INTRODUCTION
In western and developed countries, shrimp is considered as a potential health
risk food for consumer due to its intended uncooked/minimally processed direct
consumption. Contamination of uncooked raw shrimps by Salmonella was
reported in many previous studies (Ahmed and Anwar, 2007).
Pathogens from shrimp may be transmitted to humans when they are eaten undercooked
or minimally processed or when other foods, which have been cross-contaminated
by pathogens from shrimp, are eaten (Khan et al.,
2007). Vibrio parahaemolyticus is a common food borne pathogen in
Japan where infections have been linked to the consumption of aquaculture fish
such as shrimp (Khan et al., 2007).
Salmonella sp. is fecal origin and is not indigenous to the aquatic
environments (Akintola and Bakare, 2011). Salmonella
is considered among the most important enteric food borne pathogen whose presence
in the food constitutes a severe health hazard (Fadel and
Ismail, 2009; Malkawi and Gharaibeh, 2004). There
are many reports on food-borne illness due to Salmonella contamination
(Ahari et al., 2009). Vibrio parahaemolyticus
is an autochthonous bacterium in the aquatic ecosystem and is known to be associated
with infections in humans and aquatic animals (Khan et
al., 2007).
Now-a-day PCR based molecular detection methods for analysis of food and water
are gaining global interest for their rapidity and high sensitivity. PCR-based
methods have better sensitivity and specificity for rapid detection of food
borne pathogens (Yasmin et al., 2007). PCR has
become the method of choice in recent times for monitoring of microorganisms
from food samples because of its simplicity, rapidity, reliability, reproducibility,
sensitivity and specificity (Seidavi et al., 2008).
On the other hand, conventional selective media culture and biochemical confirmation
based methods for detection of pathogens are time consuming. These methods take
several days to make the results available, thus increasing the risk of uptake
and/or transmitting pathogens. Very often pathogens are present in food in very
low numbers against high background of indigenous microflora and complex matrix
system rendering recovery of low level of target organisms difficult (Sherfi
et al., 2006).
Unlike uniplex (one target sequence based) PCR methods, multiplex PCR allows
the simultaneous amplification of more than one target sequence in a single
PCR reaction. Multiplex PCR saves considerable time and effort and decrease
the number of reactions to be performed in order to assess the possible presence
of microorganisms (Seidavi et al., 2008). Multiplex
PCR system has been confirmed to be able to detect food pathogens with compatible
or superior sensitivity to the conventional method over the same time period
(Kawasaki et al., 2005).
The current study is aimed at development of a multiplex PCR method for simultaneous detection of Salmonella spp. and Vibrio parahaemolyticus present in shrimp samples.
MATERIALS AND METHODS
This study was carried out from March, 2011 to January, 2012 in Industrial Microbiology Laboratory of Institute of Food Science and Technology (IFST), Bangladesh Council of Scientific and Industrial Research (BCSIR), Bangladesh.
Reagents and media: PCR reagents were purchased from Promega (Madison, WI, USA). PCR primers were synthesized by 1st Base (Singapore). Bacteriological media and broths were purchased from Oxoid (Hampshire, England) and Hi-Media, India. The rest of the materials and chemicals and reagents used in this study were purchased from Sigma Chemical Co. (St Louis, MO, USA).
Bacterial strains and culture maintenance: The bacterial strains namely Bacillus cereus ATCC 10876, Shigella flexneri ATCC 12022, Staphylococcus aureus ATCC 25923, Salmonella typhi strain ATCC 65154 and Vibrio parahaemolyticus strain ATCC 17802 were used in this experiment and were collected from master culture of Industrial Microbiology Laboratory, IFST, BCSIR, Dhaka. The working cultures were maintained in trypticase soy agar (TSA; Oxoid) slants at 4°C. Bacterial strains were usually grown in trypticase soy broth (TSB; Oxoid) containing 0.6% yeast extract in a shaking incubator at 37°C overnight. For viable cell determination, serial decimal dilutions of samples with phosphate buffered saline (PBS, pH 7.2) were made and plated on Bismuth Sulphide agar (Hi-Media, India) for Salmonella typhi and on thiosulphate citrate bile salt agar (Hi-Media, India) for Vibrio parahaemolyticus. The plates were then incubated at 37°C for 24 to 48 h before the colonies were counted.
