Subscribe Now Subscribe Today
Research Article
 

Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability



Rekha Chamanlal Akhani, Arti Thakarshibhai Patel, Manisha Jignesh Patel, Samir Ramnikbhai Dedania and Darshan Hasmukhbhai Patel
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

Background and Objective: Carbohydrate Binding Module (CBMs), a non catalytic carbohydrate binding modules present in glycosyl hydrolases, are playing substantial role in localizing the enzyme to the target substrate, disrupting the structure of robust polymers and their presence in pectate lyase is rare. Deduced gene sequence of pectate lyase 1B (pelB) from Bacillus licheniformis (Bli PelB) shows unique structural features containing N-terminal signal peptide following with ricin super family CBM13 and C-terminal catalytic domain. The objective of the study was to characterize Bli PelB and evaluation of role of CBN13 present in Bli PelB sequence. Methodology: Full length and catalytic domain part of pelB was cloned and expressed. Protein was purified through Ni-NTA his tag affinity chromatography and characterized. Results: Biochemical characterization of Bli PelB revealed maximal activity at 50°C with pH 8.0. Enzyme retained more than 80% activity between pH 7.5-9.0. Bli PelB found to be thermostable at 50°C by maintaining more than 60% activity for 4 days. Bli PelB was 100% active on methylated (70-75%) apple pectin as compared to non methylated polygalacturonic acid (PGA) with which it was 29%. Specific activity was found to be 1451±2.0 and 423±3.5 U mg–1 for methylated pectin and PGA, respectively. kcat and kcat/Km is markedly higher for methylated pectin than PGA. In comparison with Bli PelB, C-terminal catalytic domain of Bli PelB (CD Bli PelB) showed 60% decrease in specific activity while 70% decrease in thermal stability and kinetic efficiency. Conclusion: The characterized properties of Bli PelB are suitable for its industrial applications. The reduction in catalytic activity and thermal stability of Bli PelB without CBM13 could explain the role of CBM in enzyme efficiency.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Rekha Chamanlal Akhani, Arti Thakarshibhai Patel, Manisha Jignesh Patel, Samir Ramnikbhai Dedania and Darshan Hasmukhbhai Patel, 2017. Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability. Asian Journal of Biochemistry, 12: 36-43.

DOI: 10.3923/ajb.2017.36.43

URL: https://scialert.net/abstract/?doi=ajb.2017.36.43
 
Received: January 07, 2017; Accepted: February 07, 2017; Published: February 15, 2017



INTRODUCTION

Primary cell wall of cotton fiber composed of non cellulosic materials such as polygalacturonic acid, proteins, cellulose, hemicelluloses and waxes1 and secondary cell wall contain mainly cellulosic material. For efficient dye binding to the fabrics, enzymatic degradation of non cellulosic materials is potentially valuable because they could reduce the usage of toxic alkaline chemical. To improve the scouring pretreatment process of cotton fabric, it is necessary to treat with alkaline pectinase2,3.

Pectinolytic enzymes are produced by plant pathogenic microbes like Erwinia4-6 and saprophytic bacteria including Bacillus genus7, which degrade complex pectin through concerted action of several enzymes. They are carbohydrate degrading enzymes which categorizes in various family (www.cazy.org/Polysaccharide-Lyases). Pectin esterase, pectate lyase, pectin lyase and polygalacturonase are the class of enzymes for degradation of pectin8,9. Pectate lyase and pectin lyase are specifically active towards the methoxylated pectin materials and produce unsaturated polygalacturonides10,11. Enzymatic mechanism is well established for complete degradation of pectin materials, (1) Cleavage of glycosidic bond and (2) β-elimination reaction at non reducing end resulting in Δ4,5 unsaturated oligomer residue. Pectate lyases of family 1, 2, 3, 9 and 10 carry the β-eliminative cleavage of α (1-4) glycosidic bond and generate Δ4, 5 unsaturated D-glucopyranosyluronic acid (GalpA)11.

