Subscribe Now Subscribe Today
Research Article
 

Detecting Splicing Variants of FOXP2 and its Protein Expression in Chicken Brain



Xi Wang, Hongxia Li, Mohammod Abdul Hamid and Xingbo Zhao
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

The whole cDNA sequence of chicken FOXP2 gene was obtained by 3' and 5' RACE and the length was 3839 bp, getting four splicing variants for protein isoforms (707 AA, 706AA, 687AA, 684AA). The four splicing variants were common to Zang chicken, White Plymouth Rock, Beijing fat chicken, White leghorns and Rhode Island Red by the detection of a combination of PCR and sequencing and according to two main splicing variants, two antibodies were produced to be used to detect equivalent expression in chicken brain such as cortex, striatum, mesencephalon, thalamus and hypothalamus, in White leghorns (male and female) by immunohistochemistry. The results showed that different FOXP2 mRNA and protein expression had no spatial difference.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Xi Wang, Hongxia Li, Mohammod Abdul Hamid and Xingbo Zhao, 2012. Detecting Splicing Variants of FOXP2 and its Protein Expression in Chicken Brain. Asian Journal of Animal and Veterinary Advances, 7: 702-709.

DOI: 10.3923/ajava.2012.702.709

URL: https://scialert.net/abstract/?doi=ajava.2012.702.709
 
Received: November 28, 2011; Accepted: March 27, 2012; Published: May 10, 2012



INTRODUCTION

Forkhead proteins are important transcriptional regulators that are involved in pattern formation during vertebrate development as well as in tissue specific gene expression (Accili and Arden, 2004; Carlsson and Mahlapuu, 2002; Dirksen and Jamrich, 1992, 1995; El-Hodiri et al., 2001; Erickson, 2001; Kaufmann and Knochel, 1996; Lai et al., 2001; Lai, 1990; Lehmann et al., 2003; Li and Vogt, 1993; Tseng et al., 2004). FOXP2 (Forkhead box protein 2) is a transcription factor mainly consisting of three parts: a polyglutamine tract, a zinc-finger motif and a forkhead DNA-binding domain. FOXP2 gene has several variants to code different protein. FOXP2 is very conservative and its expression was most in brain. In human, mutations in this gene result in impaired linguistic and grammatical skills that together with diminished control of complex face and mouth movements, lead to disrupted speech (Hurst et al., 1990; Lai et al., 2001; Vargha-Khadem et al., 1998).

Despite the importance of the FOXP2, there have been no comparative analyses of different FOXP2 protein expression from splicing variants. It is difficulty to find special different antibodies to make a distinction between the splice variants. To determine if the different protein from splicing variants was expressed in brain, we developed two special antibodies that specifically recognized the two kinds of proteins. We used them for immunocytochemical staining of chicken brain and combined PCR and sequencing to detect mRNA and protein expression.

MATERIAL AND METHODS

Source of animals and tissue: Experimental Chicken were all 180 days and collected from chicken farm of China Agriculture University, including Rhode Island Red (male), Zang chicken(male), White Plymouth Rock(male), Beijing Fat chicken(male), White leghorns(male) and White leghorns(female), procured brain tissue including striatum, thalamus, mesencephalon and cortex. Some were stored at -80°C until analysis and some were soaked in polymer formaldehyde solution.

Total RNA isolation and cDNA synthesis: Total RNA from chicken brain tissue was isolated using TRIzol reagent (invitrogen) and chloroform, according to manufacturer instructions. The RNA was run through a purification process, using an RNeasy mini kit (Qiagen). The quality and concentration of the RNA were determined by measuring absorbance at 260 and 280 nm and RNA integrity was confirmed by agarose gel electrophoresis. RNA was dissolved in diethylpyrocarbonate (DEPC) treated water and stored at -70°C until analysis. Approximately 1 μg total RNA was used to synthesize the first strand cDNA, using an MMLV-RT kit (Promega), according to the manufacturer protocol.

3' RACE (rapid amplification of cDNA Ends) and 5' RACE: According to the FOXP2 information of mouse (NM_212435.1), human (NG_007491.2) and bird (AY549149.1) from GenBank database, the primer 1a and primer 1b were designed, respectively for 3' RACE and 5' RACE by homology (Table 1). RNA PCR Kit ver 3.0 was used in reverse transcription reaction for 3' RACE according to the instruction of the kit (TaKaRa). The product of RACE was tested by 1.5% agarose gel electrophoresis. SMART RACE Kit was used in reverse transcription reaction for 5' RACE according to the instruction of the kit (Clontech). The product of 5' RACE PCR was tested by 1.5% agarose gel electrophoresis.

