Subscribe Now Subscribe Today
Short Communication
 

Genetic Identification of Ceriops decandra (Chiru Kandal) using tRNA (Leu) Molecular Marker



S. Gurudeeban, K. Satyavani and T. Ramanathan
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

Ceriops decandra is a glabrous shrub belongs to a family Rhizophoraceae distributed in a region including Southeast India, East Africa and Australia. The present study aimed to identify a tool in identifying the mangrove at the molecular level. The chloroplast trnL region was amplified from extracted total genomic DNA using the Polymerase Chain Reaction (PCR) and sequenced. Sequence of the principal agarose gel band revealed that Ceriops decandra and deposited in NCBI with the accession No. JN871232.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

S. Gurudeeban, K. Satyavani and T. Ramanathan, 2012. Genetic Identification of Ceriops decandra (Chiru Kandal) using tRNA (Leu) Molecular Marker. Asian Journal of Plant Sciences, 11: 91-95.

DOI: 10.3923/ajps.2012.91.95

URL: https://scialert.net/abstract/?doi=ajps.2012.91.95
 
Received: December 22, 2011; Accepted: February 20, 2012; Published: May 14, 2012



INTRODUCTION

Wetland ecosystems are imperative part of the natural resource pedestal in India, which includes salt marshes, mangroves, coral reefs, seaweed and sea grass. Of these, mangroves are predominantly important in view of its central role both from the ecological and economical development. The total area of mangroves in India is estimated to be 6,740 km2 and in Tamil Nadu, mangrove coverage is about 150 km2 (Sathya and Sekar, 2012). Ceriops decandra (Griff.) Ding Hou is a mangrove shrub belongs to the family Rhizophoraceae, growing in drier mud near the inland limits of normal tides. It is originated in a region including East Africa to Australia through Madagascar, India, Bangladesh, Sri Lanka, Burma, Thailand and Malaysia. Recent research has shown that the range of C. decandra is restricted to the east coast of India and Bangladesh, Southwestern Thailand and Western part of the Malay Peninsula. Economically C. decandra barks has huge amount of non-timber forest product of tannins widely used in the fishing nets, leather and chemical industries (Datta et al., 2011). Also it has therapeutically potential triterpenoids (Prasad et al., 2011). The middle and Southern part of its range is now considered to be C. zippeliana (Sheue et al., 2009). Also few researchers reported anti-nociceptive, hepatitis, anti-diabetic and anti-oxidant property of C. decandra (Uddin et al., 2005; Magwa et al., 2006; Nabeel et al., 2010; Krishnamoorthy et al., 2011).

Genetic analysis of mangroves is urgently necessary to combat biotic and abiotic stress. Number of molecular markers such as randomly amplified polymorphic DNA, Amplified fragment length polymorphism, Inter simple sequence repeat and simple sequence repeat studies have been used mainly for genetic diversity analysis of plants (Bandyopadhyay, 2011). Among these RAPD, RFLP, Protein and ISSR markers had been used to study diversity of C. decandra (Schwarzbachl and Ricklefs, 2001). Nevertheless, these molecular markers are dominant and they do not permit the differentiation of heterozygous from homozygous accessions. These traits make them extremely suitable to study diversity in supposedly related populations. Hence, the present study was taken up to identify a tool in identifying the medicinally potential mangrove species Ceriops decandra at the genetic level using trnL marker.

MATERIALS AND METHODS

Plant material and DNA extraction: Fresh leaves of Ceriops decandra were collected from Pichavaram mangrove forest (Lat 11.42, Log 79.79) Tamil Nadu, India. The specimen was botanically certified and a voucher specimen (AUCASMB06) deposited in the Herbarium of Centre of Advanced Study in Marine Biology, Faculty of Marine Sciences, Annamalai University, India. Plant DNA was isolated by Cetyl trimethylammonium bromide (CTAB) protocol with modification described by Gurudeeban et al. (2011). The yield of DNA per gram of leaf tissue extracted was measured using a UV Spectrophotometer (Perkin Elmer, USA) at 260 nm. DNA concentration and purity was also determined by running the samples on 0.8% agarose gel.