Selection of genes and primers: Genes selected for this study were tdh
for Vibrio parahaemolyticus and sefA for Salmonella typhi.
Primer sequence for tdh was tdh D3 (5'CCACTACCACTCTCATATGC3')
and tdh D5 (5'GGTACTAAATGGCTGACATC3') (Hara-Kudo
et al., 2003). Primer sequence for sefA was A058 (5'GATACTGCTGAACGTAGAAGG3')
and A01 (5'GCGTAAATCAGCATCTGCAGTAGG 3') (Oliveira
et al., 2003). The product size for tdh gene amplification
product is 250 bp and for sefA gene is 470 bp.
DNA extraction from target organisms: DNA from working cultures of target
organisms were extracted by phenol/chloroform and ethanol precipitation method
(Wilson, 1987). Bacterial cells were grown overnight in
nutrient broth at 37°C, aerated by shaking at 120 rpm in a shaking incubator.
Bacterial cells were harvested by centrifuging the culture at 10000 rpm for
5 min. The supernatant was discarded and cell pellet was taken. The cell pellet
was washed twice with sterile physiological saline for removing residual culture
medium from the cells and was subjected to treatment with DNA extraction solution
I (tris HCl+EDTA+sucrose) for 30 min at 37°C on a water bath in order to
disrupt cells. Then de-proteinization was done using DNA extraction solution
II (proteinase K+SDS+NaCl) at 55°C for 1 h on a water bath. Phenol: chloroform:
isoamylalcohol mixture was used to precipitate proteins. The cell extract was
mixed gently with the solvent. The nucleic acids were separated in the aqueous
layer by centrifugation at 10000 rpm for 5 min. The aqueous solution of DNA
was then removed using micropipette. The DNA was then concentrated by ethanol
precipitation in the presence of Sodium acetate. After centrifuging and washing
with 70% ethanol solution the final pellet was taken and suspended in TE buffer.
This suspension was then stored at 4°C for further use.
Quantification and purity of DNA: Quantification of genomic DNA was
done using 1.0% agarose gel electrophoresis in 1X TAE buffer followed by staining
with ethidium bromide. The concentration of extracted DNA was also estimated
by visual comparison of the band with 100 bp marker DNA. The purity and concentration
of the extracted DNA was also checked by measuring absorbances on T60 UVVIS
spectrophotometer at 260 and 280 nm. Purity was analyzed by absorbances ratios
i.e., 260/280 nm (Sahasrabudhe and Deodhar, 2010).
Uniplex amplification of tdh and sefA gene: PCR amplification was performed in a 30 μL reaction volume containing 50 ng of DNA template, 3 μL 10X PCR reaction buffer without MgCl2, 0.5 μL 20 mM MgCl2, 1 μL of dNTP mixture, 1 μL each of forward and reverse primer and 1 unit of Taq polymerase. Same reaction mixture was used for both gene. Thermal cycling was done in a DNA engine, BIO-RAD (USA). PCR reactions were maintained for initial denaturation at 94°C for 3 min, followed by 30 cycles of 1 min at 94°C (denaturation), 1 min at 55°C for tdh and 58°C for sefA (annealing) and 1 min at 72°C (extension). The final extension for 9 min at 72°C and holding temperature was maintained at 4°C. After amplification, PCR products were stored at 4°C till electrophoresis done. PCR products were mixed with 3 μL of 10X loading dye (0.25% bromophenol blue, 0.25% xylene cyanol and 40% sucrose, w/v) and electrophoresis was carried on 1.5% agarose gel in 1X TAE buffer at 100 V for 1.5 h and stained with ethidium bromide (10 μg mL-1). A 100 bp DNA ladder was used as a standard molecular weight marker.
