Subscribe Now Subscribe Today
Research Article
 

Association Analysis Between Polymorphism of Peroxisome Proliferator-activated Receptor α(PPARα) Gene and Slaughter Performance in Goose



Jun He, Xiangyong Qu and Changqing He
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

PPAR is one cluster of the most important genes that related with lipid metabolism. And it can used as the index of goose strain selection. In this study, we collected 282 blood samples of 75 days Dongting goose to detect the SNPsof PPARα gene by PCR-SSCP. The results showed that in the gene sequence of 215bp had a mutation of C→T and the gene frequency of A,B were 0.393,0.607, respectively, the genotype frequency of AA, AB, BB were 0.126, 0.533, 0.341, respectively. So we can concluded the polymorphism of goose PPARα gene and the genotype frequency of heterozygote was higher in the test samples. After genotype detection of all samples, 35 AA and 96 BB genotype obtained. The abdominal fat weight of AA and BB genotype were 23.14±5.08 and 43.69±8.04, the abdominal fat ratio and liver weight ratio of AA and BB genotype were 0.80±0.30, 2.74±0.82 and 1.58±0.55, 2.87±0.69, respectively. By statistics of variance, the PPARα genotype was highly significantly associated with abdominal fat weight, abdominal fat ratio and liver weight ratio (p<0.05). In general, the abdominal fat weight, abdominal fat ratio and liver weight ratio showed a tendency of BB>AA, indicating that the common allele was the least favorable for abdominal fat deposition. Thus, there is an enormous opportunity to decrease abdominal fat deposition in case this allele is confirmed in other more studies.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Jun He, Xiangyong Qu and Changqing He, 2013. Association Analysis Between Polymorphism of Peroxisome Proliferator-activated Receptor α(PPARα) Gene and Slaughter Performance in Goose. Asian Journal of Animal and Veterinary Advances, 8: 827-832.

DOI: 10.3923/ajava.2013.827.832

URL: https://scialert.net/abstract/?doi=ajava.2013.827.832
 
Received: March 19, 2013; Accepted: August 31, 2013; Published: September 25, 2013



INTRODUCTION

With the development of living standard, produce and consume low-fat, high quality meat has become mainstream. Lipid metabolism is a very complicated biochemical response process and it cooperated with many regulation factors. PPAR gene is known to us that it has important effect to fat deposit and differentiation. Some researches (Kerenzvi et al., 1992; Schoonjans et al., 1996; Lemberger et al., 1996; Xie et al., 2005; Ma et al., 2011; Meng et al., 2002) have showed that activation of PPAR gene could induce redistribution of animal external fat and lean tissue, regulate many gene that participated in lipid metabolism. Especially some important enzymes of β-oxidation process, they charge of fat absorption, transportation, formation, decomposition and so on.

Dongting goose is a fine two-line Hybrid Breed. It is breeding and selection by SiChuan white goose and XuPu goose, which are famous goose breeds in China. Dongting goose mainly used its meat, they have favorable growth rate, however, they also have relative strong ability of deposition external fat. So, if we can select low-fat goose line, it would bring considerable economic and social benefits, fulfill the need of produce and consume.

Now, seldom report about PPAR in goose. We screened the SNP of PPAR by PCR-SSCP, researched the polymorphism and its relate to production performance. Hope to find the relation of SNP and performance of goose. It will helpful to breeding of low-fat goose line and correlation researches in the future.

MATERIALS AND METHODS

Animals and samples preparation: Selected 282 test samples of 75 days Dongting goose. Each collected 1 mL blood sample from wing vein. Then add into 4% EDTA to prevent the blood from concreting. Adopted saturated phenol-chloroform method extracting genome DNA (Sambrook and Russell, 2001), stored in -20°C.

Primer design: According to the sequence of PPARα mRNA in GenBank, designed the prime by Prime Primer 5.0, covered partial coded sequence. Sequence of prime are: F: 5’ AATCACCCAGTGGAGCAG 3', R: 5' CAGACCTTGGCATTCGTC 3'.

PCR-SSCP: Used the prime started to PCR and SSCP analysis. The PCR reaction system is: 10xbuffer (Mg2+) 1 μL, F, R primer (20 μmol L-1) each 0.15 μL, dNTPs (10 μmol L-1) 0.2 μL, Taq DNA polymerase 1U, DNA (100 ng) 0.7 μL and supplement ddH2O to 10 μL totally volume.

Take 5 μL PCR production, mix with 10 μL denaturant, denaturalization 10 min at 98°C and put in ice 5 min at once. Then take 10 μL from them, keep voltage at 80~120V to 15% PAGE (He et al., 2006). When electrophoresis indicator reach bottom of the gel, terminate it and dyeing by silver staining method, record stripline and statistic every genotype number.