Polymerase chain reaction and DNA sequencing: The chloroplast trnL-F regions were amplified from extracted total genomic DNA using the Polymerase Chain Reaction (PCR) method. The universal primers 1, 2, 3 and 4 (Helini Biomolecules, Chennai) of Taberlet et al. (1991) were used to amplify trnL:

trnL 5’-3’: GGTTCAAGTCCCTCTATCCC
3’- 5’: ATTTGAACTGGTGACACGAG

Polymerase chain reaction parameters were an initial denaturation of 2 min at 97°C; 30 cycles of 94°C for 1 min, annealing at 48°C for 2 min and elongation at 72°C for 1 min, followed by an elongation step of 72°C for 5 min. EtBr (Ethidium bromide) stained agarose gel was visualized under a transilluminator. The fragment of interest was excised with a clean razor blade. After removing the excess liquid, the agarose fragment was placed in the spin column. The tube was centrifuged at 5500 rpm for 40 sec for the elution of DNA. The eluent was checked by running on an agarose gel and observed on a transilluminator and the DNA fraction was subjected for sequencing using trnL-F specific primers (Helini Biomolecules, Chennai). Sequencing reactions were carried out with ABI PRISM Dye Terminator Cycle Sequence Ready Reaction Kit (Applied Biosystems Inc., USA). The obtained sequence was compared to the sequences in NCBI using the BLAST algorithm to search for close evolutionary relatives (Altschul et al., 1997).

RESULTS AND DISCUSSION

The genomic DNA of the C. decandra was subjected for the isolation of the DNA coding for trnL (Fig. 1) by using Polymerase chain reaction. The bands were cut and eluted and the DNA so obtained was subjected for sequencing. The sequence analysis demonstrated that all the corresponding bands on agarose gel belonged to C. decandra. Upon sequencing of the amplified DNA, the data obtained corresponds to 550 bases for C. decandra and deposited in NCBI with the accession No. JN871232 (Fig. 2) and the folded structure of tRNA L sequence shown in Fig. 3.

Phylogenetic association of C. decandra: Sequence of the foremost agarose gel bands revealed that C. decandra in tested leaves was 100% similarity to the trn (Leu) sequences of C. decandra found in NCBI Genome Databank. The phylogenetic tree was shown in Fig. 4. The parsimony informative of dataset consisted of 550 base-pairs with manually aligned matrix. Gaps represents as binary characters, missing data had no affect on the topology.

Image for - Genetic Identification of Ceriops decandra (Chiru Kandal) using tRNA (Leu) Molecular Marker
Fig. 1: Genomic DNA of the C. decandra, Lane-1: Lamda DNA, Lane-2: Plant DNA

The 100% bootstrap consensus tree is shown in Fig. 2. The trnL gene sequence was of C. decandra blasted against nr database and the top hits were taken and aligned by multiple sequence alignment. The picture shows the phylogenetically related sequences. Our sequence is the first entry in Genbank, there was no homologous sequence for C. decandra in India. The topology is consistent with the maximum parsimony tree, which is more resolved within the clades of Rhizophoraceae.

The chloroplast DNA trnT-F region in land plants consist series of conserved trn genes trnT (UGU), trnL (UAA) and trnF (GAA) arranged in tandem and separated by noncoding spacer regions. The region is positioned in the large single copy region, approximately 8 kb downstream of rbcL (Besendahl et al., 2000). The apparent absence of gene rearrangements in the trnT-F region made the design of plant universal primers possible. As a result, the trnL-F region, comprising the trnL intron and trnL-F spacer, has become one of the most widely used chloroplast markers for phylogenetic analyses in plants (Quandt et al., 2004). The increased number of trn sequences from a wide range of plants has allowed further study of structures, functions and evolution in diverse orders of flowering plants, in basal angiosperms, in land plants (Bakker et al., 2000; Borsch et al., 2003).