Many glycoside hydrolases that attack cellulose and hemicelluloses have modular structure consisting catalytic module and ancillary non catalytic carbohydrate binding module (CBMs), which probably evolve to the specific sugar binding and facilitate the catalytic action of module12-14. Pectin degrading enzymes on the contrary, it has a relatively simple structure lacking CBMs, probably due to substrate accessibility is easier than cellulose and xylan15,16. Genome sequences show that some of the pectinases are with modular structure and two of them have been characterized which contain the CBM6 and CBM2617. While analyzing the pectate lyase sequence from the database, we encountered CBM with Bacillus licheniformis pectate lyase B of family 1 (pelB, GenBank accession No. AAU24559.1). Sequence analysis revealed that the CBM present in pectate lyase B of Bacillus licheniformis (Bli PelB) is of ricin super family 13 and C-terminal is the catalytic module. First, CBM13 has been characterized in xylanase of Streptomyces18-20 and then many studies have shown its presence in endo-glucanase, chitinase, α-galactosidase and α-L-arabinofuranosidase21.

Bacillus licheniformis is a soil bacterium and complete genome sequence analysis shows that it has extensive repertoire of glycoside hydrolase such as xylanase, cellulase, mannase and several pectin degrading enzymes22. The basic aim of this study includes the characterization of Bli PelB and evaluation of role of CBM13 present in Bli PelB sequence by comparing the data of two proteins, full length PelB protein (Bli PelB) and the catalytic module of PelB (CD Bli PelB).

MATERIALS AND METHODS

Bacteria, chemicals and media: Bacillus licheniformis DSM13/ATCC14580 was purchased from MTCC (MTTC No. 429). All molecular grade reagents required was purchased either from Takara Biomedical (Otsu, JP), New England Biolabs (UK), Invitrogen (Carlsbad, CA) or Bio-Rad (CA). The pET 21b vector was used for cloning and expression. Polygalacturonic acid (PGA) and pectin from apple (75% methyl esterified) was purchased from Sigma Aldrich. Metals, media and other chemicals were procured from Hi media Laboratories.

Recombinant DNA technique and sequence analysis: Total genomic DNA was isolated from B. licheniformis according to method described by Sambrook and Russell23. The pelB gene of 1485 bp (GenBank accession number AAU24559.1, Bli pelb) was amplified using FP 5'AGCTGCACGNheIATGAAACTGATCAAAAACGCA3' and RP 5'ACGTTCCATXhoI GTCTTTTTTAAACTGGCTGTA3'. The catalytic domain of Bli pelb (CD Bli pelb, residue No. 173-494) was amplified using gene specific forward primer 5'AGCTGCACGNheIATGAGCGACGGGCTCGAAGGTTTC3'. An amplified fragment was restricted with NheI and XhoI restriction site and cloned in to pET-21b expression vector and positive clones were subjected for sequencing.

Protein expression and purification: Sequenced confirmed clones were transformed into E. coli BL21 for expression of Bli pelb and CD Bli pelb. Single isolated transformed colonies were inoculated in 200 mL LB medium and incubated at 30°C. After overnight incubation, cells were harvested by centrifugation at 4°C and dissolved in lysis buffer (50 mM tris-HCl, 20 mM imidazole, 300 mM NaCl). Cell lysis was carried out by sonication for 10 min with 30 mV amplitude with 15 sec of interval. Further, lysate was clarified by centrifugation (10,000×g, 30 min and 4°C) and allowed to pass through nickel-nitrilo triacetate acid (Ni-NTA) agarose matrix. After extensive washing with wash buffer, the protein was finally eluted in elution buffer containing 250 mM imidazole (pH 8.0) and eluted protein was dialyzed against 50 mM tris (pH 8.0) using a 10 kDa ultra filter (Merck millipore, Germany). Dialyzed proteins were quantified using the Bio-Rad protein assay reagent (Bio-Rad, CA) against bovine serum albumin as a standard. The purified proteins were subjected to 12% SDS-PAGE and visualized with coomassie brilliant blue R-250 staining.

Enzyme activity measured spectrophotometrically using 1% methylated pectin as a substrate in 50 mM tris-HCl buffer and 0.25 mM Ca+2 and increase in released unsaturated product was measured at 235 nm24. The activity was expressed as 1 U of enzyme releasing the 1 μg of unsaturated product per minute per milliliter by using molar extinction coefficient 4600 M–1 cm–1.

Biochemical characterization and thermal inactivation of Bli PelB: To test the effects of pH on Bli PelB, the pH was varied from 5.0-9.0 using 50 mM phosphate buffer (pH 5.0 and 7.0) and tris-HCl (pH 7.5-9.0) and enzyme activity was measured using 1% methylated pectin. For influence of temperature on Bli PelB, enzyme activity was measured on 1% methylated pectin at various temperatures ranging from 30.0-70°C. Activation of Bli PelB by various divalent metals was performed using 1.0 mM of EDTA, CaCl2, MnSO4, ZnCl2, CoCl2, MgSO4, CuSO4, NiCl2 and apoenzyme in tris-HCl (pH 8.0) with 1% methylated pectin. Thermal stability of Bli PelB and CD Bli PelB was monitored at 50.0°C in 50 mM tris-HCl (pH 8.0). At different time intervals, samples were withdrawn and the relative activity was determined after the reaction.

