Research Article
 

Physiological Character of Palm Oil Seedling due to Lack of Water with Bokashi Treatment



Agnes Imelda Manurung, Bilter A. Sirait and R. Sabrina
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

Background and Objective: The problem of drought is a scourge for oil palm farmers in Indonesia, the development of oil palm plantations is directed to areas that have dry land potential with a dry climate, longer dry months and lower rainfall. The purpose of this study was to determine the physiological character of oil palm seedlings due to water stress and Bokashi treatment. Materials and Methods: The experiment was conducted in June to September, 2021. The experiment used a non-factorial completed randomized design with 9 treatments and 2 replications. The observed variables were leaf chlorophyll, total protein, total sugar and p5CS gene expression level by the qPCR method. Results: The results showed that the less water, the smaller the leaf chlorophyll, while the total sugar and total protein tended to be higher and the p5CS gene expression level by qPCR method activity under water stress conditions of 14.58 was higher than under conditions of sufficient water. Conclusion: The physiological character of oil palm seedlings differs in the treatment with sufficient water and lack of water.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Agnes Imelda Manurung, Bilter A. Sirait and R. Sabrina, 2022. Physiological Character of Palm Oil Seedling due to Lack of Water with Bokashi Treatment. Asian Journal of Crop Science, 14: 20-23.

DOI: 10.3923/ajcs.2022.20.23

URL: https://scialert.net/abstract/?doi=ajcs.2022.20.23
 
Copyright: © 2022. This is an open access article distributed under the terms of the creative commons attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.

INTRODUCTION

Abiotic stress certainly reduces plant growth, development and productivity. Drought-tolerant plants are regulated by a complex network of genes where microRNA plays an important role in drought-tolerant plants1, in this case, there is a role of micro RNA in drought tolerance2 plants. On a plant, overexpression of certain genes stabilizes a set of mRNA to increase ATP production so that it is more tolerant to drought3. So it is clear that the high p5CS gene expression level by qPCR method activity is maintained to support protein synthesis4. The PCR method is very efficient, simple and is an easy technique for measuring gene expression. From previous studies, it was also found that only 40-44% of transcripts would participate in the drought stress response as functional proteins4-9. Even longer RNA activity in drought-tolerant pea plants (identification of drought)1,4,10. Drought tolerant transgenic rootstocks can be developed1,3,4,11.

The problem of developing oil palm cultivation in dry areas can no longer be avoided because climate change has become a reality today, while physiological characteristics due to lack of water are very important to know as scientific capital for development in dry areas.

The objective of this study was to determine the physiological character of oil palm seedlings due to water stress and Bokashi treatment, namely leaf chlorophyll, the total sugar and total protein and the p5CS gene expression level by the qPCR method.

MATERIALS AND METHODS

Study area and sample collection: After the seedlings are obtained from the PPKS, the sprout bags are carefully removed and placed in a shallow tray filled with water to keep the sprouts fresh. The current research used the Tenera Simalungun variety obtained from PPKS (Pusat Penelitian Kelapa Sawit, Medan, Indonesia) and the experiment was carried out in a plastic house to determine several physiological characteristics. This experiment was conducted in June to September, 2021.

Methodology: Current study used a non-factorial completely randomized design with 9 treatments namely:

B1W1 (Bokashi 45 g/polybag+daily watering)
B1W2 (Bokashi 45 g/polybag+watering 2×1 week)
B1W3 (Bokashi 45 g/polybag+watering 1×1 week)
B2W1 (Bokashi 30 g/polybag+daily watering)
B2W2 (Bokashi 30 g/polybag+watering 2×1 week)
B2W3 (Bokashi 30 g/ polybag+watering 1×1 week)
B3W1 (Bokashi 15 g/polybag+daily watering)
B3W2 (Bokashi 15 g/polybag+watering 2×1 week)
B3W3 (Bokashi 15 g/polybag+watering 1×1 week), each treatment was repeated 2 times

Experimental variables observed at 56 days after planting included: Total leaf chlorophyll, total sugar, total protein and p5CS gene expression level by qPCR method. To measure leaf chlorophyll using a spectrophotometer by following the procedures carried out by Latifa et al.12. To measure procedures of total protein content are similar to those worked by Sarkar et al.13.