Designing of primer 2 and primer 3: Two pairs of primers were designed to detect 51 bp deletion in FOXP2 gene sequence. Then a product length of 261 bp would be got if DNA template had no 51 deletion. Meanwhile, the template with 51 bp deletion would get a PCR product of 412 bp because the upstream of primer 3 just crossed the 51 bp deletion (Fig. 1).

Antibody production: Two polyclonal antibodies directed against distinct polypeptide regions within the C-terminus of FOXP2 were employed for our studies to check the protein expression of two main splicing variants (Mohkam et al., 2011; Abdolalizadeh et al., 2008). A commercially available primary antibody could not recognize FOXP2 from different splicing variants and was not suitable to use in chicken, so we developed own antibody in rabbit against FOXP2 according to the results of RACE (Spichkina and Petrov, 2009).

Table 1: Primers in this study
Image for - Detecting Splicing Variants of FOXP2 and its Protein Expression in Chicken Brain

Image for - Detecting Splicing Variants of FOXP2 and its Protein Expression in Chicken Brain
Fig. 1: Location of the primer 2 and primer 3, Note: 1. upstream of primer 2; 2. part of FOXP2 sequence; 3. upstream of primer 3; the underlined parts were location of 51 bp deletion (Table 1)

One FOXP2 antibody (antibody 1) was made against the 12-aa sequence CLQEFYKKQQEQ in the C-terminal region of FOXP2 which was coded by the part of the 51 bp sequence so this antibody was to identify the protein isoforms from variant I (707AA) or variant II (706A) without 51 bp deletion. Another FOXP2 antibody (Antibody 2) was made against the 15-aa sequence SPELEDDREIEEEPC in the N-terminal region of FOXP2 and this antibody recognized all FOXP2 isoforms. The peptides were chosen on the basis of its antigenicity (DNASTAR) and dissimilarity between family members FOXP1 and FOXP4. Similarity of the amino acid sequence to other proteins was excluded by comparisons with family members FOXP1 and FOXP4, as well as by protein blast (blastp) analysis (BLAST). The peptide was conjugated to keyhole limpet hemocyanin and rabbits were immunized with the peptide and complete adjuvant (Sigma-Genosys). Antibody was purified on an affinity purification column with the peptide (Sigma-Genosys).

Immunostaining: For demonstrating the presence and location of FOXP2 in tissue sections, chicken brain tissues were fixed in 4% paraformaldehyde overnight at 4°C, embedded in paraffin and Paraffin-embedded tissues were sliced at 6 mm thickness using a microtome (Leica 2016, Germany). The slides were subjected to immunohistochemical analysis with immunostaining kit, Histostain-Plus Mouse Primary (Invitrogen, USA) according to the manufacturer’s recommendations (El-Kott et al., 2006; Kabbinejadian et al., 2008).

After being washed in PBS, the sections were incubated with 10% goat non-immune serum (Invitrogen, USA) at room temperature for 20 min. The washed sections were then reacted orderly with Primary antibody incubation for 60 min, Antibody 1 or Antibody 2 for 10 min, Streptavidin-HRP solution for 10 min and all steps were in room temperature and Rinsed in wash buffer between steps, respectively. Followed by incubation with biotinylated second antibody (Invitrogen, USA) at 37°C for 15 min and after being washed in PBS, the sections were incubated with streptavidin-peroxidase (HRP) (Invitrogen, USA) at 37°C for 15 min. Finally, the slides were washed with PBS and stained with DAB kit (Invitrogen, USA). After being washed fully with water for 5 min, the slides were stained with hematoxylin and eosin and then examined under a confocal laser scanning microscope (Nikon i 50, Japan) (Iqbal et al., 2002).

RESULTS

RACE: The RACE method was usually used to complete the cloning of the 5' and 3' ends of the open reading frame. The cDNA length of FOXP2 is 3839 bp and ORF (Open Read Frame, ORF) coded 707AA (Fig. 2). Two deletion sequences of 51 bp (CAGCAACAACTACAAGAGTTTTA CAAGAAACAGCAAGAGCAGTTACATCTT) and 3 bp (CAG) were found, respectively and the two deletions brought out four kinds of alternative splicing which coded four different kinds of proteins: variant I (707AA),variant II (706A),variant III (686AA) and variant IV (685AA).