Specific activity and catalytic efficiency: Approximately 1% of PGA and methylated pectin were treated with Bli PelB and CD Bli PelB under optimized conditions for 10 min and the release of unsaturated products was measured in UV-visible spectrophotometer at 235 nm. Specific activity was defined as the amount of unsaturated products produced per amount of protein per reaction time.

Kinetic parameters were analyzed at 50°C using a range of 0.01-1.5 mg of methylated pectin and PGA. Each concentration was treated with Bli PelB and CD Bli PelB containing 0.25 mM CaCl2 in 50 mM tris-HCl, pH 8.0. Reactions were stopped after 10 min and the reaction mixtures were analyzed for release of unsaturated product at 235 nm. Kinetic parameters such as Km (mg) and kcat (min–1) were determined by fitting the data to the Michaelis-Menten equation.

Statistical analysis: Simple statistical analysis was done for the results. All the results presented were average of triplicates and values shown were Mean±SD. Kinetics data analysis was performed in Origin 6.0 software.

RESULTS

Recombinant DNA technique and nucleotide sequence analysis: Bli PelB sequence analysis revealed the downstream of N- terminal signal sequence is a ricin super family CBM13 with 136 residues which is followed by catalytic domain comprising total 322 residues (Fig. 1a). When the CBM13 portion of Bli PelB (residue No 36-172) was aligned with ricin binding domain of xylanase from Streptomyces xiamenensis (GenBank accession No. AKG42035.1) and alpha fucosidase from Streptomyces sp. MMG112 (GenBank accession No. KOV65226.1), it showed 22% identity. The Trp (W, residue No. 74, 121 and 169) in CBM is essential for substrate stacking is conserved in Bli PelB (Fig. 1b). C-terminal (residue No. 173-494) shows 53% identity with PelB of closely related species B. subtilis and 35% identity with pelA from B. licheniformis 14A25. Arginine (R376 for Bli PelB) working for substrate charge neutralization is conserved throughout the different family of bacterial pectate lyase B26,27. With limited knowledge on CBM13 in pectate lyase, it is very difficult to answer such evolution in enzyme. Possibly the amplification of CBM coding sequences throughout the genome in cellulosome containing organism conferred the advantage of CBM fusion with the pectate lyase15. To find out the role of CBM in Bli PelB, full length of pectate lyase (Bli pelb) and only the catalytic module of C-terminal Bli pelb (CD Bli pelb) was successfully cloned into pET 21b expression vector.

Protein expression and purification: Soluble forms of all recombinant proteins were obtained when they were expressed in E. coli strain BL21. The SDS-PAGE analysis of Ni-NTA-purified proteins resulted in apparent molecular masses of 54 kDa for Bli PelB and 36 kDa for CD Bli PelB (Fig. 2a, b). Total 4 and 7 fold purification was obtained for Bli PelB and CD Bli PelB respectively when methylated pectin used as a substrate (Table 1).

Biochemical characterization of Bli PelB: The enzyme showed broad range of pH working profile and optimal pH was found to be pH 8.0. It has retained 80% activity at pH 7.5, 8.5 and 9.0 (Fig. 3). To determine the temperature at which the highest activity occurs, the temperature was varied from 30-70°C. The enzyme activity increased as the temperature increased, showing higher activity at 50°C and found to be active over wide range of temperature (Fig. 4).

Like other pectate lyase, Bli PelB also increases the activity in the presence of metal ions (Fig. 5), with Ca+2 it is more active while Hg+2, Cu+2 and Fe+2 inhibit the Bli PelB activity.

Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
Fig. 1(a-b):
(a) Schematic diagram of Bli PelB sequence, (b) Sequence alignment of CBM13 of Bli PelB with xylanase from Streptomyces xiamenensis and fucosidase of Streptomyces sp. MMG1121

Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
Fig. 2(a-b):
12% SDS PAGE analysis of Bli PelB and CD Bli PelB (a) Bli PelB SDS PAGE 1: Marker, 2: Bli PelB lysate, 3: Bli PelB purified, (b) CD Bli PelB SDS PAGE 1: Marker, 2: CD Bli PelB lysate, 3: CD Bli PelB purified

Table 1: Summary of purified Bli PelB and CD Bli PelB
Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
aTotal protein and units from 200 mL culture, ±represent SD of triplicate

The Ethylene Diamine Tetra Acetic Acid (EDTA) showed no influence on the activity of enzyme which indicates that the metal is not strict requirement for Bli PelB. Various concentrations of Ca+2 were tested to attain higher activity and 0.25 mM Ca+2 produced the most activity. Comparison of thermal inactivation profile showed that more than 80% residual activity observed after 3 days for Bli PelB.

Specific activity and catalytic efficiency: Bli PelB showed higher activity on methylated pectin than non-methylated PGA. It is worth noting that the specific activity of Bli PelB is higher than the CD Bli PelB (Table 2). The Michaelis-Menten kinetic parameters (Km and Vmax) and catalytic efficiency kcat/Km of Bli PelB and CD Bli PelB were determined by plotting the reaction velocity (V0) against the substrate concentration ([S]). Bli PelB showed higher turnover number (kcat) and catalytic efficiency (kcat/Km), at 6.8±0.2 and 15.5±0.82, respectively (Table 3). The kcat/Km of CD Bli PelB on methylated pectin was found to be 4.1±0.2 mg–1 min–1. Removing CBM13 from Bli PelB showed 60% reduce in enzyme activity and 70% in thermal stability after 3 days which establishes the important role of CBM13 in Bli PelB functioning (Fig. 6).

Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
Fig. 3: pH optima of Bli PelB values represent the Mean±SD of triplicate samples

DISCUSSION

The present study showed that pelB from Bacillus licheniformis DSM 13 is alkaline in nature and removal of CBM13 from the sequence decreases enzyme activity and thermal stability.

Table 2: Substrate specificity of Bli PelB and CD Bli PelB
Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
±represent SD of triplicate

Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
Fig. 4: Temperature optima of Bli PelB values represent the Mean±SD of triplicate samples

Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
Fig. 5: Effect of various divalent metal ions on activity of Bli PelB values represents the Mean±SD of triplicate samples
 
(Relative activity for: Without metal 80% (SD±1.8), EDTA 79% (SD±1.5), Mn+2 90% (SD±2.9), Mg+2 90% (SD±2), Ca+2 100% (SD±1.6), Co+2 72% (SD±3), Zn+2 39% (SD±2.4), Hg+2 0% (SD±1), Cu+2 1% (SD±1) and Fe+2 0% (SD±1))

Table 3: Kinetic parameters of Bli PelB and CD Bli PelB for two different substrates
Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
±represent SD of triplicate

Image for - Ricin Super Family Carbohydrate Binding Module 13 Containing Pectate Lyase 1B from Bacillus licheniformis Display Hyper Thermal Stability
Fig. 6:
Thermal stability profiles of Bli PelB and CD Bli PelB values represent the Mean±SD of triplicate samples (Bli PelB triangle, CD Bli PelB round)

Alkaline pectinases are mainly used in degumming process and for pretreatment of pectin waste water3,28,29. It has been speculated that the higher pH is because of their substrates which is generally alkaline in nature. At high pH values, arginine involved in catalysis become deprotonated17,27. Reported pectate lyases from different Bacillus sp. showed optimum pH in alkaline side and temperature in range of 40-70°C3,8. Besides having its optimum pH in alkaline range, the Bli PelB displayed activity in acidic range too; hence it can be used in fruit juice extraction process30,31. Generally all pectate lyases are absolutely Ca+2 dependants for its catalysis that differentiate it from pectin lyase32,33. On mechanistic point, it has been proposed that calcium neutralize the charge of substrate (uronic acid) during catalysis26,34. However, Bli PelB is active without metal and presence of metal increased activity to 20% of the wild type, this feature makes this PelB different from others. Enzyme with high thermostability at moderate temperature (50-60°C) is an ideal candidate for various industrial applications. High thermal stability of Bli PelB at 50.0°C compared to the CD Bli PelB could insight the role of CBM13. This was also been reported for XynB from Caldicellulosiruptor sp. Strain F32, showed high thermostability as compared to catalytic domain and further analysis revealed that there is intramolecular interaction between CBM and catalytic domain35. The Bli PelB possibly evolved in similar fashion in order to adopt the changing environment. The role of CBM13 in increased thermal stability was also reported in alginate lyase from Agarivorans sp. L1136, in contrast its presence in XynB decreased the thermostability of xylanase37. However, to further establish the role of CBM13 for thermo stability in Bli PelB, crystal structure analysis needs to done.

