Subscribe Now Subscribe Today
Research Article
 

Molecular Detection of Polymorphism of Heat Shock Protein 70 (Hsp70) in the Semen of Iraqi Holstein Bulls



Hassan Nima Habib, Amad Falah Hassan and Bassam Yasein Khudaier
 
Facebook Twitter Digg Reddit Linkedin StumbleUpon E-mail
ABSTRACT

Background and Objective: Hsp70 is a molecular chaperone and cell preservation against heat shock, considered as the ideal biological marker for measuring heat stress in animals, its polymorphism may affect stress tolerance bulls’ fertility. The study aimed to identify polymorphism of hsp70 gene in Holstein bulls born in Iraq. Materials and Methods: The study was carried out during 1st November, 2015 to 31th January, 2016, 29 Holstein bulls born in Iraq, 2.5-3.5 years old, back to Artificial Insemination Center of Abou-Ghareeb Baghdad, Iraq, were used. Semen was collected by using the artificial vagina. DNA extracted then PCR amplified, sequencing, BLAST analysis and multiple sequence alignment were carried out. Results: The results showed three haplotypes, haplotype G1, haplotype G2 and haplotype G3 as a compare with the same gene in GenBank, they all showed silent mutations in different positions except haplotype G2 showed a missense mutation in position 1451 as well as silent mutations. Conclusion: It is concluded that the Holstein bulls born in Iraq have new polymorphism of Hsp70 gene as a compare with same gene in GenBank, because of mutations.

Services
Related Articles in ASCI
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Hassan Nima Habib, Amad Falah Hassan and Bassam Yasein Khudaier, 2017. Molecular Detection of Polymorphism of Heat Shock Protein 70 (Hsp70) in the Semen of Iraqi Holstein Bulls. Asian Journal of Animal Sciences, 11: 132-139.

DOI: 10.3923/ajas.2017.132.139

URL: https://scialert.net/abstract/?doi=ajas.2017.132.139
 
Received: March 15, 2017; Accepted: April 06, 2017; Published: April 15, 2017


Copyright: © 2017. This is an open access article distributed under the terms of the creative commons attribution License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.

INTRODUCTION

Heat shock protein 70 (Hsp70) is one of HSPs family and its size is 68-73 kDa1. It is encoded by a single exon of the Hsp70 gene, the open reading frame to this gene is 1926 bp approximately. The protein comprises 641 amino acids2. The work of Hsp70 is molecular chaperones and cell preservation against heat shock, able of denaturing proteins3, it's one of the most important roles is prevent aggregation of the partially folded proteins remodel folding pathways and regulate activity of proteins4. Expressed in response to heat stress and environmental stress5, hsp70 gene was considered as the ideal biological marker for measuring heat stress in animals6. Polymorphism of hsp70 gene explains the differences between individuals in the tolerance of stress conditions such as heat stress, polymorphism produced by genetic mutations which can be a useful to resist heat stress7. Nucleotide polymorphisms in the hsp70 gene promoter region may affect stress tolerance and haplotypes of Hsp70 were associate with bulls’ fertility and heat tolerance8,9, the difference in reproductive performance was also associated with polymorphism of hsp70 gene10. The Hsp70 is available in spermatozoa of mature bulls11. Although the origin of the Holstein cattle is the cold regions (Europe), can be bred and preserve in tropical and sup-tropical environment like Iraq12, Hsp70 playing a pivotal function in environmental and heat stress adaptation13,14, because it is playing important roles in essential cellular processes and also related to stress15. The main objective of this study was to identify the manipulation of genotype (molecular changing) to capable with harsh environment (high temperature). Therefore, polymorphisms of the hsp70 gene of the Holstein bulls born in Iraq were identified. Since there have been no studies and the lack of information dealing with this subject, this study aimed to identify polymorphism of Hsp70 gene in Holstein bulls which are born in Iraq.

MATERIALS AND METHODS

Animals and semen collection: The study was carried out during 1st November, 2015 to 31th January, 2016. Twenty nine Holstein bulls born in Iraq of known fertility, 2.5-3.5 years old, back to Artificial Insemination Center of Abou-Ghareeb Baghdad, Iraq were used in the present study. Semen was collected from all bulls by using the artificial vagina method.