Multiplex PCR settings: Multiplex PCR was performed in a total volume of 30 μL containing 2 μL of template DNA and 28 μL of PCR master mix composed of 1X PCR buffer, 5.0 mM MgCl2, 25 μM concentration of each of Salmonella sp. detection primers (A058 and A01), 25 μM concentration of each of V. parahaemolyticus detection primers (tdh D3 and tdh D5), 200 μM dATP, dCTP, dGTP and dUTP, 0.5 U of AmpliTaq Gold DNA polymerase (Invitrogen, USA) with a DNA thermal cycler (DNA Engine, Bio Rad, USA). The thermocycler was programmed as 50°C for 2 min for carryover treatment and initial denaturation at 95°C for 5 min. The samples were then subjected to 30 cycles of 95°C for 1 min, 58°C for 1 min, 55°C for 1 min, 72°C for 1 min and then 72°C for 9 min. The amplified products were then analyzed by 2.0% agarose gel electrophoresis. Expected size for Salmonella and V. parahaemolyticus were 470 and 250 bp, respectively.
Sensitivity of the multiplex PCR: Overnight culture of the test organisms were used to prepare serial dilutions in sterile buffer solution, with bacterial concentrations 104, 105, 106 and 107 cells mL-1. Cells were pelleted by centrifugation and DNA was extracted using the method described earlier. PCR was performed with the successful multiplex setting stated earlier and amplified products were then analyzed by 2.0% agarose gel electrophoresis.
Specificity of the multiplex PCR: To test the specificity as well as the validity of the mPCR method and to ensure that the method do not amplify closely related genes present in other related organisms, Bacillus cereus ATCC 10876, Shigella flexneri ATCC 12022 and Staphylococcus aureus ATCC 25923 were included in the study. DNA extracted from these organisms was subjected to PCR according to the multiplex settings stated above.
Spiking of shrimp samples: Shrimp samples were peeled and sterilized by autoclaving at 121°C for 15 min. The cooled down sterilized shrimps were then spiked with overnight grown bacterial culture (106 CFU mL-1). Following incubation at 37°C for 24 h, spiked shrimps were homogenized with sterile ringer solution in a stomacher. 3 mL of stomached samples were inoculated into nutrient broth and incubated for 24 h at 37°C. The overnight grown culture was subjected to DNA extraction and PCR.
DNA extraction from spiked shrimp samples: For extraction of DNA in
food samples, method described by Yasmin et al. (2007)
was followed.
Multiplex PCR with the inoculated shrimp samples: DNA extracted from spiked shrimp samples were subjected to both the uniplex and multiplex PCR setting stated earlier for the detection of the pathogens concerned. The amplified products were then analyzed by 2.0% agarose gel electrophoresis. Expected size for Salmonella and V. parahaemolyticus were 470 and 250 bp, respectively.
Multiplex PCR with the mixed culture (without incubation): The sensitivity
of the multiplex PCR system for simultaneous detection of Salmonella
sp. and V. parahaemolyticus was evaluated with the mixed cultures prepared.
Each pathogen was grown to the late logarithmic phase in TSB+0.6% yeast extract.
The cells were collected by centrifugation and resuspended in the original volume
of PBS. Serial decimal dilutions were made with PBS to make 106 CFU
mL-1. One mL of the cell dilution was mixed with 9 mL of shrimp culture
extract (25 g of shrimp was stomached with 225 mL of TSB+0.6% yeast extract
and incubated at 35°C for 24 h) and immediately proceeds for DNA isolation
according to method described by Yasmin et al. (2007).
