Asian Science Citation Index is committed to provide an authoritative, trusted and significant information by the coverage of the most important and influential journals to meet the needs of the global scientific community.  
ASCI Database
308-Lasani Town,
Sargodha Road,
Faisalabad, Pakistan
Fax: +92-41-8815544
Contact Via Web
Suggest a Journal
 
Articles by Trina Ekawati Tallei
Total Records ( 6 ) for Trina Ekawati Tallei
  Johanis Jullian Pelealu , Lalu Wahyudi and Trina Ekawati Tallei
  Background and Objective: Indonesia is rich in non-rice carbohydrate sources including tubers and seeds, but the achievement of consumption these kind of food has only reached 5%. One of these tubers is purple sweet potato. This study aimed to examine the effect of administration of Arbuscular Mycorrhizal Fungi (AMF) and Organic Fertilizer (OF) on the growth and production of purple sweet potatoes. Materials and Methods: Purple sweet potato seeds were sown in the form of plant stems. This study used factorial Randomized Block Design (RBD) consisting of 2 factors with 4 replications. The first factor is the dose of AMF and the second factor is OF. The agronomical parameters observed included stem length, number of leaves, number of branches, number of flowers as well as weight, diameter, number and length of tuber. All variables were analyzed with one-way analysis of variance (ANOVA). Results: The results showed that the administration of 20 and 30 g of AMF supplemented with 50 g of OF (m2p1 and m3p1, respectively) significantly increased stem length, number of leaves, number of branches, tuber weight, diameter and length. Statistical analysis showed a highly significant increase in potato yield for inoculated plants compared with non-inoculated controls. Conclusion: Hence, it can be concluded that application of Arbuscular Mycorrhizal Fungi in combination with organic fertilizer were able to improve the plant growth and the tuber yield of purple sweet potato.
  Jusuf Manueke , Berty Herny Assa , Juliet Merry Eva Mamahit , Dantje Tarore and Trina Ekawati Tallei
  Background and objective: Clove is Indonesia's main spice commodity and one of the 16 leading national plantation commodities. However, the production is not optimal due to the attack of clove stem borer (Hexamithodera semivelutina). This study was aimed to evaluate the effect of 4 commercial synthetic pyrethroid insecticides on stem borer that attacked clove plants. Materials and Methods: The experiment was conducted on clove plantation in Kombi District, Minahasa Regency, North Sulawesi. The method used in this study was an experimental method using a randomized block design (RBD) with 5 treatments and 4 replications. Determination of clove trees for the treatment was done intentionally by selecting the hoist holes caused by active stem borers. Symptoms that were shown on the stem of the plant were liquid discharge and also the remnants of the borehole found on the clove tree stem. Results: The results showed that pyrethroid insecticides H, V, B and M were able to heal the wound/hoist holes on the clove plant stem. The most effective pyrethroid insecticides were B and M which cured almost all of the boreholes. The effectiveness of each insecticide was as follows: B (100%), M (95%), H (55%) and V (50%). Conclusion: The data revealed that a combination of synthetic pyrethroid insecticide prallethrin 0.1%, cypermethrin 0.1% and transfluthrin 0.1% was the most effective in controlling the stem borer larvae.
  Vierta Ramlan Tallei , Saroyo and Trina Ekawati Tallei
  Background and Objective: Disturbance in Mt. Tumpa forest park, North Sulawesi has affected the diversity of its mammals species. This is caused by habitat degradation due to irresponsible land clearing and illegal loging which leads to forest habitat fragmentation. This threatens the survival of some Sulawesi’s endemic mammals which reside in the forest, such as Macaca nigra and Tarsius spectrum. In this present study, survey was conducted to analyse wild mammals diversity record in forest park, North Sulawesi, Indonesia. Materials and Methods: Species richness, diversity and abundance of recorded mammals across the variety of habitat were estimated. This was done by establishing randomly selected transect lines across four types of habitat: primary and secondary rain forest, shrub, meadow and agricultural land. Species richness was the total number of the species in a community and measured using Margalef’s index (Dmg). Shannon-Wiener (H’) index was used to determine diversity of mammals. Eveness (E) of species distribution was calculated according to Krebs and supported by measurement of Lorenz curve using Excel 2013. Results: The data showed that there were a total of 621 individuals of mammals consist of eleven species and nine families recorded. The most abundant species was tarsier (Tarsius spectrum). The value of Shannon-Wiener index 1.48 indicates that the diversity, the spread of number of individuals in each species and community stability are moderate. While, the value of evenness below one ( 0.62) indicates that there is a dominant species in the community and the species distribution is uneven. In addition, the species richness in this area is moderate based on its value 1.71. Furthermore, the relatively low abundance (0.97) of macaque (Macaca nigra) indicates that the forest habitat has been degraded. Conclusion: The study reveals moderate diversity of wild mammals in Mt. Tumpa forest park. This information shows that hunting and deforestration in this area should be controlled for the sake of better conservation of the endemic and endangered faunal resource. The result of this study will contribute to the wild mammal conservation effort in this area, especially those of endemic species such as M. nigra and T. spectrum.