DNA extraction: The DNA was extracted from semen samples using Chelex-100® (Sigma Aldrich, USA) as already described by Walsh et al.16 and modified by Manuja et al.17. Concentration and purity of DNA was estimated by using Nano-drop system (Nano Drop thermo scientific 200, USA). To determine the best purity, with an estimate 260/280 ratio, which should be 1.8, that indicate the purity of the DNA18.

PCR amplification: Amplifications were performed in 25 μL reactions (Table 1). According to First BASE Laboratories/Malaysia, primer was used to amplify conserved region within the HSP70 promotor, Hsp70-F: ATGGCGAAAAACATGGCTATCGGC, hsp70-R: CTAATCCACCTCCTCAATGGTGGGGCC, First BASE Laboratories/Malaysia, the PCR ( A-2040-1 My Genie/Gradient Thermal Bioneer Korea) amplification cycling protocols of PCR amplification are summarized in Table 2. The PCR product was detected on 1.5% ethidium bromide stained agarose gel. PCR product size was 1926 bp (Fig. 1).

Sequencing: The PCR products purification, then sequenced in First BASE Laboratories/Malaysia. Nucleotide sequence alignments and comparisons were done using the Geneious version 10.1.3 software. BLAST analysis were carried out on website http://www.ncbi.nlm.nih.gov., Multiple Sequence Alignment were carried out on website http://www.ebi.ac.uk/Tools/msa/clustalo/ and compared with same gene in Gene Bank accession number AY662497.1.

RESULTS AND DISCUSSION

Results of sequencing and the multiple sequence alignment were compared with heat shock protein Hsp70 gene of the Holstein bulls in the gene bank. Three new haplotypes were detected and classified as three groups.

First group, the haplotype G1, is the closest haplotype to heat shock protein hsp70 gene in the Holstein bulls in the gene bank.

Table 1:Components of PCR reactions
Image for - Molecular Detection of Polymorphism of Heat Shock Protein 70 (Hsp70) in the Semen of Iraqi Holstein Bulls

Table 2:Cycling protocol of PCR amplification
Image for - Molecular Detection of Polymorphism of Heat Shock Protein 70 (Hsp70) in the Semen of Iraqi Holstein Bulls

Image for - Molecular Detection of Polymorphism of Heat Shock Protein 70 (Hsp70) in the Semen of Iraqi Holstein Bulls
Fig. 1:Gel electrophoresis of PCR products of Hsp70 gene
 
Sample 1 and 7: DNA marker, Sample 2: -ve is no-template control (water to replace DNA template), Sample 3-6: DNA template (Hsp70 gene), A total 75 ng of DNA sample was used in one 25 μL PCR reaction. only 3 μL of PCR product was run on 1% TAE agarose of PCR product was run on 1% TAE agarose gel at 100 V, 60 min

This haplotype was exposed to genetic mutations in nucleotides at positions, 6 (C<G), 174 (C<G), 282 (A<G) and 1339 (T<C). All mutations are silent that did not encode a new amino acid. Fifteen Bulls were found in this group.

Second group, the haplotype G2, in comparison with Hsp70 gene in the Holstein bulls in the gene bank and first group. Nucleotides were substituted in eight different positions, 114 (G<A), 174 (C<G). 282 (A<G) ,1339 (T<C), 1451 (C<A), 1590 (A<G ), 1695 (C<T) and 1719 (G<T). These genetic mutations are all silent except the mutation at the position 1451 (missense mutation). It encoded for new amino acid (Aspartic acid instead of alanine). The change nucleotide cytosine (C) instead of adenine (A) led to a change code GCC to GAC which encode a new amino acid19. Six bulls were found in this group.

Third group, the haplotypeG3, in comparison with Hsp70 gene in the Holstein bulls in the gene bank and other groups, in this group nucleotides were substituted for each position 114 (G<A), 174 (C<G), 282 (A<G), 1339 (T<C), 1590 (A<G), 1695 (C<T) and 1719 (G<T). All mutations are silent. Eight bulls were found in this group.

The results of the Multiple Sequence Alignment (MSA) of hsp70 gene in the bulls (Fig. 2) showed that the convergence ratio of G1, G2 and G3 haplotypes were 99.73, 99.51 and 99.56%, respectively.