RESULTS
Amplification of sefA gene of Salmonella sp.: The PCR product was separated by 1.5% agarose gel electrophoresis and visualized by UV transilluminator (Alpha Innotech). After electrophoresis, a 470 bp size distinct PCR product band was observed. The distinct size (470 bp) band confirms sefA gene in the reference Salmonella sp. ATCC 65154 (Fig. 1).
Amplification of tdh gene of V. parahaemolyticus: The PCR product was separated by 1.5% agarose gel electrophoresis and visualized by UV transilluminator (Alpha Innotech). After electrophoresis, a 250 bp size distinct PCR product band was observed. The distinct size band (250 bp) confirms tdh gene in the reference Vibrio parahaemolyticus ATCC 17802 (Fig. 2).
|
| Fig. 1: |
Agarose gel electrophoretic analysis of PCR product of sefA
gene of Salmonella spp., Lane M: 100 bp DNA ladder, Lane 1 and 2:
sefA gene product (470 bp), Lane 3: Negative control |
|
| Fig. 2: |
Agarose gel electrophoretic analysis of PCR product of tdh
gene of V. parahaemolyticus, Lane M: 100 bp DNA ladder, Lane 1: Negative
control, Lane 2: tdh gene product (250 bp) |
Multiplex amplification of sefA and tdh genes: After electrophoresis of PCR product, two distinct PCR product band was observed and their size was measured as 470 and 250 bp. From the amplification results of the multiplex PCR, it is evident that the designed set-up is able to amplify sefA gene of Salmonella sp. and tdh gene of V. parahaemolyticus in a single reaction mixture (Fig. 3).
Sensitivity of the multiplex PCR: Although the multiplex setting amplified the genes in all four DNA samples extracted (104, 105, 106 and 107 cells mL-1) but the intensity of the PCR bands gradually decreased with decreasing cell concentration in the samples (Fig. 4).
Specificity of the multiplex PCR: No PCR band was found in case of Bacillus cereus ATCC 10876, Shigella flexneri ATCC 12022 and Staphylococcus aureus ATCC 25923. The results indicate that the method is specific for the target organisms Salmonella sp. and V. parahaemolyticus (Fig. 4). The result of the amplification reaction is shown in Fig. 5.
|
| Fig. 3: |
Agarose gel electrophoretic analysis of products of multiplex
PCR (Lane M: 50 bp DNA ladder, Lane 1 and 2: Multiplex PCR product (470
bp confirms sefA and 250 bp confirms tdh), Lane 3: Negative
control) |
|
| Fig. 4: |
Agarose gel electrophoretic analysis of products of multiplex
PCR (Lane 2: 106 CFU mL-1, Lane 3: 107
CFU mL-1, Lane 4: 50 bp marker, lane 5: 104 CFU mL-1,
Lane 6: 105 CFU mL-1, Lane 1 and 7: Negative control) |
|
| Fig. 5: |
Agarose gel electrophoresis of amplification with non target
DNA (Lane M: 100 bp DNA ladder, Lane 1: Bacillus cereus ATCC 10876,
Lane 2: Shigella flexneri ATCC 12022, Lane 3: Staphylococcus aureus
ATCC 25923) |
|
| Fig. 6: |
Agarose gel electrophoretic analysis of products of multiplex
PCR setup for simultaneous detection of the target pathogens from shrimp
sample. Lane M: 100 bp ladder, Lane 1, 2, 3, 4: Multiplex PCR product (470
bp confirms sefA and 250 bp confirms tdh) Lane 5: Negative
control |
Multiplex amplification of DNA extracted from spiked shrimp samples: DNA extracted from shrimp samples spiked with Salmonella typhi ATCC 65154 and V. parahaemolyticus ATCC 17892 were subjected to PCR amplification with the designed multiplex set up. The multiplex set up able to amplify both of the genes (sefA and tdh) from all the samples (Fig. 6).