One of the most important notable features observed for Bli PelB was high substrate specificity towards the highly methylated pectin than PGA, similar to what was observed for pectate lyase from Bacillus sp. BP 2338. The PelB of Paenibacillus amylolyticus showed the maximum activity on 20-34% methylated pectin39. However, some of pectate lyase like from Bacillus subtilis40 and Bacillus sp. RN141 exhibited most activity with substrate having very low or moderate degree of esterification. In contradiction, pectate lyase from Bacillus sp. N16-542, B. licheniformis43, Paenibacillus sp. 060244 and Erwinia carotovora45 showed highest activity with PGA. The reduction in thermal stability of CD Bli PelB is observed in many enzymes where removal of carbohydrate binding module influences the enzyme properties46. It may cause the alteration in activity or lose the affinity for crystalline substrate46-51.

CONCLUSION

Thermo stability of Bli PelB coupled to its high specific activity on esterified substrate makes it an attractive candidate to be employed in textile industries for fiber degumming process. A hypothetical protein encoded by PelB of B. licheniformis was found to be mesophilic and alkaline. To date, this is first report to characterize the pectate lyase 1B which contains family 13 CBM. Further probe is requiring for establishing the role of CBM13 for pectin degradation.

SIGNIFICANCE STATEMENTS

The CBM present in pelB is the first report for pectate lyase B having family 13 CBM
Removing CBM13 decreased the thermal stability and enzyme activity shows that the CBM13 is essential part of the pectate lyase B
These findings will further create base for establishing the exact mechanism of CBM13 in pectate lyase B

ACKNOWLEDGMENTS

Authors are thankful to P. D. Patel Institute of Applied sciences, CHARUSAT, Changa, Anand, Gujarat for providing the research facility.

REFERENCES

1:  Solbak, A.I., T.H. Richardson, R.T. McCann, K.A. Kline and F. Bartnek et al., 2005 2005. Discovery of pectin-degrading enzymes and directed evolution of a novel pectate lyase for processing cotton fabric. J. Biol. Chem., 280: 9431-9438.
CrossRef  |  Direct Link  |  

2:  Agrawal, P.B., V.A. Nierstrasz, B.G. Klug-Santner, G.M. Gubitz, H.B.M. Lenting andf M.M.C.G. Warmoeskerken, 2007. Wax removal for accelerated cotton scouring with alkaline pectinase. Biotechnol. J., 2: 306-315.
CrossRef  |  Direct Link  |  

3:  Hoondal, G., R. Tiwari, R. Tewari, N. Dahiya and Q. Beg, 2002. Microbial alkaline pectinases and their industrial applications: A review. Applied Microbiol. Biotechnol., 59: 409-418.
CrossRef  |  Direct Link  |  

4:  Hugouvieux-Cotte-Pattat, N., G. Condemine, W. Nasser and S. Reverchon, 1996. Regulation of pectinolysis in Erwinia chrysanthemi. Annu. Rev. Microbiol., 50: 213-257.
CrossRef  |  Direct Link  |  

5:  Pissavin, C., J. Robert-Baudouy and N. Hugouvieux-Cotte-Pattat, 1996. Regulation of pelZ, a gene of the pelB-pelC cluster encoding a new pectate lyase of Erwinia chrysanthemi 3937. J. Bacteriol., 178: 7187-7196.
CrossRef  |  Direct Link  |  

6:  Shevchik, V.E., J. Robert-Baudouy and N. Hugouvieux-Cotte-Pattat, 1997. Pectate lyase PelI of Erwinia chrysanthemi 3937 belongs to a new family. J. Bacteriol., 179: 7321-7330.
Direct Link  |  

7:  Henrissat, B., S.E. Heffron, M.D. Yoder, S.E. Lietzke and F. Jurnak, 1995. Functional implications of structure-based sequence alignment of proteins in the extracellular pectate lyase superfamily. Plant Physiol., 107: 963-976.
PubMed  |  Direct Link  |  

8:  Dubey, A.K., S. Yadav, M. Kumar, G. Anand and D. Yadav, 2016. Molecular biology of microbial pectate lyase: A review. Br. Biotechnol. J., 13: 1-26.
CrossRef  |  Direct Link  |  