In the calculation of total sugar, after the supernatant was heated to 85°C, 3-5 mL was transferred to a measuring flask and then added with distilled water to 50 mL, then 2 mL was taken and 4 mL of anthrone was added, heated to 85°C for 15 min, then removed and cooled on ice and then read at a wavelength of 630 nm. The next procedure is as done by Islam et al.14.

After DNA isolation, the next several steps are gene expression validation using RT-qPCR using the P5CS target gene. The primers used are F: 5' CGGTTGGAAGATTGGGAGCT 3' and R: 5' TTGGGGTTTCTGAAGGTCGG 3', RT-qPCR conditions according to the procedure holding stage 95°C 2 min, cycling stage 45×cycles 95°C 5 sec, annealing 58°C 30 sec. Melting stage 95°C 15 sec, step and hold 60°C 1 min. This follows the procedure previously worked by Turhadi et al.5.

Statistical analysis: An analysis of variance was used data processing, was used for data processing and if the treatment was significant then Duncan’s average difference test at the 5% level was done. Response variables were observed in USU and other places.

RESULTS

The result of Duncan’s mean difference test as a continuation of the results of the analysis of variance can be seen in Table 1.

Leaf chlorophyll from Table 1, it was found that B1W1 (Bokashi 45 g/polybag+daily watering l) produced the highest leaf chlorophyll followed by B1W2 (Bokashi 45 g/polybag+watering 2×1 week) which was not significantly different while the lowest total chlorophyll in the B3W3 treatment (Bokashi 15 g/polybag+watering 1×1 week).

Table 1: Chlorophyll content, total protein, total glucose and p5CS gene expression level by qPCR method
Treatments
Total leaf chlorophyll
Total protein (% dw)
Total glucose (%) (cg/cg)
p5CS gene expression level by qPCR method
B1W1
18.16ef
4.68a
61.00a
1.00
B1W2
18.15ef
4.69a
62.00a
B1W3
18.08ef
4.80ab
63.00a
B2W1
16.58de
4.90b
66.00ab
B2W2
15.01cd
4.91bc
68.00abc
B2W3
13.38bc
4.93bc
71.00abc
B3W1
17.20def
4.96bc
73.00abc
B3W2
12.88b
5.11cd
80.00bc
B3W3
9.825a
5.16d
83.00c
14.58
Numbers followed by the same letter in the same column are not different from the LSD test at the 5% level

Furthermore, the highest total protein was produced by B3W3 followed by B3W2 treatment, while the smallest total protein was produced by B1W1 treatment. The highest total glucose was also produced by the B3W3 treatment, followed by the B3W2 treatment while the B1W1 treatment produced the smallest total glucose.

From Table 1 it can also be seen that the B1W1 treatment produced a p5CS gene expression level by qPCR method only 1 time, while the B3W3 treatment was 14.58.

