degradation of many organic compounds such as: milk casein, tyrosin, xanthin (Nitsch and Kutzner, 1969; Goodfellow, 1971), gelatin, starch, esculin and arbutin, the production of melanoid pigments on ISP 6 and ISP 7 media and nitrate reductase (Shirling and Gottlieb, 1966; Marchal et al., 1987). The organism was also tested for its ability to grow on glucose-yeast extract agar (GYEA) medium supplemented with 5 different antibiotics (Athalye et al., 1985) and inhibitory compounds including (w/v): sodium azide, 0.001%; sodium chloride, 1, 2, 3, 4, 5, 6 and 7 and to grow at pH 5, pH 9 and at 42°C.

DNA isolation: Chromosomal DNAs were isolated by a versatile quick-prep method for genomic DNA of Gram-positive bacteria (Pospiech and Neumann, 1995), with some modifications. Mycelia (5 mL) grown in a LB broth shake culture were centrifuged, rinsed with TE and resuspended in 0.4 mL SET buffer (75 mM NaCl, 25 mM EDTA, 20 mM Tris, pH 7.5). Lysozyme was added to a concentration of 1 mg mL-1 and incubated at 37°C for 0.5-1 h. Then 0.1 vols 10% SDS and 0.5 mg Proteinase K mg mL-1 were added and incubated at 55°C with occasional inversion for 2 h. One-third volume 5 M NaCl and 1 vol. chloroform were added and incubated at room temperature for 0.5 h with frequent inversion. The mixture was centrifuged at 4500 g for 15 min and the aqueous phase was transferred to a new tube using a blunt-ended pipette tip. Chromosomal DNA was precipitated by the addition of 1 vol. 2-propanol with gentle inversion. The DNA was transferred to a new tube, rinsed with 70% ethanol, dried under vacuum and dissolved in a suitable volume (about 100 μL) of distilled water. The dissolved DNA was treated with 20 μg RNase A mL-1 at 37°C for 1 h. Samples were extracted in the same volume of phenol/chloroform/isoamyl alcohol (25:24:1) and precipitated with 2.5 vols cold ethanol and 0.1 vols 3 M sodium acetate. The pellets were washed with 70% ethanol, dried and dissolved in TE or distilled water.

PCR amplification: The 16S rDNA gene was amplified using primers fD1 (AGAGTTTGATCCTGGCTCAG) and rP2 (ACGGCTACCTTGTTACGACTT) (Weisburg et al., 1991). It was performed in iCycler PCR BIORAD, in a total volume of 50 mL containing 30-50 ng DNA, 100 mM each primer, 10 mM dNTP, 10X buffer (100 mM Tris/HCl, pH 8.0, 500 mM KCl, 20 mM MgCl2, 0.1% gelatin) and 1.5 U Taq DNA polymerase (Promega). PCR was performed under the following conditions: 3 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 58°C, 2 min at 72°C and then final extension at 72°C for 7 min, The PCR reaction mix was analyzed by agarose gel electrophoresis and the DNA of the expected size was purified then cloned into pGEM_T Easy vector (Promega).

Cloning and nucleotide sequence determination: PCR products of the 16S rDNA of strain RAF10 were sub-cloned into pGEM-T Easy Vector for nucleotide sequence determination using an automated laser fluorescence sequencer (3100 genetic analyzer ABI PRISM, Applied Biosystem, HITCHI, USA). Sequencing reactions were carried out with the Big Dye termination kit (Applied Biosystems) according to the supplier’s instructions. Nucleotide sequence of the 16S rDNA of strain RAF10 was determined and compared for similarity level with the reference species of bacteria contained in genomic database banks, using the NCBI Blast available at the ncbi-nlm-nih.gov Web site.

Phylogenetic analysis: Phylogenetic and molecular evolutionary analyses were conducted using software’s included in MEGA version 3.0 (Kumar et al., 2004) package. The 16S rDNA sequence of the strain RAF 10 was aligned using the CLUSTAL W program (Thompson et al., 1994) against corresponding nucleotide sequences of representatives of the genus Streptomyces retrieved from GenBank. Evolutionary distance matrices were generated as described by Jukes and Cantor (1969) and a phylogenetic tree was inferred by the Neighbor joining method (Saitou and Nei, 1987). Tree topologies were evaluated by bootstrap analysis (Felsenstein, 1985) based on 1000 resamplings of the neighbor joining data set.