Image for - Detecting Splicing Variants of FOXP2 and its Protein Expression in Chicken Brain
Fig. 2: The results of RACE

Image for - Detecting Splicing Variants of FOXP2 and its Protein Expression in Chicken Brain
Fig. 3(a-b): (a) The 2% agarose gel electrophoretic tests of 51 bp deletion and (b) No 51 bp deletion and in various chicken breeds by PCR (reverse transcription-polymerase chain reaction). Note: M represents DL2000 Plus DNA Ladder marker (from up to down: 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp, 150 bp); 1-15 represent different samples (male): Rhode Island Red (1-3), Zang chicken (4-6), White Plymouth Rock (7-9), Beijing Fat chicken (10-12), White leghorns (13-15)

The difference of variant I and variant II was a change from glutamine (Q) to arginine (R) and more one glutamine (Q) among poly (Q) caused by an insertion of CAG. The different of variant III (686AA) and variant IV (685AA) was the same as the one of variant I and variant II. Variant I had more an 51 bp insertion (17AA) than variant III and so did the variant II than variant IV.

In this Fig. 2, the first deletion of 51 bp existed among the exon3 and the CAG was in the beginning of the exon4.

Assaying four variants in some chicken breeds: Two pairs of primers (primer 2 and primer 3 in Table 1) were used to assay the 51 bp deletion. If Primer 2 was used to amply cDNA samples and the length of PCR product was 261 bp, it was the variant I or variant II (51 bp deletion). For the same reason, if the PCR product was 412 bp by Primer 3, it was the variant III or variant IV (existing 51 bp). Two percent agarose gel electrophoretic tests showed that 51 bp deletion (Fig. 3a) and no 51 bp deletion (Fig. 3b) coexisted in all the samples which were cDNA of corpus striatum.

Image for - Detecting Splicing Variants of FOXP2 and its Protein Expression in Chicken Brain
Fig. 4(a-f): Protein expression of FOXP2 from splicing variants without 51 bp deletion was detected at male chicken brain in White leghorns such as (a) Cortex, (b) Striatum, (c) Mesencephalon, (d) Thalamus, (e) Hypothalamus and (f) Female chicken striatum

Image for - Detecting Splicing Variants of FOXP2 and its Protein Expression in Chicken Brain
Fig. 5(a-f): Protein expression of FOXP2 from splicing variants with and without 51 bp deletion was detected at male chicken brain in White leghorns such as (a) Cortex, (b) Striatum, (c) Mesencephalon, (d) Thalamus, (e) Hypothalamus and (f) Female chicken striatum

A combination of PCR and sequencing detected ACG deletion in striatum of some chicken breeds including Rhode Island Red, Zang chicken, White Plymouth Rock, Beijing Fat chicken, White leghorns and a pair of primer 4 was used. The results showed that ACG deletion existed in all these breeds.

Checking FOXP2 by immunohistochemistry staining: Antibody 1 was used to check FOXP2 in the male and female chicken brain including cortex, striatum, mesencephalon, thalamus and hypothalamus (Fig. 4). So did antibody 2 (Fig. 5). The results showed that the FOXP2 with 51 bp deletion and without 51 bp deletion were both expressed in these sections of chicken brain.

DISCUSSION

FOXP2 gene is very conservative as a transcription factor. There are some variants because of the change number of Q of Poly Q (Polyglutamine) or the different amino acid in different species (Zhang et al., 2011). There were more 2 Qs and 6 Qs in each place of Ploy Q, respectively and more 25 AA in human than in chicken (Enard et al., 2002). Two amino acids, 274T/A and 346S/N were different between human and rat and human has more 2 Qs than rat. FOXP2 in chicken is more 4 Qs than in zebra finch and they have different five amino acids, 24G/S, 42T/S, 79T/S, 80D/E and 576R/G (Haesler et al., 2004). Mammals and birds are quite different species and they went in separate way more than 300 million years ago but only five amino acid of the FOXP2 protein are different between zebra finch and mice, eight between zebra finch and human; songbirds and human have more than 98% identity of the protein (Haesler et al., 2004). In the different amino acid, 576R/G is located in the forkhead DNA-binding domain which maybe implies the main reason that zebra finch is a kind of songbird but chicken is not.

Zebrafish and Mouse FOXP2 is expressed in the diencephalon, thalamus, cerebellum, hindbrain and spinal cord (Ferland et al., 2003; Lai et al., 2003; Teramitsu et al., 2004). This expression pattern is not obviously similar to that of other known genes (Goyal et al., 2010; Raj et al., 2009). Zebrafish FOXP2 is also expressed in the heart but we have not detected embryonic expression in the spleen, kidney or gut, unlike its mouse and songbird orthologs (Haesler et al., 2004; Shu et al., 2001). In humans, FOXP2 expresses in subcortical regions (Lai et al., 2003; Teramitsu et al., 2004) which in the KE family show abnormalities when imaged by use of functional MRI (Liegeois et al., 2003; Watkins et al., 2002). Nevertheless, the previous studies were not related to the mRNA expression of each splicing variants of FOXP2.

