MATERIALS AND METHODS

Isolation and Identification of Fusarium Isolates
Dendrobium orchids with symptoms of root and stem rot were collected from orchid nurseries in northern states of Peninsula Malaysia in 2006. The samples were collected from an orchid nursery at Agriculture Center, Relau, Penang and from two commercials orchid nurseries in Taiping, Perak.

All diseased roots and stems were cut about 3 mm and surface sterilized with 1% natrium hypochloride (NaOCl) for 2 min. Then the cuttings were rinsed immediately in distilled water, blotted dry and plated onto peptone-pentachloro-nitrobenze agar (PPA) and incubated at 27±1°C for 7 days. Mycelium developed from the tissue cuttings was sub-cultured onto Potato Sucrose Agar (PSA) and single spore technique was used to purify the Fusarium isolates.

For identification of Fusarium species, Carnation Leaf Agar (CLA) and Potato Dextrose Agar (PDA) were used for morphological characteristics observation. Species descriptions were based on the description of Nelson et al. (1983) and Fusarium Laboratory Manual (Leslie and Summerell, 2006).

Pathogenicity Test
Pathogenicity tests were conducted using Koch’s Postulate to confirm the Fusarium species as the causal agent of root and stem rot of Dendrobium orchid. The plants used were 3 years old and showed no disease symptoms.

The Fusarium isolates used were the representative of isolates, which was successfully isolated and identified from root and stem rot of Dendrobium. Two representatives from each of the Fusarium species were tested for their pathogenicity on apparently healthy Dendrobium and separate plants were used for inoculation tests on root and stem.

The root and stem of the Dendrobium were washed and surface sterilized before inoculation. For inoculation, spore suspensions (adjusted to 1x10⁶ spores mL^-1) were prepared. Twenty milliliter of the spore suspensions for each Fusarium species were sprayed on the root and stem of the plants. The control plants were sprayed with 20 mL of sterile distilled water.

The experiment was conducted in a Completely Randomized Design (CRD) with five replicates for each Fusarium species and control and grown in a plant house until disease symptoms were observed. The plants were position randomly on the bench with temperature about 28±1°C and watered daily.

Disease rating was based on a scale of 0-5 as described by Benyon et al. (1996). For assessment of pathogenicity, four roots per plant were selected randomly by cutting 3 cm section from behind the root tip. For stem, about 2-3 cm section from the margin of infected tissues were cut. After surface sterilization using 1% natrium hypochloride (NaOCl) for 2 min, rinsed in distilled water and blotted dry, the infected plant parts were plated onto PPA for reisolation of Fusarium species.

Analyses of differences between treatments were analysed by using Duncan Multiple Range Test (DMRT) and analysis of variance (ANOVA).

PCR-RFLP of ITS+5.8S
A total of 40 Fusarium isolates from root and stem rot of orchid were used in this study (Table 1). Twenty nine isolates were recovered from root and stem rot of Dendrobium and eight isolates namely, F. proliferatum (1325, 1374, 1377, 1378, 1380 and 13811), F. solani (1257) and F. oxysporum (1493) were obtained from Fusarium Culture Collection, Universiti Sains Malaysia, Penang, Malaysia. These cultures were isolated from stem rot of orchid in a disease survey conducted in the late 1999. Another three isolates comprising F. oxysporum (AP7 and AP9) and F. solani (AP8) were from root rot of Oncidium orchid obtained during this study.

For DNA extraction, mycelium was grown on Potato Sucrose Agar (PSA) and incubated for 6 days. DNA was extracted using DNeasy Plant Mini Kit (Qiagen) according to the manufacturers’ instructions. The extracted DNA was stored at -20°C until used.

The ITS+5.8S were amplified using ITS1 (5TCCGTAGGTGAACCTGCGG3) and ITS2 (TCCTCCGCTTATTGATATGC3) primers (White et al., 1990). Amplification reactions were conducted in a 25 μL 10X PCR buffer (Promega), 2.5 μL MgCl₂, 0.8 mM dNTP mix, 0.4 μM each primers, 1 unit Taq polymerase (Promega) and approximately 5 ng of template DNA. Each reaction was overlaid with 25 μL of mineral oil. Amplification was performed in a programmable thermal cycler (DNA  Engine Peltier Thermal Cycler model PTC-100) as follows, initial denaturation of 95°C for 2 min followed by 35 cycles of denaturation at 30 sec, annealing at 63°C for 1 min and extension at 72°C for 2 min. After 35 cycles, additional extension was performed at 72°C for 10 min.