After electrophoresis, we PCR the DNA samples of homozygote and give them sequencing to ShangHai Invitrogen Company.

Statistical analysis: SAS program (8.2 version) was used to statistic and analysis all the test data (Xue et al., 2004). Allele and genotypes frequencies were calculated from the genotypes of the 282 goose, respectively. Hardy-Weinberg equilibrium in the studied population was tested by comparing expected and observed genotype frequencies using chi-square test. A linear model was established to analyze the genotypic effects of the locus:

yijl = μ+si+gj+eijl

where, yijl is an observation on the slaughter traits, μ is the overall mean, si is the effect of sex, gj is the effect of genotype and eijl is the random residual. The data were analyzed by GLM procedure.

RESULTS

PCR-SSCP
Result of agarose gel electrophoresis of PCR:
We amplified partial sequence of goose PPAR. From the result of agarose gel electrophoresis Fig. 1, the band of PCR ranged of 242~331 bp. The result showed that the PCR condition was suitable. The size of PCR fragment and aimed gene fragment is consistent and has nice specificity.

Image for - Association Analysis Between Polymorphism of Peroxisome Proliferator-activated Receptor α(PPARα) Gene and Slaughter Performance in Goose
Fig. 1: Agarose gel electrophoresis of PCR product of goose PPAR gene

Image for - Association Analysis Between Polymorphism of Peroxisome Proliferator-activated Receptor α(PPARα) Gene and Slaughter Performance in Goose
Fig. 2: PCR-SSCP electrophoresis of PPAR gene partial sequence

Genotypes 3 had come forth via SSCP: 2 homozygotic type and 1 heterozygotic type. According to the band location of electrophoresis, 2 homozygotic type were defined AA and BB genotype and 1 heterozygotic type was defined AB genotype (Fig. 2). Because the existed of SNP between AA and BB, space conformation of the two homozygotic type were different. This led the different result of electrophoresis. It showed that mutation would change its space conformation and electrophoresis could reflect the change.

Sequence analysis: After sequencing, the sequence of AA and BB gene are as follows:

AA:ttgtggggataaagcctcaggctaccattacggagtacatgcttgtgaaggttgtaagggtttttttaggagaacaatccgatt
gaaactcatctatgataaatgcgatcgcaattgcaaaattcagaaaaaaaatcgtaataagtgccaatactgtcgttttcagaagt
gcctttcagttggaatgtcacataatgcaatacgttttaaaaacaaaaacaggacgaatgccaaggtctg
BB:attgtggggataaagcctcaggctaccattacggagtacatgcttgtgaaggttgtaagggtttttttaggagaacaatccgat
tgaaactcatctatgataaatgcgatcgcaattgcaaaattcagaaaaaaaatcgtaataagtgccaatactgtcgttttcagaagt
gcctttcagttggaatgtcacataatgcaatacgttttaaaaacaaaaataggacgaatgccaaggtctg

Image for - Association Analysis Between Polymorphism of Peroxisome Proliferator-activated Receptor α(PPARα) Gene and Slaughter Performance in Goose
Fig. 3: Mutation site of PPAR gene partial sequence

Table 1: Table of gene frequency and genotype frequency
Image for - Association Analysis Between Polymorphism of Peroxisome Proliferator-activated Receptor α(PPARα) Gene and Slaughter Performance in Goose
χ20.05(2) = 5.99

Table 2: Relation of genotype and performance in goose of different gender
Image for - Association Analysis Between Polymorphism of Peroxisome Proliferator-activated Receptor α(PPARα) Gene and Slaughter Performance in Goose
In the same column, the different capital letters mean significant difference of ♂ in different genotype (p<0.05), the different small letters mean significant difference of ♀ in different genotype (p<0.05) and *mean significant difference of means in different genotype

Selected PCR product of AA and BB, send them to sequencing. From the figure of above, we can deduce that the mutation of C→T in two gene sequence at 215 bp Fig. 3.

Allele frequency and genotype frequency: Upon chi-square test, the difference of our research group was not significant (p>0.05). It showed that the population was fitting hardy-weinberg law, belonged to balance population. Gene frequency of A was 0.392 and B was 0.608. the specific results were listed in Table 1.

By way of ANOVA and multiple comparisons, the results were shown in Table 2, the difference of abdominal fat weight, abdominal fat ratio and liver weight ratio of gander, goose and their means in different genotype were significant (p<0.05). It indicated that the Dongting goose has different fat deposit performance in different genotype. From this point, we could deduce that SNP may interrelate with the performance in a certain extent. It can affect the lipid metabolism. Furthermore, the semi-eviscerated percentage of means and eviscerated percentage of goose had significant difference in genotype of AA and BB (p<0.05).