DISCUSSION

In general, the results of the study revealed that when oil palm seedlings lack water, the total leaf chlorophyll decreases, whereas the total protein and total glucose increase. These results are not much different from the results of previous studies, including for other commodities4-10 and the expression of genes related to the formation of osmoprotectants is increased5-7. From the results of the study, it can be seen that the role of Bokashi is very important, in the future to a certain extent it can be used to reduce the negative impact of water shortages. Likewise, gene activity in water shortages, p5CS gene expression level by qPCR method increased 14.58 times more actively than with sufficient water as recommended4-10. Decreased water supply causes a water deficit15-17 and has been extensively studied in leaves18-20. Drought causes changes in turgor pressure, osmotic pressure and water potential. Thus, drought will cause cell shrinkage, a decrease in cell volume and a decrease in turgor pressure so that it inhibits growth, meaning that the enlargement and elongation of cells are disrupted so that leaf expansion is inhibited, by itself the number of chlorophyll decreases. In addition, it can also increase the viscosity of cell fluid, resulting in protein aggregation and denaturation as well as an increase in the concentration of solutes, which in excess can be toxic. Drought also destroys the chlorophyll pigment and deterioration of thylakoid function19. Bokashi is only able to support the formation of chlorophyll with the availability of water and is less functional if there is a lack of water, on the other hand, total protein and total glucose increase with watering once per week. Bokashi is organic material rich in biological sources with a fermentation process of organic matter using EM4 technology (effective microorganism 4). According to information from the producer, EM4 contains Azotobacter sp., Lactobacillus sp., yeast, photosynthetic bacteria and cellulose-decomposing fungi, so it is strongly influenced by the ratio of the C/N raw materials used. As is known, the main functions of chlorophyll in the photosynthesis process, namely utilizing solar energy and triggering CO2 fixation to produce carbohydrates. One of the factors that influence the formation of chlorophyll in water so if there is a lack of water, the formation of chlorophyll will be inhibited19-21. This research complements and enriches the repertoire of knowledge, especially the physiological character which is very useful for the educated. Knowing gene expression quickly in palm oil seedlings with the qPCR method on the treatment lack of water. With a lack of water, the physiological character of oil palm seedlings can be predicted. It is not known whether the results of this study apply to all varieties of oil palm and in various places in Indonesia.

CONCLUSION

The less water, the smaller the leaf chlorophyll, while the total sugar and total protein tended to be higher and the p5CS gene expression level under water stress conditions of 14.58 was higher than under conditions of sufficient water.

SIGNIFICANCE STATEMENT

This experiment discovers the physiological characteristics of palm oil seedlings due to a lack of water. In the future, it is suspected that the use of Bokashi can reduce the severe negative impact of water stress. Thus, a new theory is found that the less water, the smaller the leaf chlorophyll, while the total sugar and total protein tended to be higher and the p5CS gene expression level by qPCR method activity under stress conditions of 14.58 was higher than under conditions of sufficient water, all response physiological character can different between water stress condition and sufficient of water may be arrived.

ACKNOWLEDGMENTS

We express our thanks to UDA Agriculture Faculty students and also to the Board of Darma Agung University Foundation for their help both materially and morally.

REFERENCES

  1. Liu, M., H. Yu, G. Zhao, Q. Huang, Y. Lu and B. Ouyang, 2017. Profiling of drought-responsive microRNA and mRNA in tomato using high-throughput sequencing. BMC Genomics, Vol. 18.
    CrossRef  |  Direct Link  |  


  2. Ferdous, J., S.S. Hussain and B.J. Shi, 2015. Role of microRNAs in plant drought tolerance. Plant Biotechnol. J., 13: 293-305.
    CrossRef  |  Direct Link  |  


  3. Bang, S.W., H.S. Lee, S.H. Park, D.K. Lee and J.S. Seo et al., 2021. OsCRP1, a ribonucleoprotein gene, regulates chloroplast mRNA stability that confers drought and cold tolerance. Int. J. Mol. Sci., Vol. 22.
    CrossRef  |  Direct Link  |  


  4. Azzeme, A.M., S.N.A. Abdullah, M.A. Aziz and P.E.M. Wahab, 2016. Oil palm leaves and roots differ in physiological response, antioxidant enzyme activities and expression of stress-responsive genes upon exposure to drought stress. Acta Physiologiae Plant., Vol. 38.
    CrossRef  |  Direct Link  |  


  5. Turhadi, H. Minarsih, I. Riyadi, Priyono and A. Budiani, 2020. Physiological responses and P5CS gene expression of transgenic oil palm plantlet induced by drought stress. Menara Perkebunan, 88: 69-78.
    CrossRef  |  Direct Link  |  


  6. Barichello, D., R. Farinacio, C.C.N. dos Santos, G.A. Andrade and G.T. Nagashima et al., 2017. Drought-tolerant transgenic Swingle Citrumelo controls accumulation of proline modulating the expression of key genes of the proline metabolism. Citrus Res. Technol., 38: 139-150.
    CrossRef  |  Direct Link  |  