In this study, two antibodies were developing according to two FOXP2 proteins, Immunostaining indicated that protein expression of FOXP2 from splicing variants with or without 51 bp was at the cortex, striatum, mesencephalon, thalamus and hypothalamus of chicken brain. This study showed that the two FOXP2 proteins had no spatial expression specificity and that different splicing variants was translated into different protein isoforms which span similar ranges of tissue expression, though they might have different quantity and different function.

The way of using different antibodies to detect differential splicing was not so much in reports but Prescott and Chamberlain (2011) had used this way to study SNAP25a and SNAP25b (Differential splicing of the SNAP25 gene) which expressed differently in their development and region in human and rat brain. These differences might show that alternatively spliced isoforms had distinct functions in Complex neural pathways in the brain (Prescott and Chamberlain, 2011). However in this study, we did not find any different expression and function between different splicing of FOXP2, so more research was needed to show their each function in neural system of brain.

ACKNOWLEDGMENTS

This study was supported by the Domain-Specific Projects for transgenic biological breeding (2011ZX08009-002) and the National Natural Science Foundation of China (Grant No. 31072017). Authors thank Professor Changxin Wu for kindly providing laboratory facilities (China Agricultural University, China).

REFERENCES

  1. Abdolalizadeh, J., J. Majidi and S. Farajnia, 2008. Production and purification of polyclonal antibody against human kappa light chain. J. Boil. Sci., 8: 683-686.
    CrossRef  |  Direct Link  |  


  2. Accili, D. and K.C. Arden, 2004. FoxOs at the crossroads of cellular metabolism, differentiation and transformation. Cell, 117: 421-426.
    Direct Link  |  


  3. Carlsson, P. and M. Mahlapuu, 2002. Forkhead transcription factors: Key players in development and metabolism. Dev. Biol., 250: 1-23.
    PubMed  |  


  4. Raj, G.D., T.M.C. Rajanathan, K. Kumanan and S. Elankumaran, 2009. Expression profile of toll-like receptor mRNA in an indigenous aseel breed of chicken in India. Int. J. Poult. Sci., 8: 651-655.
    CrossRef  |  Direct Link  |  


  5. Dirksen, M.L. and M. Jamrich, 1992. A novel, activin-inducible, blastopore lip-specific gene of Xenopus laevis contains a fork head DNA-binding domain. Genes Dev., 6: 599-608.
    PubMed  |  


  6. Dirksen, M.L. and M. Jamrich, 1995. Differential expression of fork head genes during early Xenopus and zebrafish development. Dev. Genet., 17: 107-116.
    CrossRef  |  


  7. El-Hodiri, H., N. Bhatia-Dey, K. Kenyon, K. Ault, M. Dirksen and M. Jamrich, 2001. Fox (forkhead) genes are involved in the dorso-ventral patterning of the Xenopus mesoderm. Int. J. Dev. Biol., 45: 265-271.


  8. Enard, W., M. Przeworski, S.E. Fisher, C.S. Lai and V. Wiebe et al., 2002. Molecular evolution of FOXP2, a gene involved in speech and language. Nature, 418: 869-872.


  9. Erickson, R.P., 2001. Forkhead genes and human disease. J. Appl. Genet., 42: 211-221.
    PubMed  |  


  10. Ferland, R.J., T.J. Cherry, P.O. Preware, E.E. Morrisey and C.A. Walsh, 2003. Characterization of Foxp2 and Foxp1 mRNA and protein in the developing and mature brain. J. Comp. Neurol., 460: 266-279.
    PubMed  |  


  11. Goyal, G., V. Upmanyu, S.K. Singh, S.K. Shukla, S. Mehra, V. Kumar and D. Sharma, 2010. Differential expression of IL-6 and IGF-II in guinea fowl and chicken. Int. J. Poult. Sci., 9: 756-760.
    CrossRef  |  Direct Link  |  


  12. Haesler, S., K. Wada, A. Nshdejan, E.E. Morrisey, T. Lints, E.D. Jarvis and C. Scharff, 2004. FoxP2 expression in avian vocal learners and non-learners. J. Neurosci., 24: 3164-3175.
    CrossRef  |  


  13. Hurst, J.A., M. Baraitser, E. Auger, F. Graham and S. Norell, 1990. An extended family with a dominantly inherited speech disorder. Dev. Med. Child. Neurol., 32: 352-355.
    CrossRef  |  