9:  Kester, H.C. and J. Visser, 1994. Purification and characterization of pectin lyase B, a novel pectinolytic enzyme from Aspergillus niger. FEMS Microbiol. Lett., 120: 63-67.
CrossRef  |  Direct Link  |  

10:  Benen, J.A.E. and J. Visser, 2002. Pectate and Pectin Lyases. In: Handbook of Food Enzymology, Whitaker, J.R., A.G.J. Voragen and D.W.S. Wong (Eds.). Taylor and Francis Inc., New York, ISBN: 9780824706869, pp: 1029-1041

11:  Tardy, F., W. Nasser, J. Robert-Baudouy and N. Hugouvieux-Cotte-Pattat, 1997. Comparative analysis of the five major Erwinia chrysanthemi pectate lyases: Enzyme characteristics and potential inhibitors. J. Bacteriol., 179: 2503-2511.
CrossRef  |  Direct Link  |  

12:  Artzi, L., E.A. Bayer and S. Morais, 2016. Cellulosomes: Bacterial nanomachines for dismantling plant polysaccharides. Nat. Rev. Microbiol., 15: 83-95.
CrossRef  |  Direct Link  |  

13:  Chakraborty, S., V.O. Fernandes, F.M.V. Dias, J.A.M Prates and L.M.A. Ferreira et al., 2015. Role of pectinolytic enzymes identified in Clostridium thermocellum cellulosome. PLoS ONE, Vol. 10.
CrossRef  |  Direct Link  |  

14:  Venditto, I., A.S. Luis, M. Rydahl, J. Schuckel and V.O. Fernandes et al., 2016. Complexity of the Ruminococcus flavefaciens cellulosome reflects an expansion in glycan recognition. Proc. Natl. Acad. Sci., 113: 7136-7141.
CrossRef  |  Direct Link  |  

15:  Din, N., I.J. Forsythe, L.D. Burtnick, N.R. Gilkes, R.C. Miller, R.A.J. Warren and D.G. Kilburn, 1994. The cellulose‐binding domain of endoglucanase A (CenA) from Cellulomonas fimi: Evidence for the involvement of tryptophan residues in binding. Mol. Microbiol., 11: 747-755.
CrossRef  |  Direct Link  |  

16:  McKie, V.A., J.P. Vincken, A.G.J. Voragen, L.A.M. van den Broek, E. Stimson and H.J. Gilbert, 2001. A new family of rhamnogalacturonan lyases contains an enzyme that binds to cellulose. Biochem. J., 355: 167-177.
CrossRef  |  Direct Link  |  

17:  Brown, I.E., M.H. Mallen, S.J. Charnock, G.J. Davies and W. Gary, 2001. Pectate lyase 10A from Pseudomonas cellulosa is a modular enzyme containing a family 2a carbohydrate-binding module. Biochem. J., 355: 155-165.
CrossRef  |  Direct Link  |  

18:  Boraston, A.B., P. Tomme, E.A. Amandoron and D.G. Kilburn, 2000. A novel mechanism of xylan binding by a lectin-like module from Streptomyces lividans xylanase 10A. Biochem. J., 350: 933-941.
CrossRef  |  Direct Link  |  

19:  Fujimoto, Z., A. Kuno, S. Kaneko, S. Yoshida, H. Kobayashi, I. Kusakabe and H. Mizuno, 2000. Crystal structure of Streptomyces olivaceoviridis E-86 β-xylanase containing xylan-binding domain. J. Mol. Biol., 300: 575-585.
CrossRef  |  Direct Link  |  

20:  Notenboom, V., A.B. Boraston, S.J. Williams, D.G. Kilburn and D.R. Rose, 2002. High-resolution crystal structures of the lectin-like xylan binding domain from Streptomyces lividans xylanase 10A with bound substrates reveal a novel mode of xylan binding. Biochemistry, 41: 4246-4254.
CrossRef  |  Direct Link  |  

21:  Fujimoto, Z., 2013. Structure and function of carbohydrate-binding module families 13 and 42 of glycoside hydrolases, comprising a β-trefoil fold. Biosci. Biotechnol. Biochem., 77: 1363-1371.
CrossRef  |  Direct Link  |  

22:  Veith, B., C. Herzberg, S. Steckel, J.O.R. Feesche and K.H. Maurer et al., 2004. The complete genome sequence of Bacillus licheniformis DSM13, an organism with great industrial potential. J. Mol. Microbiol. Biotechnol., 7: 204-211.
CrossRef  |  Direct Link  |  