Antimicrobial activity: For determining the antimicrobial activity of strain RAF10, the disk paper diffusion method was used (Wu, 1984). Inhibition zones were expressed as diameter and measured after incubation at 37°C for 24 h for bacteria and yeasts and at 28°C for 48 h for filamentous fungi. The used target germs obtained from MIRCEN Cairo, Faculty of Agriculture, Ain-Shams University, Egypt, were (Bacillus cereus, B. subtilis, Staphylococcus aureus, Micrococcus luteus, Escherichia coli, Pseudomonas aeruginosa, Candida albicans, C. pseudotropicalis, Rhodotorula minuta, Aspergillus niger, A. flavus, A. terreus, Botrytis allii, Diplodia oryzae, Fusarium oxysporum, Helmenthosporium turcicum, Machrophomina phaseoli, Trichoderma viride.

Selection of suitable broth medium and correct culture conditions: In favor of optimum formation of antibiotic from the selected organism, a number of broth culture media such as yeast-extract malt-extract glucose broth (ISP2), Inorganic salts-starch broth (ISP4), tryptone-yeast extract-glucose broth (TYG), TSB and starch nitrate broth medium were tried. After incubation at 28°C for 144 h in New Brunswick Scientific Shaker at 200 rpm, antibacterial activities were assayed for each culture supernatant. After determination of the better culture broth, effects of various carbon and nitrogen sources and temperatures, on the antibiotic production were also investigated in the same culture conditions described above. Finally and based on the obtained results, the effect of incubation periods (up to 144 h) was also determined. A range of extraction solvents was screened for effectiveness, including petroleum ether, n-hexane, chloroform, diethyl ether, ethyl acetate, butyl acetate, benzene and n-butanol. The organic extracts were evaporated to dryness then recuperated in 1 mL of methanol and tested for their antimicrobial activities using disks of 8mm diameter against Bacillus cereus and Candida albicans. The solvent which gave the highest inhibition diameter, using respective solvents as control, was then kept for the extraction of antibiotics. The biomass was extracted with ethanol.

RESULTS

Screening of Streptomyces isolates: Thirteen out of nineteen isolates of Streptomyces spp. obtained showed noticeable antimicrobial activities against Gram positive and Gram negative bacteria, yeasts and filamentous fungi. Three isolates exhibited high activities against all the tested microorganisms and appeared promising (Table 1). The most active one (Table 2) was selected for identification and designated strain RAF10. It exhibited different activities compared to its closest species Streptomyces enissocaesilis (Table 3).

Taxonomy: The examination of the strain RAF10 grown on ISP 2 medium at 28°C for 7 days revealed that sporophores are spiral. Transmission electron micrograph showed that spores are numerous, very fine and oval with smooth membranes (Fig. 1). The cultures are brown, earthy-black or gray-black. Strain RAF10 grew well to moderate on the tested organic and synthetic media. The color of the Aerial Mycelium (AM) is lilac to pinkish lilac; it varied depending on the type of used media. The brown substance was produced on synthetic and organic media and stains them. This strain hydrolyzed starch, reduced nitrate, liquefied gelatin and peptonized milk, but it did not produce H2S. It utilized glucose, arabinose, mannose, maltose, xylose, inositol and sodium citrate, it could not utilize lactose, raffinose, sucrose, galactose, mannitol and sodium acetate. As nitrogen sources, it utilized nitrates well and ammonium salts are either poorly utilized or not utilized at all. Strain RAF10 was not able to grow on Glucose-Yeast Extract Agar (GYEA) medium supplemented with 5 different antibiotics, Chloramphenicol (25 mg L-1), Erythromycin (10 mg L-1), Gentamicin (5 mg L-1), Oxytetracycline (25 mg L-1) and Penicillin (25 mg L-1). It did not grow at 0.001% sodium azide and 6% sodium chloride. Well growth was recorded at a temperature range of 15 to 37°C and at pH range of 6 to 9. The chemotaxonomic study showed the presence of a chemotype I cell wall characterized by (LLDAP) (Lechevalier and Lechevalier, 1970), no diagnostic sugars were detected.