Table 1:	Fusarium isolates used in molecular analysis, their host and location

The PCR product was run on 1.7% agarose gel and stained with ethidium bromide. The estimated size of the amplified ITS+5.8S was based on comparison with 100 bp marker (Promega).

The PCR products were digested with four restriction enzymes namely, EcoRI, Eco881, BsuI and MspI (Fermentas). Ten microliter of the PCR products were digested with the restriction enzymes according to the manufacturer’s instructions. The digested PCR products were separated on 1.7% agarose gel and stained with ethidium bromide. The estimated bands were based on 1 kb DNA marker (GeneRuler, Fermentas).

Restriction bands were scored based on presence (1) and absence (0) of a particular band with reference to the standard markers. A binary matrix was compiled and subjected to cluster analysis. A genetic similarity was constructed using Simple Matching Coefficient. The Numerical Taxonomy System of Multivariate Program (NT-SYS) software package version 2.0 (Rohlf, 2000) was used to analyse the data. A dendrogram was constructed using unweighted pair-group method with arithmetic averages (UPGMA) cluster analysis to infer the relationships within and between the Fusarium isolates from root and stem rot of orchid.

RESULTS

A total of 29 Fusarium isolates were isolated from root and stem rot of Dendrobium in which 14 isolates from the root and 15 isolates from the stem. Based on morphological characteristics described by Nelson et al. (1993) and Leslie and Summerell (2006), three Fusarium species were identified namely, F. oxysporum, F. solani and F. proliferatum.

The species identified from root rot of Dendrobium were F. oxysporum (six isolates) and four isolates each for F. solani and F. proliferatum. Seven F. oxysporum isolates, three F. solani and five F. proliferatum were recovered from stem rot of Dendrobium.

Twenty days after inoculation, disease symptoms were observed on the roots. Initially, the roots showed brownish discolouration and water-soaked appearance. The brownish discolouration eventually turned to dark colour which indicates rotting of the root tissues. The disease symptoms observed corresponding to the symptoms observed in the nurseries.

For infection on the Dendrobium root, F. solani (AP4) shows the highest infection with a disease rating of 3.70. There were no significant differences between the two F. solani isolates used in the test (Table 2). For F. oxysporum isolates (AT14 and AP1) there were no significant differences of disease infection between the two isolates.F. proliferatum isolates (AT11 and AT10) also showed significant difference of infection on the root.

The first symptoms on Dendrobium stems were observed 30 days after inoculation. The infected stems turned yellowish with water-soaked appearance and very friable. Severe infection could cause the plant to collapse. It was also observed that there were some degrees of rotting on a few leaves close to the stem base. However, not all the leaves showed the symptoms.

The symptom on the stem resembled those observed in the nurseries. F. oxysporum (BP1) gave the highest disease rating, but there were no significant differences between the two F. oxysporum (BP1 and BP2) isolates (Table 3). There were also no significant differences between F. solani isolates (BP5 and BT7) and F. proliferatum isolates (BT10 and BT15).

Table 2:	Mean disease rating on Dendrobium root of F. oxysporum, F. solani and F. proliferatum
Mean values in the same row followed by different superscripts are significantly different, p<0.05

Table 3:	Mean disease rating on Dendrobium stem of F. oxysporum, F. solani and F. proliferatum
Mean values in the same row followed by different superscripts are significantly different, p<0.05

Table 4:	Estimated sizes of restriction bands of F. oxysporum, F. solani and F. proliferatum using Eco881, Msp1, BsuRI dan EcoR1

The three Fusarium species were successfully recovered from the inoculated root and stem which indicated that the three Fusarium species were able to cause root and stem rot of Dendrobium orchid.

Using primer pairs of ITS1 and ITS4, a PCR product was amplified from the isolates of the three Fusarium species. Fusarium oxysporum produced approximately 550 bp band; F. solani and F. proliferatum approximately 590 bp bands.

Table 4 shows estimated sizes of the restriction bands produced after digestion of the ITS+5.8S using Eco881, MspI, BsuRI and EcoRI for F. oxysporum, F. solani and F. proliferatum. Generally, the restriction patterns produced by the restriction enzymes could differentiate between the three Fusarium species.