  7. Wang, L., M. Lee, B. Ye and G.H. Yue, 2020. Genes, pathways and networks responding to drought stress in oil palm roots. Sci. Rep., Vol. 10.
    CrossRef  |  Direct Link  |  


  8. Lee, J., H.B. Kim, Y.H. Noh, S.R. Min and H.S. Lee et al., 2018. Sugar content and expression of sugar metabolism-related gene in strawberry fruits from various cultivars. J. Plant Biotechnol., 45: 90-101.
    CrossRef  |  Direct Link  |  


  9. Li, Y., C. Liu, J. Zhang, H. Yang and L. Xu et al., 2018. Variation in leaf chlorophyll concentration from tropical to cold-temperate forests: Association with gross primary productivity. Ecol. Indic., 85: 383-389.
    CrossRef  |  Direct Link  |  


  10. Jain, A.K., S.M. Basha and C.C. Holbrook, 2002. Identification of drought-responsive transcripts in peanut (Arachis hypogaea L.). Electron. J. Biotechnol., 4: 59-67.
    CrossRef  |  Direct Link  |  


  11. Niu, X., N. Zhai, X. Yang, M. Su and C. Liu et al., 2022. Identification of drought-resistant genes in Shanlan upland rice. Agriculture, Vol. 12.
    CrossRef  |  Direct Link  |  


  12. Latifa, R., S. Hadi and E. Nurrohman, 2019. The exploration of chlorophyll content of various plants in city forest of Malabar Malang. Bioedukasi, 17: 50-62.
    CrossRef  |  Direct Link  |  


  13. Sarkar, S., M. Mondal, P. Ghosh, M. Saha and S. Chatterjee, 2020. Quantification of total protein content from some traditionally used edible plant leaves: A comparative study. J. Med. Plants Stud., 8: 166-170.
    CrossRef  |  Direct Link  |  


  14. Islam, S., M. Akond, I. Islam and Z. Adam, 2017. Soluble sugar contents, total phenolic, and antioxidant capacity in a diverse set of Amaranthaceae accessions. Int. Food Res. J., 24: 2009-2016.
    Direct Link  |  


  15. Sirait, B.A., A.I. Manurung, O.M. Samosir, R.G. Marpaung, Nurhayati and C. Manalu, 2021. Growth palm oil seedling (Elaeis guineensis Jacq.) via NPK fertilization and different frequency of watering. J. Agron., 20: 1-8.
    CrossRef  |  Direct Link  |  


  16. Sirait, B., A.I. Manurung, E. Panjaitan and L. Siregar, 2020. ABA content of palm oil seedlings (Elaeis guineensis Jacq.) with vedagro treatment on water stress. Asian J. Crop Sci., 12: 147-151.
    CrossRef  |  Direct Link  |  


  17. Manurung, A.N.H., Sudradjat and Haryadi, 2015. Optimization rate of organic and NPK compound fertilizers on second year immature oil palm. Asian J. Appl. Sci., 3: 375-381.
    Direct Link  |  


  18. Suryanto, T., A. Wachyar and Supijatno, 2015. The growth of oil palm (Elaeis guineensis Jacq.) seedlings at various media and containers in double stage nursery. Asian J. Appl. Sci., 3: 664-671.
    Direct Link  |  


  19. Ashraf, M. and P.J.C. Harris, 2013. Photosynthesis under stressful environments: An overview. Photosynthetica, 51: 163-190.
    CrossRef  |  Direct Link  |  


  20. Farooq, M., A. Wahid, N. Kobayashi, D. Fujita and S.M.A. Basra, 2009. Plant drought stress: Effects, mechanisms and management. Agron. Sustainable Dev., 29: 185-212.
    CrossRef  |  Direct Link  |  


  21. Ansar, M., Bahrudin, S. Darman and Paiman, 2020. Application of bokashi fertilizer and duration of water supply to increase growth, yields, and quality of shallot in dryland. Int. J. Des. Nat. Ecodyn., 15: 711-719.
    CrossRef  |  Direct Link  |  


©  2023 Science Alert. All Rights Reserved