23:  Sambrook, J. and D.W. Russell, 2001. Molecular Cloning: A Laboratory Manual. 3rd Edn., Cold Spring Harbor Laboratory Press, New York, USA., ISBN-13: 9780879695774, Pages: 2344

24:  Hansen, K.M., A.B. Thuesen and J.R. Soderberg, 2001. Enzyme assay for identification of pectin and pectin derivatives, based on recombinant pectate lyase. J. AOAC. Int., 84: 1851-1854.
Direct Link  |  

25:  Berensmeier, S., S.A. Singh, J. Meens and K. Buchholz, 2004. Cloning of the pelA gene from Bacillus licheniformis 14A and biochemical characterization of recombinant, thermostable, high-alkaline pectate lyase. Applied Microbiol. Biotechnol., 64: 560-567.
CrossRef  |  Direct Link  |  

26:  Jurnak, F., N. Kita, M. Garrett, S.E. Heffron, R. Scavetta, C. Boyd and N. Keen, 1996. Functional implications of the three-dimensional structures of pectate lyases. Prog. Biotechnol., 14: 295-308.
CrossRef  |  Direct Link  |  

27:  Scavetta, R.D., S.R. Herron, A.T. Hotchkiss, N. Kita and N.T. Keen et al., 1999. Structure of a plant cell wall fragment complexed to pectate lyase C. Plant Cell, 11: 1081-1092.
Direct Link  |  

28:  Liang, C., X. Gui, C. Zhou, Y. Xue, Y. Ma and S.Y. Tang, 2015. Improving the thermoactivity and thermostability of pectate lyase from Bacillus pumilus for ramie degumming. Applied Microbiol. Biotechnol., 99: 2673-2682.
CrossRef  |  Direct Link  |  

29:  Zhang, C., J. Yao, C. Zhou, L. Mao, G. Zhang and Y. Ma, 2013. The alkaline pectate lyase PEL168 of Bacillus subtilis heterologously expressed in Pichia pastoris is more stable and efficient for degumming ramie fiber. BMC Biotechnol., Vol. 13.
CrossRef  |  Direct Link  |  

30:  Alkorta, I., C. Garbisu, M.J. Llama and J.L. Serra, 1998. Industrial applications of pectic enzymes: A review. Process Biochem., 33: 21-28.
CrossRef  |  Direct Link  |  

31:  Kashyap, D.R., P.K. Vohra, S. Chopra and R. Tewari, 2001. Applications of pectinases in the commercial sector: A review. Bioresour. Technol., 77: 215-227.
CrossRef  |  PubMed  |  Direct Link  |  

32:  Sakai, T., T. Sakamoto, J. Hallaert and E.J. Vandamme, 1993. Pectin, pectinase and protopectinase: Production, properties and applications. Adv. Applied Microbiol., 39: 231-294.
PubMed  |  Direct Link  |  

33:  Jayani, R.S., S. Saxena and R. Gupta, 2005. Microbial pectinolytic enzymes: A review. Process Biochem., 40: 2931-2944.
CrossRef  |  Direct Link  |  

34:  Yoder, M.D. and F. Jurnak, 1995. The refined three-dimensional structure of pectate lyase C from Erwinia chrysanthemi at 2.2 angstrom resolution (Implications for an enzymatic mechanism). Plant Physiol., 107: 349-364.
Direct Link  |  

35:  Meng, D.D., Y. Ying, X.H. Chen, M. Lu, K. Ning, L.S. Wang and F.L. Li, 2015. Distinct roles for carbohydrate-binding modules of glycoside hydrolase 10 (GH10) and GH11 xylanases from Caldicellulosiruptor sp. strain F32 in thermostability and catalytic efficiency. Applied Environ. Microbiol., 81: 2006-2014.
CrossRef  |  Direct Link  |  

36:  Li, S., X. Yang, M. Bao, Y. Wu, W. Yu and F. Han, 2015. Family 13 carbohydrate-binding module of alginate lyase from Agarivorans sp. L11 enhances its catalytic efficiency and thermostability and alters its substrate preference and product distribution. FEMS Microbiol. Lett., Vol. 362.
CrossRef  |  Direct Link  |  

