MATERIALS AND METHODS

Clinical examination and necropsy: The study was conducted in the Department of Pathology, Faculty of Veterinary Science, Bangladesh Agricultural University (BAU), Mymensingh. Layer chickens (N = 2000) in various farms of Mymensingh district, Bangladesh with a history of progressive weight loss, suspected as a case ATB and constituted the study materials. These cases were investigated extensively to identify the pathogen and specific cause of illness. A total of five clinically infected layer chickens (about 45 weeks of age) and five apparently healthy layer chickens from these farms was investigated. The clinical examination was carried out in farm and necropsy was carried out with extreme care to avoid zoonotic spread. Gross tissue changes observed were recorded by systemic dissection. The tissue samples were collected in 10% neutral buffered formalin for histopathological investigation. Portion of liver, spleen and intestine was snap frozen for the extraction of genomic DNA and PCR detection of the variant of Mycobacterium.

Histopathological examination of lesions: Formalin-fixed lungs, liver, spleen, muscle, kidney and intestine from the suspected layer chickens were processed for paraffin embedding, sectioning and staining with haematoxylin and eosin (H and E) and Ziehl Neelsen staining²⁰. The stained tissues on to the slides were examined at low (10x) and high (100x) power microscopic fields, images were captured and analyzed.

PCR detection of specific cause of ATB: The genomic DNA from liver, spleen and intestine of infected and carrier birds were extracted using traditional methods. Briefly individual tissue (2 g) was crushed in liquid nitrogen, dissolved in 600 μL of cell lysis buffer, transferred in an eppendorf tube and vortexes to wet the tissues. The solution containing tissue lysate was incubated at 56°C for 2 h. The solution in the tube was centrifuged at 1000 g for 5 min and supernatant was collected. Equal volume (400 μL) of phenol chloroform isoamyle alcohol (PCI) was added, vortexed and spin down at 10000×g for 2 min. Supernatant (top layer, 300 μL) was collected in a fresh tube, added 1/10th volume of 5 mol NaCl and 2.5x ice cold ethanol. The mixture was incubated on ice for 30 min and extracted DNA using standard procedure²¹. The DNA samples were evaluated both quantitatively and qualitatively using spectrophotometer (A²⁶⁰-A²⁸⁰) and agarose gel electrophoresis, respectively. The concentration of extracted DNA obatined were between 200-300 ng μL^–1 of solution.

A uniplex PCR (192 bp) was adapted in a 25 μL reaction volume to detect fragment of 16S rRNA gene of M. avium. Forward (AGAGTTTGATCCTGGCTCAG) and reverse primers (ACCAGAAGACATGCGTCTTG), 20 pmol of each were used¹⁸ per reaction in a programmable thermocycler using PCR Kit (Promega, USA). The thermal profile consisted of an initial denaturation for 4 min at 95°C followed by 40 cycles of DNA amplification reaction in a Master Cycler (Master Cycler Gradient, Eppendorf, Germany). The condition of PCR amplifications were denaturation for 60 sec at 95°C, annealing for 90 sec at 56°C and extension for 60 sec at 72°C followed by a final extension for 10 min at 72°C. The PCR reactions were held at 4°C and the reaction was terminated by adding 3 μL of 50 mM EDTA. The PCR products were analyzed by electrophoresis in 1.5% agarose gel, stained with ethidium bromide and examined under UV light using an image documentation system (Cell Biosciences, Alphalmager HP, USA).

RESULTS AND DISCUSSION

Several mycobacterial species are involved with the tuberculous lesions in birds. Avian TB is mostly caused by highly pathogenic M. a. avium (serovars 1, 2 and 3), low pathogenic M. a. avium (serovars 4-20 known as M. intracellulare) and M. genavense. Highly sensitive PCR technique is required to selectively detect infectivity in birds due to a specific serovar. The incidence of ATB in layer chickens is not a regular finding and there are limited literature describing the incidence of ATB in chickens in Bangladesh. The incidence of ATB in pet birds is higher and farm chickens may catch infection from the pet birds²². Some of the reasons of the incidence of the infection in pet birds are age of the host, population density and the ability of organism to survive environmental inclemency⁷. The primary lesions of ATB in birds mostly seen in the intestinal tract. Intestinal lesions take the form of deep ulcers filled with caseous material containing many Mycobacterium and these are discharged into the lumen and appear in the faeces. Similar findings are also described earlier²³ and reported that fecal contamination of water, soil, or feed thus enabling transmition of infection²⁴. However, the source of infection in the layer farms was not identified but free living rodents, crows or other birds may play role in disease transmission. According to OIE²⁵ the infectivity in pet birds or captive chicken can be identified by using tuberculin test or serological tests. If acid-fast bacilli are not seen in tissues but typical tuberculous lesions are present in internal organs of birds, culture of the organism was suggested. However, nucleic-acid-based technologies like PCR is the most sensitive and recommended technology to detect and differentiate causal agents of ATB with the DNA extracted directly from tissue samples. In this study infectivity of layer chickens due to ATB was made by using traditional techniques like clinical signs, necropsy, routine H and E staining and Ziehl-Neelsen staining of tissue sections. A uniplex PCR was adapted for specific detection of pathogenic variant of ATB and compare the efficcacy of traditional techniques with the PCR in terms of sensitivity and specificity to detect pathogenic variant of ATB in layer chicken.