These results showed silent mutations in different positions of hsp70 gene, although it does not encode a new amino acid20 but it may influence the relevant protein through change in transcription and may impact the precision or efficiency of splicing of mRNA or control of transcripts21,22. On the other hand the missense mutation that occurred in haplotype G2 may change protein properties due to differences between amino acids, aspartic and alanine23.

These mutations may effect on protein folding and stability24, protein function25 and protein-protein intractions26.

Image for - Molecular Detection of Polymorphism of Heat Shock Protein 70 (Hsp70) in the Semen of Iraqi Holstein Bulls
Image for - Molecular Detection of Polymorphism of Heat Shock Protein 70 (Hsp70) in the Semen of Iraqi Holstein Bulls
Image for - Molecular Detection of Polymorphism of Heat Shock Protein 70 (Hsp70) in the Semen of Iraqi Holstein Bulls
Fig. 2:Identified Hsp70 gene in Iraqi Holstein bulls and the same gene in GenBank
  CLUSTAL Omega (1.2.4) multiple sequence alignment

The result agree with Li et al.27, Sodhi et al.28, Kerekoppa et al.29 and Bhat et al.3 on the possibility of polymorphism of hsp70 gene in cattle.

While the results indicate that the Iraqi Holstein bulls have new haplotypes of hsp70 in comparison with that recorded in GenBank. The haplotypes of this gene identified from Holstein cattle in Japan and Poland were identical accession number AY662497.130,31. Similar results were found in Italian6 and Chinese Holstein32. However, polymorphism of crossing Indian cattle with Holstein disagreed with this result33.

There is no study in line with the results of this study on the location of mutations and perhaps the reason is that this study is the first of its kind on the hsp70 gene polymorphism in the Holstein bulls in Iraq.

These results might indicate that the Iraqi Holstein bulls have adapted significantly to resist heat stress conditions through changes in the polymorphism of the Hsp70 gene, that's because the mutations in Hsp70 gene could be used as marker for heat stress tolerances27 and assisted selection for resistant to heat stress in the breeding34 but this needs to be further studied to determine the association between Hsp70 gene polymorphism in semen and its characteristics in Holstein bulls born in Iraq.

CONCLUSION

This study showed three new haplotypes of the Hsp70 gene in the Holstein bulls born in Iraq as a result of mutations in different positions, where Holstein can modify their genotypes of hsp70 gene to adapting surrounding environmental conditions, even it was originated in different environments. These changes did not affect the animal fitness.

SIGNIFICANCE STATEMENTS

This study discovers that the Hsp70 gene can manipulate by mutations (silent or missense) according to the environment conditions. This study will help the researcher to uncover the polymorphisms of hsp70 gene in Holstein bulls born in Iraq and helps to study the relationship between hsp70 gene polymorphism and semen quality as a guide to the selection of bulls.

ACKNOWLEDGMENTS

The authors would like to thank Prof. Dr: Asaad Y. Ayied, Department of Animal Production, College of Agriculture, University of Basrah, Iraq. For his scientific assistance in completing this paper.

REFERENCES

1:  Pockley, A.G., M. Muthana and S.K. Calderwood, 2008. The dual immunoregulatory roles of stress proteins. Trends Biochem. Sci., 33: 71-79.
CrossRef  |  Direct Link  |  

2:  Gade, N., R.K. Mahapatra, A. Sonawane, V.K. Singh, R. Doreswamy and M. Saini, 2010. Molecular characterization of heat shock protein 70-1 gene of goat (Capra hircus). Mol. Biol. Int., Vol. 2010.
CrossRef  |  Direct Link  |  

3:  Bhat, S., P. Kumar, N. Kashyap, B. Deshmukh and M.S. Dige et al., 2016. Effect of heat shock protein 70 polymorphism on thermotolerance in Tharparkar cattle. Vet. World, 9: 113-117.
CrossRef  |  Direct Link  |  

4:  Mashaghi, A., S. Bezrukavnikov, D.P. Minde, A.S. Wentink and R. Kityk et al., 2016. Alternative modes of client binding enable functional plasticity of Hsp70. Nature, 539: 448-451.
CrossRef  |  PubMed  |  Direct Link  |  

5:  Mohanarao, G.J., A. Mukherjee, D. Banerjee, M. Gohain and G. Dass et al., 2014. HSP70 family genes and HSP27 expression in response to heat and cold stress in vitro in peripheral blood mononuclear cells of goat (Capra hircus). Small Rumin. Res., 116: 94-99.
CrossRef  |  Direct Link  |  