  14. Iqbal, A., H.N. Bhatti, S. Nosheen, A. Jamil and M.A. Malik, 2002. Histochemical and physicochemical study of bacterial exopolysaccharides. Biotechnology, 1: 28-33.
    CrossRef  |  Direct Link  |  


  15. Kabbinejadian, S., S. Fouladdel, M. Ramezani and E. Azizi, 2008. p53 expression in MCF-7, T47D and MDA-MB 468 breast cancer cell lines treated with Adriamycin using RT-PCR and Immunocytochemistry. J. Biol. Sci., 8: 380-385.
    CrossRef  |  


  16. Kaufmann, E. and W. Knochel, 1996. Five years on the wings of fork head. Mech. Dev., 57: 3-20.


  17. El-Kott, A.F., E.M. El-Gamal and A.M. Khalil, 2006. Immunohistochemical study of inducible nitric oxide and its prognosis in schistosomasis associated urinary bladder carcinoma. J. Boil. Sci., 6: 1098-1102.
    CrossRef  |  Direct Link  |  


  18. Lai, C.S., S.E. Fisher, J.A. Hurst, F. Vargha-Khadem and P.A. Monaco, 2001. A forkhead-domain gene is mutated in a severe speech and language disorder. Nature, 413: 519-523.


  19. Lai, C.S.L., D. Gerrelli, A.P. Monaco, S.E. Fisher and A.J. Copp, 2003. FOXP2 expression during brain development coincides with adult sites of pathology in a severe speech and language disorder. Brain, 126: 2455-2462.
    CrossRef  |  


  20. Lai, E., 1990. HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated trancriptionally. Genes Dev., 4: 1427-1436.


  21. Lehmann, O.J., J.C. Sowden, P. Carlsson, T. Jordan and S.S. Bhattacharya, 2003. Fox`s in development and disease. Trends Genet., 19: 339-344.


  22. Li, J. and P.K. Vogt, 1993. The retroviral oncogene qin belongs to the transcription factor family that includes the homeotic gene fork head. Proc. Nat. Acad. Sci. USA., 90: 4490-4494.
    Direct Link  |  


  23. Liegeois, F., T. Baldeweg, A. Connelly, D.G. Gadian, M. Mishkin and F. Vargha-Khadem, 2003. Language fMRI abnormalities associated with FOXP2 gene mutation. Nat. Neurosci., 6: 1230-1237.
    PubMed  |  


  24. Mohkam, M., S.H. Zarkesh-Esfahani and M. Fazeli, 2011. Construction of a recombinant fab fragment of a monoclonal antibody against leptin reseptor. Asian J. Biotechnol., 3: 493-506.


  25. Prescott, G.R. and L.H. Chamberlain, 2011. Regional and developmental brain expression patterns of SNAP25 splice variants. Biol. Med. Chem. Neurosci.,
    CrossRef  |  


  26. Shu, W., H. Yang, L. Zhang, M.M. Lu and E.E. Morrisey, 2001. Characterization of a new subfamily of winged-helix/forkhead (Fox) genes that are expressed in the lung and act as transcriptional repressors. J. Biol. Chem., 276: 27488-27497.
    CrossRef  |  


  27. Spichkina, O. and Y. Petrov, 2009. Analysis of primary human keratinocytes using polyclonal antibodies. J. Biol. Sci., 9: 292-301.
    CrossRef  |  Direct Link  |  


  28. Teramitsu, I., L.C. Kudo, S.E. London, D.H. Geschwind and S.A. White, 2004. Parallel FoxP1 and FoxP2 expression in songbird and human brain predicts functional interaction. J. Neurosci., 24: 3152-3163.
    CrossRef  |  


  29. Tseng, H.T., R. Shah and M. Jamrich, 2004. Function and regulation of FoxF1 during Xenopus gut development. Development, 131: 3637-3647.
    CrossRef  |  


  30. Vargha-Khadem, F., K.E. Watkins, C.J. Price, J. Ashburner and K.J. Alcock et al., 1998. Neural basis of an inherited speech and language disorder. Proc. Nat. Acad. Sci. USA., 95: 12695-12700.


  31. Watkins, K.E., N.F. Dronkers and F. Vargha-Khadem, 2002. Behavioural analysis of an inherited speech and language disorder: Comparison with acquired aphasia. Brain: A. J. Neurol., 125: 452-464.
    Direct Link  |  


  32. Zhang, B.L., J. Du, H.B. Han, Z. Lian and N. Li, 2011. Two novel splice variants of the Ovis aries toll-like receptor 4. Asian J. Anim. Vet. Adv., 6: 155-165.
    CrossRef  |  Direct Link  |  


©  2022 Science Alert. All Rights Reserved