Multiplex PCR evaluated with the mixed culture (without incubation): DNA extracted from shrimp samples spiked with the target organisms without incubation were subjected to PCR amplification with the designed multiplex set up. The multiplex set up amplified both of the genes from all the samples. The results are shown in Fig. 7.
|
| Fig. 7: |
Agarose gel electrophoretic analysis of products of multiplex
PCR, Lane M: 50 bp DNA ladder, Lane 1: Negative control, Lane 2 and 3: Multiplex
PCR product (470 bp confirms sefA and 250 bp confirms tdh) |
DISCUSSION
In Bangladesh, shrimp cultivation and processing is one of the major sectors
that earn a lot of foreign exchange every year and the sector is developing
gradually. As it is mentioned earlier, export of shrimp is an important contributor
to economic growth of the country. The shrimp sector is the second largest export
earner for Bangladesh, accounting for an annual export of USD 445 million in
2007-08 (BBS, 2010). Export market of shrimp could be
threatened if contaminated with pathogenic bacteria such as Vibrio spp.,
Salmonella spp., E. coli O157:H7 etc. (Porteen
et al., 2007). Bangladesh frozen shrimp exporters continue to have
both real and perceived problems with buyers having stringent food regulation
and standard in the U.S., the EU and Japan, concerning the safety and quality
of their products (Ahmed and Anwar, 2007).
In most of the laboratories, microbiological examination and detection of food
pathogens are selective media and biochemical characteristics based. These methods
involve lengthy procedure and in some cases Level of Detection (LOD) is not
satisfactory. Modern biotechnology has enabled us to use more reliable and sensitive
detection methods. PCR-based methods have potential for rapid and sensitive
detection of food borne pathogens. Multiplex PCR is a variant of PCR which enables
amplification of many targets in one reaction by using more than one pair of
primers (Farag et al., 2010). Multiplex assays
can be tedious and time-consuming and it requires lengthy optimization procedures,
though it is a cost saving technique in many diagnostic laboratories (Elnifro
et al., 2000). The technique is subject to certain difficulties related
in principal to the availability of primers for various pathogens (Martin
et al., 2000); the formation of primer dimers (Jannine
et al., 1997) and the carryover of certain inhibitory factors in
the samples (Wilson, 1997; Parekh
and Subhash, 2008). Thus an optimization of multiplex PCR conditions is
necessary before use in detection of more than one pathogen targets concurrently
(Ozdemir, 2005). The application of multiplex PCR will
provide the ease, speed and economic advantage over the single PCR reaction
for detecting multiple pathogens (AlHaj et al., 2007).
In this study, we targeted to detect simultaneously V. parahaemolyticus
and Salmonella sp. from shrimp samples. The targeted genes (tdh
and sefA) were amplified individually and then by multiplex settings.
Sensitivity of the multiplex assay was good as it amplified the genes from 104
CFU mL-1 sample. Similar results were found in the study of Seidavi
et al. (2008) and AlHaj et al. (2007).
The method is also specific for the target organisms as it did not produced
any product during amplification with non-target organisms.
The performance of the method was checked by using DNA extracted from spiked
and overnight incubated shrimp samples. The method successfully amplified both
genes from all the samples. DNA extracted from spiked and not incubated shrimp
samples were also subjected to PCR amplification and the method also amplified
the genes from all the samples. Similar results were found by Malkawi
and Gharaibeh (2004) in simultaneous detection of multiple Salmonella
serotypes from chicken and meat products.
CONCLUSION
This multiplex assay will be valuable as a screening method for shrimp contaminated with these pathogens and will also be useful for identifying the sources of contamination. The main problem still to be solved in this study is the detection limit of the pathogens when inoculated in lower number along with other pathogens. Further study will help resolving this problem.
ACKNOWLEDGMENT
This research project was carried out under a special allocation project entitled "Development and Validation of Multiplex PCR Method for Rapid Detection of Pathogenic Microorganisms from Shrimp Value Chain of Bangladesh", funded by Ministry of Science and Technology, Government of the People’s Republic of Bangladesh.
Subscribe Today