DISCUSSION

SSCP is a rapid, simple and sensitive mutation detection method. In order to achieve the best results of SSCP, we should pay attention to electrophoresis voltage and temperature. For maintain a stable conformation of single-strand DNA, SSCP should be carried out under low temperature (4~15°C). In addition electrophoresis process temperature, high voltage caused a rise in temperature is the main reason. With about 100 V voltage electrophoresis, which was mainly due to the beginning of high voltage can separate the different conformation of DNA single strand and the gel will not increase the temperature and then the low-voltage electrophoresis can make it further separation (He et al., 2006). How many voltage electrophoresis we can used? It should be based on specific test conditions to determine.

It found in the test that short-chain DNA mutation detection rate higher than the long-chain of SSCP. This may be due to molecules of long-chain DNA, changed single nucleotide plays a small role in maintenance of the conformation. Generally, the midpoint mutation of 300 bp DNA detection rate is over 90%.

Screen SNP of PPAR gene in Dongting goose by PCR-SSCP. It found that there is a G→A mutation in the two allele gene sequence of 215 bp. That showed goose PPAR gene fragments of DNA has single-nucleotide polymorphism and the heterozygous genotype frequencies of test samples were higher, which could related on the breeding of Hybrid Breed System of Dongting goose.

Research has shown that PPAR gene polymorphism related with abdominal fat weight and abdominal fat ratio. The results of this study was similar (Luo et al., 2010). We can see the PPAR gene mutation consisting of different genotypes of goose have some regulation with fat metabolism and deposition. Whether it could be use as a candidate gene remains to be further studied. If there is obviously related, PPAR gene will improve as the candidate genes to goose meat quality trait and apply for marker-assisted selection, provide new ways and means for the scientific breeding of goose.

CONCLUSION

In our detection, the PPARα gene frequency of A, B were 0.393, 0.607, respectively and the genotype frequency of AA, AB, BB were 0.126, 0.533, 0.341, respectively the abdominal fat weight, abdominal fat ratio and liver weight ratio showed a tendency of BB>AA. So the genetic marker can be used as one of the indexes of high, low fat goose strain selection.

ACKNOWLEDGEMENTS

This study was supported by National Natural Science Foundation of China (No. 31101695) and Scientific Project of Hunan Province (2012NK4015).

REFERENCES

1:  Xie, X.L., D. Wang and H. Wang, 2005. Relationship between genotype of PPARα and body fat traits in AA broiler line. Chinese J. Anim. Vet. Sci., 36: 1261-1264.

2:  Schoonjans, K., A.M. Peinado-Onsurbe, R.A. Heyman, M. Briggs, S. Deeb, B. Staels and J. Auwerx, 1996. PPARα and PPARγ activators direct tissue specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J., 15: 5336-5348.

3:  Ma, Y., Y.Y. Wang, X.T. Zhang, F. Li, Q.Z. Wang and X.Z. Wang, 2011. Bioinformatics analysis of duck PPARα gene structure and function. J. Zhejiang Univ. (Agric. Life Sci.), 37: 371-379.
Direct Link  |  

4:  Meng, H., G.H. Wang, Q.G. Wang, J.G. Zhao, Z.L. Gu, Y.X. Wang and H. Li, 2002. Studies of single nucleotide polymorphism of PPAR Gene and its associations with fattiness trait in chicken. J. Gen. Genomics, 29: 119-123.
PubMed  |  Direct Link  |  

5:  Kerenzvi, S., I. Nir and Z. Nitsan, 1992. Effect of dietary concentrations of fat and energy on fat deposition in broiler divergently selected for high or low abdominal adipose tissue. Br. Poultry Sci., 33: 517-524.

6:  Lemberger, T., O. Braissant, C. Juge-Aubry, H. Keller and R. Saladin et al., 1996. PPAR tissue distribution and interactions with other hormone signaling pathways. Ann. NY Acad. Sci, 804: 231-251.
Direct Link  |  

7:  He, J., X.Y. Qu, S.Q. Huang, J. Jiang and C.Q. He, 2006. Optimization of the conditions affecting SSCP analysis. China Anim. Husbandry Vet. Med., 33: 44-46.

8:  Sambrook, J. and D.W. Russell, 2001. Molecular Cloning: A Laboratory Manual. 3rd Edn., Cold Spring Harbor Laboratory Press, New York, USA
Direct Link  |  

9:  Xue, F., W. Zhang and X. Tian, 2004. SAS 8.2 Statics and Applied Guide: Statistics. Hope Electronic Press, Beijing, China

10:  Luo, J.B., Y. Tian, Z.R. Tao, Q.Y. Yuan and G.Q. Li et al., 2010. Regulatory expression of peroxisome proliferator activated receptors genes during fatty liver formation in geese. Agric. Sci. China, 9: 113-120.
CrossRef  |  

©  2021 Science Alert. All Rights Reserved