The alignment of the nucleotide sequence (1489 bp) of strain RAF10 (Accession No EF 474464) through matching with 16S rDNA reported genes sequences in the gene bank using the NCBI Blast available at the ncbi-nlm-nih.gov Web site and compared with sequences of the reference species of bacteria contained in genomic database banks exhibited a similarity level ranged from 97.22 to 98.37% with Streptomyces enissocaesilis having the closest match. The phylogenetic tree obtained by applying the neighbor-joining method is shown in Fig. 2.

Antimicrobial activity: Results in Table 2 and 3 showed the broad antimicrobial spectrum of strain RAF10 against various target microorganisms. It exhibited a good activity against Gram-positive bacteria such as (Staphylococcus aureus and Bacillus cereus) and Gram-negative bacteria (E. coli), then filamentous fungi (Aspergillus niger) and yeasts (Candida albicans).

Table 1: Antimicrobial activity of nineteen isolates of Streptomyces spp. against Gram positive and Gram negative bacteria, yeasts and filamentous fungi
Image for - Screening, Isolation and Characterization of a Novel  Antimicrobial Producing Actinomycete, Strain RAF10
+: Antibiosis, -: No effect

Table 2: Antimicrobial activity of the culture broth of the three selected isolates of Streptomyces spp. against the same test organisms mentioned above
Image for - Screening, Isolation and Characterization of a Novel  Antimicrobial Producing Actinomycete, Strain RAF10
*Antimicrobial activity was measured as growth inhibition zone diameter (mm)

Table 3: Antibiosis of strain RAF 10 and S. enissocaesilis towards various test organisms
Image for - Screening, Isolation and Characterization of a Novel  Antimicrobial Producing Actinomycete, Strain RAF10
ND: Not Determined, + Active, -: Not Active, *: Data from Krassilnikov (1981)

Suitable broth medium and correct culture conditions: Different broth media, carbon and nitrogen sources, temperatures and incubation periods were tested for the best production of active compounds. It was found that, (ISP 4) broth medium using, starch and ammonium sulphate at concentrations of 2.5 and 0.25% (w/v) as carbon and nitrogen sources respectively, for 120 h at 28°C in orbital incubator with shacking at 200 rpm were the most suitable for antibiotic formation. The ethanol extract of the biomass showed no antimicrobial activity. Petroleum ether, n-hexane, chloroform, diethyl ether and benzene were negative for antibiotics extraction. While ethyl acetate and butyl acetate were poor solvents for extraction. Because, n-butanol was good for extraction of active compounds, it was then kept for antibiotics extraction.

Image for - Screening, Isolation and Characterization of a Novel  Antimicrobial Producing Actinomycete, Strain RAF10

Fig. 1:

Transmission electron micrograph of strain RAF10, showing smooth surface of spores (X10000)

Image for - Screening, Isolation and Characterization of a Novel  Antimicrobial Producing Actinomycete, Strain RAF10

Fig. 2:

16S rDNA tree showing the phylogenitic relationship neighbor-joining method between strain RAF 10 and other known sequences of Streptomyces sp.
DISCUSSION

On the basis of its morphological and chemical properties, the strain RAF10 was classified in the genus Streptomyces. The characterization of Streptomyces species is mainly based on, the color of aerial and substrate mycelia and of soluble pigment, the shape and ornamentation of spore surface because of its stability. Furthermore and for adequate identification, some physiological characters such as temperature range growth, degradation of starch, gelatin, inositol and rhamnose and reduction of nitrates, some additional tests relative to the use of arabinose, glycerol, galactose and mannitol are also considered to ascertain species classification of new isolates strains as recommended by Shirling and Gottlieb (1972) and Holt et al. (1989). Comparison of cultural and physiological characteristics of the strain RAF10 with those of Streptomyces known species indicated that Streptomyces enissocaesilis was the nearest species. This species was identified as Actinomyces enissocaesilis INMI 40-31, when it was first isolated and described by Krassilnikov in 1970 (Gauze et al., 1983). The two strains have the same aerial and substrate mycelia colors, spore shape and physiological characters with some differences between them.