The combination of trnL sequences with chloroplast markers rbcL and matK for phylogenetic reconstruction in the tropical flowering plants reported morphological character evolution, classification (Richardson et al., 2004), biogeography and molecular dating (Richardson et al., 2004; Pirie et al., 2006; Pirie and Zapata, 2004).

Image for - Genetic Identification of Ceriops decandra (Chiru Kandal) using tRNA (Leu) Molecular Marker
Fig. 2: Partial chloroplast tRNA-Leu trnL gene sequence of medicinal mangrove Ceriops decandra

Image for - Genetic Identification of Ceriops decandra (Chiru Kandal) using tRNA (Leu) Molecular Marker
Fig. 3: Folded structure of tRNA-Leu trnL gene sequence of Ceriops decandra

These markers appeared to contain complementary phylogenetic signals, as is expected from different sequences sampled from the plastid genome (Chase and Cox, 1998) and were thus applied in combined analyses. The combined analyses yielded better resolved phylogenies, subject to higher levels of support, than those derived from individual markers.

Image for - Genetic Identification of Ceriops decandra (Chiru Kandal) using tRNA (Leu) Molecular Marker
Fig. 4: UPGMA method of phylogenetic analysis of trnL gene sequence of C. decandra compared with Rhizophoraceae clades

CONCLUSION

The present study can be utilized in identifying the mangrove species directly by using any part of the tissue in live form or even from the fossil specimens. The gene sequences of trnL-F will be the same in any part of the plant because of the presence of chloroplast and its genome is same throughout. In India, there was no sequence available in the database for medicinal mangrove till now and hence it can be exploited for the identification of mangrove species up to the level of varieties as the sequences will be more or less conserved with minor variations.

ACKNOWLEDGMENT

The authors are gratefully acknowledged to the Director and Dean, Faculty of Marine Sciences, Annamalai University, Parangipettai, Tamil Nadu, India for providing all support during the study period.

REFERENCES

  1. Altschul, S.F., T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller and D.J. Lipman, 1997. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucl. Acids Res., 25: 3389-3402.
    CrossRef  |  PubMed  |  Direct Link  |  


  2. Bakker, F.T., A. Culham, R. Gomez-Martinez, J. Carvalho, J. Compton, R. Dawtrey and M. Gibby, 2000. Patterns of nucleotide substitution in angiosperm cpDNA trnL (UAA)-trnF (GAA) regions. Mol. Biol. Evol., 17: 1146-1155.
    Direct Link  |  


  3. Bandyopadhyay, T., 2011. Molecular marker technology in genetic improvement of tea. Int. J. Plant Breed. Genet., 5: 23-33.
    CrossRef  |  Direct Link  |  


  4. Besendahl, A., Y.L. Qiu, J. Lee, J.D. Palmer and D. Bhattacharya, 2000. The cyanobacterial origin and vertical transmission of the plastid tRNA(Leu) group-I intron. Curr. Genet., 37: 12-23.
    Direct Link  |  


  5. Borsch, T., K.W. Hilu, D. Quandt, V. Wilde, C. Neinhuis and W. Barthlott, 2003. Noncoding plastid trnT-trnF sequences reveal a well resolved phylogeny of basal angiosperms. J. Evol. Biol., 16: 558-576.
    Direct Link  |  


  6. Chase, M.W. and A.V. Cox, 1998. Gene sequences, collaboration and analysis of large data sets. Aust. Syst. Bot., 11: 215-220.