History, clinical sings and gross pathology: In most cases, infected birds showed little sign of illness, but they may eventually become lethargic and emaciated. Many affected birds showed diarrhoea, comb and wattles may regress and become pale. Under intensive husbandry conditions, sudden death may occur, often associated with severe lesions in the liver; such lesions are easily observed at necropsy. Similar findings were also described by the World Assembly of Delegates²⁵ of the OIE in May, 2014 and suggested that detection of ATB in elderly captive, wild or pet birds are needed to diagnose with care. In this study the farms investigated have had about 2000 layer chickens and during on farm investigation, about 45 birds showed signs of illness comprising emmaciation, drop of egg laying, unthriptiness and reduced feed intake. The affected chickens at necropsy appeared cachectic (Fig. 1a), showed thin musculature and prominent kill bone manifested as "Knife edged" (Fig. 1b). Some birds were adapted in sitting position. Jerky hopping gait with unilateral or bilateral lameness was observed in 10-12% affected chickens. Thoen⁵ suggested that the lameness in infected birds was due to tuberculous lesions in the leg bones and joints but such lesions in bone and joint was not seen in this study. About 80-85% birds in the infected farm were apparently healthy except a history of progressive weight loss. The layer birds at their age of 45 weeks stop laying eggs and this was due to loss of body condition. Case fatality was seen in 4-5% cases due to rupture of liver and or spleen and massive congestion in lungs. Previous study⁹ also described such lesions in liver and spleen but the case fatality described was a bit lower (2-3%) than the present study. In some case, the birds were died suddenly in good bodily condition and without advanced lesions of tuberculosis. Tell et al.²³ reported that the death was due to multiple organ failure and appeared similar with the finding of this study. The body temperature of the affected bird was normal, even in severe cases. There were multiple whitish nodular masses on liver (Fig. 1c, 2a) and enlargement of spleen (Fig. 2b), these are typical lesions of avian TB²⁶. Affected part of intestine especially ileum appeared thicker (Fig. 2c), containing whitish nodular lesions and diffuse thickening in various part of ileum.

Fig. 1(a-c):	Fourty five weeks old layer chicken (a) Obtained from a commercial farm showed progressive weight loss, muscular atrophy and prominent kill bone, (b) Black arrow at necropsy and (c) Liver of the suspected chickens were larger and containing multiple diffuse whitish necrotic patches

Fig. 2(a-c):	Pathological changes observed in the (a) Liver, (b) Spleen and (c) Intestine of the suspected layer chickens. There were numerous whitish nodular lesion embeded in liver (a, white arrow). Spleen of infected chickens appeared larger (b, black arrow) and there was diffuse thickening in various part of ileum (c, yellow arrow)

Typical nodular lesions as seen in the liver and spleen, leading to enlargement of the organs was due to the formation of new granulomas. Previous studies described that the lungs of ATB infected birds was ordinarily free from granulomatous lesions even in advanced cases^13,23 but massive congestion as seen in the lungs of infected birds was not described in previous study.