Modern Streptomyces identification systems are based on 16S rDNA sequence data, which have provided invaluable information about Streptomycetes systematic and then have been used to identify several newly isolated Streptomyces (Pineau et al., 2003; Lee et al., 2005; Forar et al., 2006a; Hyo et al., 2006). The 16S rDNA sequence of strain RAF10 was compared with those of other Streptomyces species, it showed the highest sequence similarity of 98.37% with S. enissocaesilis the most closely related species. However, it is clear from phylogenetic analysis that, strain RAF10 did cluster with neither S. enissocaesilis nor any of Streptomyces species and represented a distinct phyletic line suggesting a new genomic species. This may suggest the novelty of this strain. The use of phylogenetic technique gives a better resolution in the species level identification, (Stackebrandt and Woese, 1981; Dyson and Schrempf, 1987).

On the other hand, the antagonism of S. enissocaesilis is manifested poorly towards individual species of Gram-positive bacteria (Staphylococci and Mycobacteria), they do not suppress the growth of Gram-negative bacteria, fungi and yeasts (Krassilnikov, 1981), while strain RAF10 showed greater potency against Gram-positive and Gram- negative bacteria, yeasts and fungi.

Various parameters were tested for their suitability to increase antibiotics production by strain RAF10. It was found that, (ISP 4) broth medium using, starch and ammonium sulphate at concentrations of 2.5 and 0.25% (w/v) as carbon and nitrogen sources respectively, for 120 h at 28°C in orbital incubator with shacking at 200 rpm, were the most suitable. In fact, it has been shown that the nature of carbon and nitrogen sources, temperature, pH and incubation period, strongly affect active metabolite production in different organisms, (Vilshes et al., 1990; Holmalahti et al., 1998). Results obtained match with what was reported by Chattopadhyay and Sen (1997). The active compounds were extracted by n-butanol from the culture supernatant, whereas the ethanol extract of the biomass showed no antimicrobial activity. This shows the extracellular nature of active substances. Mostly antibiotics are extracellular (Hacene et al., 2000; Augustine et al., 2005). The investigation of these molecules is now in progress.

In conclusion, in view of all the previous characteristics of RAF10, it could be stated that, RAF10 is suggested of being a new variety of Streptomuyces enissocaesilis. Thus it is designated as Streptomuyces enissocaesilis RAF10. It is a potential source of active compounds. Results obtained from the present work are promising and hence merit further studies.

ACKNOWLEDGMENT

This research was supported by the Ministère de l Enseignement supérieur et de la Recherche Scientifique (MESRS) of Algeria. The authors are grateful to Prof. Dr. Salah M. Prof. of Genetic Engineering and Biotechnology in Agricultural Genetic Engineering Research Institute (AGERI), Cairo-Egypt, for his keen help in DNA sequencing and analysis.

REFERENCES

1:  Athalye, M., M. Goodfellow, J. Lacey and R.P. White, 1985. Numerical classification of actinomadura and nocardiopsis. Int. J. Syst. Bacteriol., 35: 86-98.

2:  Augustine, S.K., S.P. Bhavsar and B.P. Kapadnis, 2005. Production of a growth dependent metabolite active against dermatophytes by Streptomyces rochei AK 39. Indian J. Med. Res., 121: 164-170.
Direct Link  |  

3:  Becker, B., M.P. Lechevalier, R.E. Gordon and H.A. Lechevalier, 1964. Rapid differentiation between Nocardia and Streptomyces by paper chromatography of whole-cell hydrolysates. Applied Microbiol., 12: 421-423.
PubMed  |  

4:  Berdy, J., 1989. The Discovery of New Bioactive Microbial Metabolites: Screening and Identification. In: Bioactive Metabolites from Microorganisms, Bushell, M.E. and U. Grafe (Eds.). Elsevier Science Publishers, Amsterdam pp: 3-25

5:  Bevan, P., H. Ryder and I. Shaw, 1995. Identifying small-molecule lead compounds: The screening approach to drug discovery. Trends Biotechnol., 13: 115-121.
CrossRef  |  Direct Link  |  

6:  Chattopadhyay, D. and S.K. Sen, 1997. Optimization of cultural conditions for antifungal antibiotic accumulation by Streptomyces rochei G164. Hindustan Antibiot. Bull., 39: 64-71.
Direct Link  |  

7:  Dyson, P. and H. Schrempf, 1987. Genetic instability and DNA amplification in Streptomyces lividans 66. J. Bacteriol., 169: 4796-4803.