6:  Srikanth, K., A. Kwon, E. Lee and H. Chung, 2017. Characterization of genes and pathways that respond to heat stress in Holstein calves through transcriptome analysis. Cell Stress Chaperones, 22: 29-42.
CrossRef  |  Direct Link  |  

7:  Cai, Y., Q. Liu, G. Xing, L. Zhou and Y.Y. Yang et al., 2005. Polymorphism of the promoter region of Hsp70 gene and its relationship with the expression of HSP70mRNA, HSF1mRNA, Bcl-2mRNA and Bax-αmRNA in lymphocytes in peripheral blood of heat shocked dairy cows. Asian-Aust. J. Anim. Sci., 18: 734-740.
Direct Link  |  

8:  Rosenkrans, Jr., C., A. Banks, S. Reiter and M. Looper, 2010. Calving traits of crossbred Brahman cows are associated with heat shock protein 70 genetic polymorphisms. Anim. Reproduct. Sci., 119: 178-182.
CrossRef  |  Direct Link  |  

9:  Basirico, L., P. Morera, V. Primi, N. Lacetera, A. Nardone and U. Bernabucci, 2011. Cellular thermotolerance is associated with heat shock protein 70.1 genetic polymorphisms in Holstein lactating cows. Cell Stress Chaperones, 16: 441-448.
CrossRef  |  Direct Link  |  

10:  Cushman, R.A., 2013. The current status of heat shock in early embryonic survival and reproductive efficiency. J. Anim. Sci., 91: 1141-1142.

11:  Kamaruddin, M., T. Kroetsch, P.K. Basrur, P.J. Hansen and W.A. King, 2004. Immunolocalization of heat shock protein 70 in bovine spermatozoa. Andrologia, 36: 327-334.
CrossRef  |  Direct Link  |  

12:  Abdel Rahman, I.M.K. and T.A. Alemam, 2008. Reproductive and productive performance of Holstein-Friesian cattle under tropical conditions with special reference to Sudan-a review. Agric. Rev., 29: 68-73.
Direct Link  |  

13:  Gupta, M., S. Kumar, S.S. Dangi and B.L. Jangir, 2013. Physiological, biochemical and molecular responses to thermal stress in goats. Int. J. Livestock Res., 3: 27-38.
Direct Link  |  

14:  Banerjee, D., R.C. Upadhyay, U.B. Chaudhary, R. Kumar and S. Singh et al., 2014. Seasonal variation in expression pattern of genes under HSP70: Seasonal variation in expression pattern of genes under HSP70 family in heat- and cold-adapted goats (Capra hircus). Cell Stress Chaperones, 19: 401-408.
CrossRef  |  Direct Link  |  

15:  Yu, A., P. Li, T. Tang, J. Wang, Y. Chen and L. Liu, 2015. Roles of Hsp70s in stress responses of microorganisms, plants and animals. BioMed Res. Int., Vol. 2015.‏
CrossRef  |  Direct Link  |  

16:  Walsh, P.S., D.A. Metzger and R. Higuchi, 1991. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques, 10: 506-513.
PubMed  |  

17:  Manuja, A., S. Manchanda, B. Kumar, S. Khanna and R.K. Sethi, 2010. Evaluation of different methods of DNA extraction from semen of buffalo (Bubalus bubalis) bulls. Buffalo Bull., 29: 109-128.

18:  Desjardins, P. and D. Conklin, 2010. NanoDrop microvolume quantitation of nucleic acids. J. Vis. Exp., Vol. 45.‏
CrossRef  |  Direct Link  |  

19:  Kimball, J., 2014. The genetic code. Kimball's Biology Pages. http://www.biology-pages.info/C/Codons.html.

