Asian Science Citation Index is committed to provide an authoritative, trusted and significant information by the coverage of the most important and influential journals to meet the needs of the global scientific community.  
ASCI Database
308-Lasani Town,
Sargodha Road,
Faisalabad, Pakistan
Fax: +92-41-8815544
Contact Via Web
Suggest a Journal
Articles by Gracia Alice Victoria Pollo
Total Records ( 1 ) for Gracia Alice Victoria Pollo
  Gracia Alice Victoria Pollo , Sarah Celia Pertiwi Sumarauw , Sofia Safitri Hessel and Trina Ekawati Tallei
  Background and Objective: Genetic variation in the form of a single nucleotide polymorphisms (SNPs) in the tumor necrosis factor alpha (TNF-α) promoter region is known to influence the regulation of TNF-α production, transcription and translation and has been linked to several diseases. Primer sequences that amplify DNA flanking the -308 sequence are not universal, therefore, research on SNP conducted in this area still uses different primer pairs. The purpose of this research was to design and optimize universal primers to amplify DNA sequences covering the TNF-α -308 promoter area for other researchers to study the presence of SNPs in the -308 nucleotide and beyond. Materials and Methods: The peripheral blood samples for DNA preparation were obtained from 3 participants. The DNAs were extracted using available commercial kit. The candidate of universal primers were designed using BLAST and Primer3 softwares. Amplification of DNA region flanked by the designed primer pairs was performed using PCR method using available commercial kit. Results: The study showed that there were significant differences between the 5 primary pairs studied. From the 5 pairs of primers, the TNF-α 1 primer pair (TNF-α 1F: AACCAGCATTATGAGTCTC and TNF-α 1R: AACAACTGCCTTTATATGTC) and the TNF-α 2 primer pair (TNF-α 2F: TGAAACCAGCATTATGAGT and TNF-α 2R: AACAACTGCCTTTATATGTC) produced single, distinct, sharp and thick bands. Conclusion: From this study it can be concluded that TNF-α 1 and TNF-α 2 primer pairs have the potential to be used as universal primers to study the SNPs in the TNF-α -308 promoter region.
Copyright   |   Desclaimer   |    Privacy Policy   |   Browsers   |   Accessibility