  Marjam Magdalena Toding , Trina Ekawati Tallei and Dwinita Wikan Utami
  Background and Objective: The genetic character of North Sulawesi’s local rice cultivated by local communities has not been extensively explored. Genetic character can be used as tool for rice varieties identification to complement the morphological characters. This study aimed at developing genetic character of North Sulawesi’s local rice varieties Burungan and Super Win using SSR and SNP molecular markers. Materials and Methods: Two local North Sulawesi varieties of rice from Bolaang Mongondow Regency, namely Super Win (Tropical Japonica) and Burungan (Japonica), were used. Control varieties included in this research were IR64 (Indica), Nipponbare (Japonica), Super Win Aromatik (Tropical Japonica) and Leukat Hitam (Tropical Japonica). The significant markers associated with agro-morphological characters were used, such as flowering date, panicle length, flag leaf corner, leaf length, panicle branches and the number of productive tillers. The SSR and SNP 384-chip which are mapped in the entire rice genome were employed. Results: The study showed that Burungan has alleles’ size range 108.7-148.8 with a mean size of alleles 118.97. The frequency of this allele is 33.33%. Alleles’ size range of Super Win is 109.2-148.8 with a mean size of alleles 119.50. The frequency of this allele is 22.22%. This diversity variation of allele size cannot be used as a genetic identifier for both varieties. The genetic distance between Burungan and Super Win varieties was quite high (0.461). It was due to they came from different sub species, Burungan was from Japonica while Super Win was from Tropical Japonica. Conclusion: Burungan and Super Win varieties are not a local rice of North Sulawesi.
  Gracia Alice Victoria Pollo , Sarah Celia Pertiwi Sumarauw , Sofia Safitri Hessel and Trina Ekawati Tallei
  Background and Objective: Genetic variation in the form of a single nucleotide polymorphisms (SNPs) in the tumor necrosis factor alpha (TNF-α) promoter region is known to influence the regulation of TNF-α production, transcription and translation and has been linked to several diseases. Primer sequences that amplify DNA flanking the -308 sequence are not universal, therefore, research on SNP conducted in this area still uses different primer pairs. The purpose of this research was to design and optimize universal primers to amplify DNA sequences covering the TNF-α -308 promoter area for other researchers to study the presence of SNPs in the -308 nucleotide and beyond. Materials and Methods: The peripheral blood samples for DNA preparation were obtained from 3 participants. The DNAs were extracted using available commercial kit. The candidate of universal primers were designed using BLAST and Primer3 softwares. Amplification of DNA region flanked by the designed primer pairs was performed using PCR method using available commercial kit. Results: The study showed that there were significant differences between the 5 primary pairs studied. From the 5 pairs of primers, the TNF-α 1 primer pair (TNF-α 1F: AACCAGCATTATGAGTCTC and TNF-α 1R: AACAACTGCCTTTATATGTC) and the TNF-α 2 primer pair (TNF-α 2F: TGAAACCAGCATTATGAGT and TNF-α 2R: AACAACTGCCTTTATATGTC) produced single, distinct, sharp and thick bands. Conclusion: From this study it can be concluded that TNF-α 1 and TNF-α 2 primer pairs have the potential to be used as universal primers to study the SNPs in the TNF-α -308 promoter region.
  Billy Kepel , Widdhi Bodhi , Fatimawali and Trina Ekawati Tallei
  Background and Objective: North Sulawesi is rich in minerals, among them gold is also present. The gold mining in the Buyat area produces heavy metal waste which can pollute the environment, among others is arsenic. Arsenic is a heavy metal that is very toxic to humans, so an agent is needed for the remediation process. The aim of this study was to isolate and identify arsenic-resistant bacteria from the Buyat estuary and beach to analyze the isolates’ ability to detoxify arsenic. Materials and Methods: Soil sediment samples were obtained from Buyat estuary and beach in North Sulawesi. Isolation of arsenic-resistant bacteria was carried out by growing the samples in LB broth media containing 100, 500 and 1000 ppm arsenite. Indentification of arsenic-resistant bacteria was carried out by microbiological, biochemical and biomolecular analysis. The ability to detoxify arsenite was analyzed by CVAFS. Results: The study showed that there were 4 isolates of arsenic-resistant bacteria isolated from the soil samples. All isolates are rod-shaped, Gram-negative and non-motile bacteria. BLAST results showed that isolates A was Stenotrophomonas sp., isolate B was Stenotrophomonas maltophilia, isolate C was Pseudomonas sp. and isolate D was Pseudomonas putida. All isolates reduced the levels of arsenic in media by almost 100% within 72 h. Conclusion: The study suggested that Stenotrophomonas sp., S. maltophilia, Pseudomonas sp. and P. putida had the potentials to be used in the bioremediation of arsenic.
 
 
 
Copyright   |   Desclaimer   |    Privacy Policy   |   Browsers   |   Accessibility