  7. Datta, D., R.N. Chattopadhyay and S. Deb, 2011. Prospective livelihood opportunities from the mangroves of the sunderbans, India. Res. J. Environ. Sci., 5: 536-543.
    CrossRef  |  


  8. Gurudeeban, S., T. Ramanathan, K. Satyavani and T. Dhinesh, 2011. Standardization of DNA isolation and PCR protocol for RAPD analysis of Suaeda sp. Asian J. Biotechnol., 3: 486-492.
    CrossRef  |  Direct Link  |  


  9. Krishnamoorthy, M., J.M. Sasikumar, R. Shamna, C. Pandiarajan, P. Sofial and B. Nagarajan, 2011. Antioxidant activities of bark extract from mangroves Bruguiera cylindrica (L.) Blume and Ceriops decandra Perr. Indian J. Pharmacol., 43: 557-562.


  10. Magwa, M.L., M. Gundidza, N. Gweru and G. Humphrey, 2006. Chemical composition and biological activities of essential oil from the leaves of Sesuvium portulacastrum. J. Ethnopharmal., 103: 85-89.
    Direct Link  |  


  11. Nabeel, M.A., K. Kathiresan and S. Manivannan, 2010. Antidiabetic activity of the mangrove species Ceriops decandra in alloxan-induced diabetic rats. J. Diabetes, 2: 97-103.
    CrossRef  |  Direct Link  |  


  12. Pirie, M.D. and C.M. Zapata, 2004. Three new endemic species of Cremastosperma (Annonaceae) from the Rio Maranon basin. Amazonas Peru. Arnaldoa, 11: 7-20.


  13. Pirie, M.D., L.W. Chatrou, J.B. Mols, R.H.J. Erkens and J. Oosterhof, 2006. Andean-centred genera in the short-branch clade of Annonaceae: Testing biogeographic hypotheses using phylogeny reconstruction and molecular dating. J. Biogeog., 33: 31-46.


  14. Quandt, D., K.F. Muller, M. Stech, K.W. Hilu, W. Frey, J.P. Frahm and T. Borsch, 2004. Molecular evolution of the chloroplast trnL-F region in land plants. Monogr. Syst. Bot. Missouri Botanical Garden, 98: 13-37.


  15. Prasad, R., M.S.B. Zainol, I. Ahmad and D. Krishnaiah, 2011. Kinetics study of microwave assisted extraction of hypoglycemic active compounds from Ceriops Decandra sp. leaves using ethanol: Comparison with the soxhlet extraction. J. Applied Sci., 11: 2364-2369.
    CrossRef  |  Direct Link  |  


  16. Richardson, J.E., L.W. Chatrou, J.B. Mols, R.H. Erkens and M.D. Pirie, 2004. Historical biogeography of two cosmopolitan families of flowering plants: Annonaceae and Rhamnaceae. Philo. Trans. R Soc. Lond B Biol. Sci., 359: 1495-1508.
    Direct Link  |  


  17. Sathya, T. and C. Sekar, 2012. Mangrove eco-system and their multifunctionalities: An analysis of the provision of economic and environmental livelihoods to the fishermen communities in the South-East Coast of India. Trends Agric. Econ., 5: 31-47.
    CrossRef  |  


  18. Schwarzbach, A.E. and R.E. Ricklefs, 2001. The use of molecular data in mangrove plant research. Wetlands Ecol. Manage., 9: 205-211.
    CrossRef  |  Direct Link  |  


  19. Sheue, C.R., H.Y. Liu, C.C. Tsai, S.M.A. Rashid, J.W.H. Yong and Y.P. Yang, 2009. On the morphology and molecular basis of segregation of two species Ceriops zippeliana Blume and C. decandra (Griff.) Ding Hou (Rhizophoraceae) from Southeastern Asia. Blumea, 54: 220-227.


  20. Taberlet, P., L. Gielly, G. Pautou and J. Bouvet, 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol., 17: 1105-1109.
    CrossRef  |  Direct Link  |  


  21. Uddin, S.J., J.A. Shilpi, J. Barua and R. Rouf, 2005. Antinociceptive activity of Ceriops decandra leaf and pneumatophore. Fitoterapia, 76: 261-263.
    CrossRef  |  


©  2022 Science Alert. All Rights Reserved