8:  El-Nakeeb, M.A. and H.A. Lechevalier, 1963. Selective isolation of aerobic actinomycetes. Applied Environ. Microbiol., 11: 75-77.
Direct Link  |  

9:  Felsenstein, J., 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 39: 783-791.
CrossRef  |  Direct Link  |  

10:  Forar, L.R., K. Amany, E. Ali and Ch. Bengraa, 2006. Taxonomy, identification and biological activities of a novel isolate of Streptomyces tendae. Arab J. Biotech., 9: 427-436.
Direct Link  |  

11:  Forar, L.R., A. Norrya and Ch. Bengraa, 2006. Screening, isolation and characterization of antifungal producing actinomycete, Streptomyces strain RN+ 8. Afr. J. Biol. Sci., 2: 73-82.

12:  Gauze, G.F., T.P. Preobrazhenskaya, M.A. Sveshnikova., L.P. Terekhova and T.S. Maximova, 1983. A guide for the determination of actinomyctes Genera Streptomyces, Streptoverticilliu and Chaina. Nauka, Moscow, pp: 137-138, (In Russian).

13:  Goodfellow, M., 1971. Numerical taxonomy of some nocardioform bacteria. J. Gen. Micrbiol., 69: 33-80.
CrossRef  |  PubMed  |  

14:  Hacene, H. and G. Lefebvre, 1996. HP17, a new pigment-like antibiotic produced by a new strain of spirillospora. J. Applied Bact., 89: 565-569.
CrossRef  |  

15:  Hacene, H., F. Boudjellal and G. Lefebvre, 1998. AH7, a non-polyenic antifungal antibiotic produced by a new strain of Streptosporangium roseum. Microbios, 96: 103-109.
Direct Link  |  

16:  Hacene, H., F. Daoudi-Hamdad, T. Bhatnagar, J.C. Baratti and G. Lefebvre, 2000. H107, a new aminoglycoside anti-Pseudomonas antibiotic produced by a new strain of spirillospora. Microbios, 102: 69-77.
PubMed  |  

17:  Holmalahti, J., O. Raatikainen, A. Wright, H. Laatsch, A. Spohr, O.K. Lyngberg and J. Neilson, 1998. Production of dihydroabikoviromycin by Streptomyces analatus. Production parameters and chemical characterization of genotoxicity. J. Applied Microbiol., 85: 61-68.

18:  Williams, S.T., 1989. Bergey's Manual of Systematic Bacteriology. Vol. 4, Williams and Williams, Baltimore, MD., USA

19:  Hopwood, D.A., M.J. Bibb and K.F. Chater, 1985. Genetic manipulation of Streptomyces. A Laboratory Manual. Norwish: The John Innes Founqation.

20:  Hyo, J.K., C.L. Sung and K.H. Byung, 2006. Streptomyces cheonanensis sp. nov., a novel streptomycete with antifungal activity. Int. J. Syst. Evol. Microbiol., 56: 471-475.
Direct Link  |  

21:  Jukes, T.H. and C.R. Cantor, 1969. Evolution of Protein Molecules. In: Mammalian Protein Metabolism, Munro, H.N. (Ed.). Academic Press, New York, pp: 21-132

22:  Kenneth, L.K., 1958. Prepared research paper RP 2911, central nations for the revised ISCC-NBS color name blocks. J. Res. NBS, 16: 427-427.