The occurance of TB in free living birds²⁷ including raptors were reported earlier, describing disseminated form where lesions were distributed in multiple organs including digestive tract, liver and spleen. Gross lesions of the affected layer chicken as seen in this study could be a disseminated form of ATB and involving multiple organs like spleen, liver, kidney, heart and intestine. Nodular lesion was not seen in lungs, heart and skeletal muscles. The pneumonic lesions as seen could be due to secondary to other bacterial infection. Pulmonary avian TB is only occasionally reported as in case of TB of water fowl⁸. Based on the lesions, the disease process was described in three phases: Latency, lesion development and period of cachexia. During cachexia, massive granulomas in visceral organs was seen. In the classic form of infection, which is seen in this study the tubercles or granulomas develop in multiple organs; a second form is manifested with lesions in the intestinal tract; a third type of infection often reported as diffuse granulomas, mainly seen in finches, canaries and psittacines. Previous studies^23,25 also described avian TB in three phases but the typical lesions in each phases varies in various cases and state of management. Some birds occasionally showed respiratory signs and sudden death, dyspnoea was less common but granulomatous ocular and skin lesions were prominent²⁸. The lungs of infected chickens were congested and consolidated could have microscopic lesion and were studied by means of histopathology.

Histopathological investigation: Sections of lungs, liver, spleen, kidney, heart and ileum stained with H and E staining showed multi-focal accumulation of macrophages, epitheloid cell, lymphocytes and fibrous connective tissue. Accumulation of macrophages and lymphocytes and deposition of fibrin was seen in liver (Fig. 3a), spleen (Fig. 3b) and heart (Fig. 3c). The epithelial lining of affected ileum was necrosed and slaughed off (Fig. 4a). There were accummulation of macrophages and lymphocytes in the mucosa (Fig. 4b, c) of intestine. Characteristics granulomatous reaction containing caseous necrotic center as seen in mammalian TB was seen in the central lesions of ATB. Nodular lesion was not seen in the sections of lungs but containing scatterdly distributed lymphocytes and macrophages. Similar changes in lungs of chickens infected with ATB was reported earlier^29,30. Congestions and hemorrhages in the lungs of infected birds was seen and was due to infection with Pasteurella spp., (common isolated from lungs lesion).

Fig. 3(a-c):	Section of (a) Liver, (b) Spleen and (c) Heart stained with hematoxylin and eosin. There were multifocal accummulation of mononuclear cells (white arrow) in these organs indicating chronic granulomatous reaction (10x)

Fig. 4(a-c):	Section of ilium of suspected layer chickens stained with hematoxylin and eosin showed diffuse thickening of the mucosa of illium (a) Yellow arrow, 4x, profuse infiltration of mononuclear cells in this intestinal villei, (b) Yellow arrow, 10x and degeneration and necrosis of intestinal mucosa and (c) Yellow arrow, 40x

Fig. 5(a-d):

Ziehl-Neelsen staining of acid fast bacteria in the section of (a) An infected (-ve) and uninfetced chickens of (b) Liver and (c) Spleen. Light pink color comma or rod shaped acid fast bacteria was seen in the cytoplasm of macrophages (b and c, yellow arrow, 100x) which, however, was absent in the (a) Control section. Using PCR 192 bp ampliocn specific to highly pathogenic serovar of M. a. avium was generated with the DNA extracted from the intestine (lane 1), liver (lane 2) and spleen (lane 3)

Pulmonary form of avian TB due to M. avium is not a regular finding in layer birds but occasionally seen in pigeons and water fowl⁵.

However, characteristic caseous necrotic center was not seen in all of the organs investigated, this could be due to disseminated form of TB. Disseminated form of ATB involving the digestive tract, liver and spleen of free living birds including raptors was predominant²⁷. The H and E staining of tissue section showed disseminated form of TB with granulomas in infected organs; such granulomas can also be seen in a number of diseases like coligranulomas, Heterakis gallinarum, aspergillosis etc., hence differential diagnosis is required. In order to detect acid fast bacteria in the lesion and to ensure infectivity due to acid fast bacilli, the Ziehl-Neelsen staining of tissue sections were carried out.

Ziehl-Neelsen staining of the sections of lungs, liver, spleen, kidney and intestine showed pink color acid fast bacteria in the epitheloid cells/macrophages of affected organs. Very low densities (0-1 bacteria per 100x objective) of infiltrating epitheloid cells/macrophages was seen in kidney, moderate densities in liver (1-3 organism per 100x objective, Fig. 5b) and higher densities (2-5 organism per 100x objective) in spleen (Fig. 5c). Acid fast bacteria and granuloma was not seen in the lungs of infected chickens. The sections of liver, spleen, kidney and intestine of apparently healthy chickens although showed sactterdly distributed inflammatory lesions, acid fast bacteria was not seen. The epitheloid cells in the central part of granulomas containing large numbers of pink color bacilli. Ziehl-Neelsen staining^9,26 is a special staining technique has been used to detect acid fast bacilli in tissues but cannot detect acid fast bacteria in subclinical form. Moreover, Ziehl-Neelsen staining of tissue section although detect acid fast bacterium in epitheloid cells but unable to differentiate infectivity due to variant serovars of ATB. The highly or low pathogenic variant of ATB involved was, therefore, detected using PCR.