After digestion with Eco881, the PCR products of F. oxysporum isolates were undigested as band of 550 bp was observed which indicated that there’s no restriction sites for the restriction enzyme within the ITS+5.8S of the isolates. Digestion with MspI and EcoRI produced the same restriction patterns for all the isolates. BsuI restriction patterns were variable in which three restriction patterns were generated. The similarity values based on the restriction bands ranged from 91.7-100%.

Digestion of F. solani PCR products with Eco881, BsuI and EcoRI produced variable restriction patterns. Digestion with MspI generated the same restriction patterns for all F. solani isolates from Dendrobium root and stem rot as well as from Oncidium root rot and the stock culture (1257). The similarity value for all the isolates ranged from 75-100%.

Fusarium proliferatum isolates from Dendrobium stem and root rot as well as from the stock culture showed similar restriction patterns when digested using Eco881, MspI and EcoRI. Only BsuRI restriction patterns produced variable patterns. The similarity values of the F. proliferatum isolates ranged from 91.7-100%.

Cluster analysis based on the restriction bands formed two major clusters, I and II (Fig. 1). The cluster analysis clearly discriminate the three Fusarium species into three separate clusters in which F. solani isolates were clustered in sub-cluster A in major cluster I, F. oxysporum isolates in sub-cluster B and F. proliferatum isolates in major cluster II.

Fig. 1:	Dendrogram from UPGMA clusters analysis using simple matching coefficient based on restriction bands of F. oxysporum, F. proliferatum and F. solani from root and stem rot of orchid

DISCUSSION

From pathogenicity test, F. oxysporum, F. solani and F. proliferatum were recovered from the inoculated root and stem which indicated that the three Fusarium species were able to cause root and stem rot of Dendrobium orchid. Although F. oxysporum was the most frequent isolates isolated from the root and stem rot of Dendrobium, based on the mean disease rating, F. oxysporum gave the highest rating on the stem and F. solani on the root. F. proliferatum could also cause root and stem rot of Dendrobium. The results indicated that a complex of Fusarium species could be pathogenic to the orchid and suggested that F. oxysporum could be the main causal agent of stem rot and F. solani, the main causal agent of root rot.

The three Fusarium species have been reported to be pathogenic to orchidaceous plant in several countries. Fusarium oxysporum, F. solani and F. proliferatum have been associated with root rot of Cymbidium orchid in Australia (Benyon et al., 1996), dry rot of Cymbidium (Lee et al., 2002) and root rot of moth orchid (Phalaenopsis spp.) (Kim et al., 2002) in Korea. Fusarium proliferatum has also been reported to cause yellow spot disease in Cymbidium in Japan by Ichikawa and Aoki (2000) and leaf spot of Cymbidium hybrida in Korea (Kim et al., 2002). Fusarium solani has been recorded as root pathogen on orchids by Burnett (1975). Although F. subglutinans was isolated and associated with root rot and yellow spot disease of orchidaceous plants (Benyon et al., 1996; Ichikawa and Aoki, 2000), however in this study, F. subglutinans was not recovered.

PCR-RFLP of ITS+5.8S have been used by Hyun and Clark (1998) on characterization of F. lateritium from sweet potato, Suga et al. (2000) in distinguishing F. solani forma speciales and Lee et al. (2000) on comparison of genetic relationship of 12 Fusarium species from different sections.

In PCR-RFLP of ITS+5.8S, restriction patterns produced by BsuRI revealed variations within F. oxysporum, F. solani and F. proliferatum isolates as well as MspI restriction patterns of F. proliferatum isolates and EcoRI restriction patterns for F. solani isolates. Intraspecies variations could be due to minor changes in nucleotide composition within the ITS+5.8S which may lead to different restriction patterns. Similar results were obtained by Konstantinova and Yli Mattila (2004) in their studies using PCR-RFLP of intergenic spacer to analyse Fusarium species in Section Sporotrichiella. Further studies using ITS+5.8S sequence analysis would be necessary to compare the genetic variations observed in Fusarium isolates from root and stem rot of orchid.

In conclusion, three Fusarium species were isolated from root and stem rot of Dendrobium. Based on morphological characteristics, the Fusarium species were identified as F. oxysporum, F. solani and F. proliferatum. From pathogenicity test, the three Fusarium species were found to be pathogenic, causing root and stem rot on Dendrobium. PCR-RFLP of ITS+5.8S analysis, offers a convenient tool for characterization and analyzing variations of Fusarium species associated with root and stem rot of Dendrobium orchid.

ACKNOWLEDGMENT

The research project was funded by Universiti Sains Malaysia Short Term Grant (304/PBIOLOGY/636117).