23:  Krassilnikov, N.A., 1981. Ray Fungi. Higher Forms (Translated from Luchistye griby. Vysshie). Amerind Publishing Co. Pvt. Ltd., New Delhi, pp: 1001-1002

24:  Kumar, S., K. Tamura and M. Nei, 2004. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform., 5: 150-163.
CrossRef  |  PubMed  |  Direct Link  |  

25:  Kuster, E. and S.T. Williams, 1964. Selection of media for isolation of streptomycetes. Nature, 202: 928-929.
CrossRef  |  Direct Link  |  

26:  Lechevalier, M.P. and H. Lechevalier, 1970. Chemical composition as a criterion in the classification of aerobic actinomycetes. Int. J. Syst. Evol. Microbiol., 20: 435-443.
CrossRef  |  Direct Link  |  

27:  Lee, J.Y., H.W. Jung and B.K. Hwang, 2005. Streptomyces koyangensis sp. nov., a novel actinomycete that produces 4-phenyl-3-butenoic. Int. J. Syst. Evol. Microbiol., 55: 257-262.
Direct Link  |  

28:  Marchal, N., J.L. Bourdon and Cl. Richard, I987. The culture media for isolation and biochemical identification of bacteria. Doin, Paris.

29:  Nitsch, B. and H.J. Kutzner, 1969. Egg-yolk agar as a diagnostic medium for streptomycetes. Experientia, 25: 220-221.
CrossRef  |  Direct Link  |  

30:  Nonomura, H., 1974. Key for classification and identification of 458 species of the Streptomyces included in ISP. J. Ferment. Technol., 52: 78-92.

31:  Pineau, R., L. Sembiring and M. Godfellow, 2003. Streptomyces yatensis sp. nov.; a novel bioactive streptomycete. Antonie van Leewenhoek, 83: 21-26.

32:  Pospiech, A. and B. Neumann, 1995. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet., 11: 217-218.
CrossRef  |  

33:  Pridham, T.G. and D. Gottlieb, 1948. The utilization of carbon compounds by some Actinomycetales as an aid for species determination. J. Bacteriol., 56: 107-114.
Direct Link  |  

34:  Saitou, N. and M. Nei, 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406-425.
CrossRef  |  PubMed  |  Direct Link  |  

35:  Shadomy, S., 1987. Preclinical evaluation of antifungal agents. In: Recent Trends in the Discovery. Prous Science, New Jersey, pp: 8-14

36:  Shirling, E.B. and D. Gottlieb, 1966. Methods for characterization of Streptomyces species. Int. J. Syst. Evol. Microbiol., 16: 313-340.
CrossRef  |  Direct Link  |  

37:  Shirling, E.B. and D. Gottlieb, 1972. Cooperative description of type cultures of Streptomyces V. additional description. Int. J. Syst. Bacteriol., 22: 265-394.

38:  Stackebrandt, E. and C.R. Woese, 1981. Towards a phylogeny of the actinomycetes and related organisms. Cyrr. Microbiol., 5: 197-202.

39:  Thompson, J.D., D.G. Higgins and T.J. Gibson, 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res., 22: 4673-4680.
CrossRef  |  PubMed  |  Direct Link  |  

40:  Tresner, H.D., M.C. Davies and E.J. Backus, 1961. Electron microscopy of Streptomyces spores morphology and its role in species differentiation. J. Bacteriol., 81: 70-80.

41:  Tsao, P.H., C. Liben and G.W. Kitt, 1960. An enrichment for isolating actinomycetes that produce diffusable antifungal antibiotics. Phytopathology, 50: 88-89.

42:  Vilshes, C., C. Mendez, C. Hardisson and J.A. Salas, 1990. Biosynthesis of oleandomycin by Influence of nutritional conditions and development of resistance. J. Gen. Microbiol., 139: 1447-1454.
Direct Link  |  

43:  Watve, M.G., R. Tickoo, M.M. Jog and B.D. Bhole, 2001. How many antibiotics are produced by the genus Streptomyces? Arch. Microbiol., 176: 386-390.
CrossRef  |  Direct Link  |  

44:  Weisburg, W.G., S.M. Barns, D.A. Pelletier and D.J. Lane, 1991. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol., 173: 697-703.
PubMed  |  Direct Link  |  

45:  Wu, R.Y., 1984. Studies on the Streptomyces SC4. II- Taxonomical and biological characteristics of Streptomyces strain SC4. Bot. Bull. Acad. Sci., 25: 111-123.

©  2022 Science Alert. All Rights Reserved