37:  Leskinen, S., A. Mantyla, R. Fagerstrom, J. Vehmaanpera, R. Lantto, M. Paloheimo and P. Suominen, 2005. Thermostable xylanases, Xyn10A and Xyn11A, from the actinomycete Nonomuraea flexuosa: Isolation of the genes and characterization of recombinant Xyn11A polypeptides produced in Trichoderma reesei. Applied Microbiol. Biotechnol., 67: 495-505.
CrossRef  |  Direct Link  |  

38:  Soriano, M., A. Blanco, P. Diaz and F.I.J. Pastor, 2000. An unusual pectate lyase from a Bacillus sp. with high activity on pectin: Cloning and characterization. Microbiology, 146: 89-95.
Direct Link  |  

39:  Boland, W.E., E.D. Henriksen and J.D. Peterson, 2010. Characterization of two Paenibacillus amylolyticus strain 27C64 pectate lyases with activity on highly methylated pectin. Applied Environ. Microbiol., 76: 6006-6009.
CrossRef  |  Direct Link  |  

40:  Soriano, M., P. Diaz and F.I.J. Pastor, 2006. Pectate lyase C from Bacillus subtilis: a novel endo-cleaving enzyme with activity on highly methylated pectin. Microbiology, 152: 617-625.
CrossRef  |  Direct Link  |  

41:  Sukhumsiirchart, W., S. Kawanishi, W. Deesukon, K. Chansiri, H. Kawasaki and T. Sakamoto, 2009. Purification, characterization and overexpression of thermophilic pectate lyase of Bacillus sp. RN1 isolated from a hot spring in Thailand. Biosci. Biotechnol. Biochem., 73: 268-273.
CrossRef  |  Direct Link  |  

42:  Li, G., L. Rao, Y. Xue, C. Zhou, Y. Zhang and Y. Ma, 2010. Cloning, expression and characterization of a highly active alkaline pectate lyase from alkaliphilic Bacillus sp. N16-5. J. Microbiol. Biotechnol., 20: 670-677.
CrossRef  |  Direct Link  |  

43:  Zhou, C., Y. Xue and Y. Ma, 2017. Characterization and overproduction of a thermo-alkaline pectate lyase from alkaliphilic Bacillus licheniformis with potential in ramie degumming. Process Biochem., 54: 49-58.
CrossRef  |  Direct Link  |  

44:  Li, X., H. Wang, C. Zhou, Y. Ma, J. Li and J. Song, 2014. Cloning, expression and characterization of a pectate lyase from Paenibacillus sp. 0602 in recombinant Escherichia coli. BMC Biotechnol., Vol. 14.
CrossRef  |  Direct Link  |  

45:  Heikinheimo, R., D. Flego, M. Pirhonen, M.B. Karlsson and A. Eriksson et al., 1995. Characterization of a novel pectate lyase from Erwinia carotovora subsp. carotovora. Mol. Plant Microb. Interact., 8: 207-217.
PubMed  |  Direct Link  |  

46:  Hefford, M.A., K. Laderoute, G.E. Willick, M. Yaguchi and V.L. Seligy, 1992. Bipartite organization of the Bacillus subtilis endo-β-1,4-glucanase revealed by C-terminal mutations. Protein Eng., 5: 433-439.
CrossRef  |  Direct Link  |  

47:  Coutinho, J.B., N.R. Gilkes, D.G. Kilburn, R.A.J. Warren and R.C. Miller, 1993. The nature of the cellulose-binding domain effects the activities of a bacterial endoglucanase on different forms of cellulose. FEMS Microbiol. Lett., 113: 211-217.
CrossRef  |  Direct Link  |  

48:  Demain, A.L., M. Newcomb and J.H.D. Wu, 2005. Cellulase, clostridia and ethanol. Microbiol. Mol. Biol. Rev., 69: 124-154.
CrossRef  |  Direct Link  |  

49:  Doi, R.H. and A. Kosugi, 2004. Cellulosomes: Plant-cell-wall-degrading enzyme complexes. Nat. Rev. Microbiol., 2: 541-551.
CrossRef  |  Direct Link  |  

50:  Doi, R.H., M. Goldstein, S. Hashida, J.S. Park and M. Takagi, 1994. The Clostridium cellulovorans cellulosome. Crit. Rev. Microbiol., 20: 87-93.
CrossRef  |  Direct Link  |  

51:  Goldstein, M.A. and R.H. Doi, 1994. Mutation analysis of the cellulose-binding domain of the Clostridium cellulovorans cellulose-binding protein A. J. Bacteriol., 176: 7328-7334.
CrossRef  |  Direct Link  |  

©  2022 Science Alert. All Rights Reserved