20:  Kimchi-Sarfaty, C., J.M. Oh, I.W. Kim, Z.E. Sauna, A.M. Calcagno, S.V. Ambudkar and M.M. Gottesman, 2007. A "silent" polymorphism in the MDR1 gene changes substrate specificity. Science, 315: 525-528.
CrossRef  |  Direct Link  |  

21:  Cartegni, L., S.L. Chew and A.R. Krainer, 2002. Listening to silence and understanding nonsense: Exonic mutations that affect splicing. Nat. Rev. Genet., 3: 285-298.
Direct Link  |  

22:  Komar, A.A., 2007. Silent SNPs: Impact on gene function and phenotype. Pharmacogenomics, 8: 1075-1080.
CrossRef  |  PubMed  |  Direct Link  |  

23:  Scopelliti, A.J., R.M. Ryan and R.J. Vandenberg, 2013. Molecular determinants for functional differences between alanine-serine-cysteine transporter 1 and other glutamate transporter family members. J. Biol. Chem., 288: 8250-8257.
CrossRef  |  Direct Link  |  

24:  Ode, H., S. Matsuyama, M. Hata, S. Neya, J. Kakizawa, W. Sugiura and T. Hoshino, 2007. Computational characterization of structural role of the non-active site mutation M36I of human immunodeficiency virus type 1 protease. J. Mol. Biol., 370: 598-607.
CrossRef  |  Direct Link  |  

25:  Yamada, Y., Y. Banno, H. Yoshida, R. Kikuchi, Y. Akao, T. Murate and Y. Nozawa, 2006. Catalytic inactivation of human phospholipase D2 by a naturally occurring Gly901Asp mutation. Arch. Med. Res., 37: 696-699.
CrossRef  |  Direct Link  |  

26:  Jones, R., M. Ruas, F. Gregory, S. Moulin and D. Delia et al., 2007. A CDKN2A mutation in familial melanoma that abrogates binding of p16INK4a to CDK4 but not CDK6. Cancer Res., 67: 9134-9141.
CrossRef  |  Direct Link  |  

27:  Li, Q., J. Han, F. Du, Z. Ju and J. Huang et al., 2011. Novel SNPs in HSP70A1A gene and the association of polymorphisms with thermo tolerance traits and tissue specific expression in Chinese Holstein cattle. Mol. Biol. Rep., 38: 2657-2663.
PubMed  |  

28:  Sodhi, M., M. Mukesh, A. Kishore, B.P. Mishra, R.S. Kataria and B.K. Joshi, 2013. Novel polymorphisms in UTR and coding region of inducible heat shock protein 70.1 gene in tropically adapted Indian zebu cattle (Bos indicus) and riverine buffalo (Bubalus bubalis). Gene, 527: 606-615.
CrossRef  |  Direct Link  |  

29:  Kerekoppa, R.P., A. Rao, M. Basavaraju, G.R. Geetha and L. Krishnamurthy et al., 2015. Molecular characterization of the HSPA1A gene by single-strand conformation polymorphism and sequence analysis in Holstein-Friesian crossbred and Deoni cattle raised in India. Turk. J. Vet. Anim. Sci., 39: 128-133.
Direct Link  |  

30:  Sugimoto, M., H. Furuoka and Y. Sugimoto, 2003. Deletion of one of the duplicated Hsp70 genes causes hereditary myopathy of diaphragmatic muscles in Holstein‐Friesian cattle. Anim. Genet., 34: 191-197.
CrossRef  |  Direct Link  |  

31:  Adamowicz, T., E. Pers and D. Lechniak, 2005. A new SNP in the 3'-UTR of the hsp 70-1 gene in Bos Taurus and Bos indicus. Biochem. Genet., 43: 623-627.
PubMed  |  Direct Link  |  

32:  Xiong, Q., J. Chai, H. Xiong, W. Li and T. Huang et al., 2013. Association analysis of HSP70A1A haplotypes with heat tolerance in Chinese Holstein cattle. Cell Stress Chaperones, 18: 711-718.
CrossRef  |  Direct Link  |  

33:  Deb, R., B. Sajjanar, U. Singh, S. Kumar and G.S. Sengar et al., 2016. Cytosine deletion at AP2-box region of HSP70 promoter and its influence on semen quality traits in crossbred bulls. J. Genet., 95: 1035-1038.
CrossRef  |  Direct Link  |  

34:  Gafer, J.A., G.H. Abd El-Rahman and Z.M. Rawash, 2015. Association of Hsp70 gene polymorphism and bull semen quality in winter and summer seasons. Alexandria J. Vet. Sci., 46: 1-14.
CrossRef  |  Direct Link  |  

©  2021 Science Alert. All Rights Reserved