PCR detection of ATB: Specific and reliable tests for speciation are the use of nucleic acid based technology. Commercial nucleic acid hybridisation probes have become a ‘Gold standard’ for distinction between M. a. avium and M. intracellulare³¹. The M. genavense can also be distinguished using nucleic acid hybridization probes. A concern is that the nucleic acid hybridisation probes could have led cross-reactivity among serovars of M. a. avium, which may have serious consequences³². Various in-house molecular methods have been reported to design or adapted for the identification of specific causes of ATB. The PCR method targeting fragment of 16S rRNA gene for differentiating M. avium from M. intracellulare and M. tuberculosis complex has got some advantages. The PCR technique adapted in this study was initially designed to amplify fragment of 16S rRNA gene (192 bp) of a highly pathogenic variant of M. a. avium^8,18. Results of PCR showed amplification of 192 bp fragment with the DNA extracted from intestine, liver and spleen (Fig. 5d) of clinically infected layer chickens. Such amplification was also seen with the DNA directly collected from asymptomatic birds. The clinically infected and susceptible layer chickens investigated in this study was infected with highly pathogenic variant of ATB. The ATB in layer industry due to pathogenic variant of M. a. avium causes higher rate of morbidity and lower rate of mortality. Such higher rate of morbidity and mortality in infected birds due to M. a. avium also described by Tell et al.²³ and OIE²⁵ and appeared similar with the findings of this study.

Avian TB and zoonosis: Among domestic mammals, pigs are most susceptible to ATB but clinical manifestations usually not seen. Avian TB in pigs is suspected while tuberculous lesions are seen in the lymph nodes (head and mesenteric) on meat inspection. Tuberculous lesions in pigs due to Mycobacterium a. avium usually seen at advanced stage of the disease and accounted for up to 35% of the mycobacteria isolated from such tuberculous lesions in Czech Republic³³. Cattle although resistant to the causative agent of avian TB, the tuberculous lesions due to Mycobacterium a. avium can be detected in mesenteric lymph nodes and liver on meat inspection. The isolation rate of Mycobacterium a. avium in cattle at slaughter over 2 years of age ranged³⁴ from 34.4-13.0%. However, all members of M. avium complex and M. genavense are capable of infecting humans that is refractory to treatment, especially in immunocompromised individuals^23,35. Members of Mycobacterium avium complex are classed in risk group 2 for human infection and should be handled with appropriate measures as described²⁵. The ATB was a significant threat of infectivity to poultry, human, cattle, pigs, other captive or free living birds with condemnation of carcasses during 2000-2010^{3,8,9,14,27,31}. During the last few years, there were few literatures describing the incidence of ATB in organized poultry farm as detected by necropsy and PCR^25,36,37. OIE Terrestrial Manual 2014 addressed the etiology, pathology, diagnosis and zoonotic spread of ATB in the World Assembly of Delegates²⁵ under the OIE in May, 2014. The incidence of ATB in poultry farms attract less attention by the researcher in developed countries due to proper biosecurity measures in farm operation. Due to use of unlawful farm chemicals, feed additives, feed preservatives, anticoccidials, toxin binders, growth promoters, antibiotics etc., in the poultry feed in developing country; the ATB may have re-emerged and transmitted to other animals and birds. Detection of human TB due to M. a. avium serovars 1, 2 and 3 has got little attention in most of the world including Bangladesh. It requires designing multiplex PCR to detect members of mycobacterium avium tuberculosis complex and effectively discriminating closely related mycobacterium species. The suspected poultry, farm workers, pet birds, pet animals, etc., found in suspected/infected premises requires veterinary and public health intervention to diagnose ATB at early onset and designing future diagnostic, treatment and preventive strategies accordingly.

CONCLUSION

SIGNIFICANCE STATEMENT

ACKNOWLEDGMENT

Thanks are due to the Sponsored Public Good Research (SPGR), Project Implementation Unit (PIU), Bangladesh Agricultural Research Council (BARC), Farmgate, Dhaka, Bangladesh for funding the research.