Subscribe Now Subscribe Today
Abstract
Fulltext PDF
References

Research Article
Tobacco Callus Culture as a Propagating Medium for Cucumber Mosaic Cucumovirus

Sohair I. El-Afifi , Ali M. El-Borollosy and Sabry Y.M. Mahmoud
 
ABSTRACT
This study was performed on Cucumber mosaic cucumovirus (CMV) as a model. The virus was isolated from naturally infected cucumber plants depending on polyclonal antibodies specific for the CMV (subgroup I) and local lesions produced on Chenopodium amaranticolor were used as a source of single lesion isolation. CMV isolate was maintained in Nicotiana tabacum cv. White Burley. The presence of viral spherical particles was confirmed by electron microscopic examination. Infected callus tissues were prepared by syringe injection with infectious clarified tobacco sap with the aid of Millipore® filter. CMV was purified from both infected tobacco leaves and calli tissues. The purification method was modified to omit the sap clarification step when using calli as a purification source. After spectrophotometry and electron microscopic evaluation purified preparations from both sources were used for rabbit immunization to produce polyclonal antibodies. IgGs were purified and evaluated by determination of their dilution end points using indirect enzyme linked immunosorbant assay (I-ELISA) and their reaction against healthy tobacco sap as a control. The CMV coat protein gene (cp) was isolated and amplified from both kinds of infected tissues using immunocapture reverse transcription polymerase chain reaction (IC-RT-PCR). PCR products were analyzed by agarose gel electrophoresis.
Services
Related Articles in ASCI
Similar Articles in this Journal
Search in Google Scholar
View Citation
Report Citation

 
  How to cite this article:

Sohair I. El-Afifi , Ali M. El-Borollosy and Sabry Y.M. Mahmoud , 2007. Tobacco Callus Culture as a Propagating Medium for Cucumber Mosaic Cucumovirus. International Journal of Virology, 3: 73-79.

DOI: 10.3923/ijv.2007.73.79

URL: http://scialert.net/abstract/?doi=ijv.2007.73.79

INTRODUCTION

Cucumber mosaic virus (CMV, family: Bromoviridae, genus: Cucumovirus) is one of the most widespread plant viruses in the world with extensive host range infecting about 1000 species including cereals, fruits, vegetables and ornamentals (Brunt et al., 1996; Roossinck, 1999). CMV is a multicomponent virus with a single stranded positive sense RNA. RNAs 1 and 2 are associated with viral genome replication while RNA 3 encodes for movement protein and coat protein. Numerous strains of CMV have been classified into two major subgroups (subgroups I and II) on the basis of serological properties and nucleotide sequence homology (Palukaitis et al., 1992; Madhubala et al., 2005). The subgroup I has been further divided into two groups (IA and IB) by phylogenetic analysis (Roossinck, 1999). Occurrence of subgroup I was found to be predominant in many countries worldwide (Singh et al., 1995; Hord et al., 2001; Madhubala et al., 2005).

Tissue culture has acquired many practical applications in agriculture, one of the most established uses is an efficient, safe and often economical method of plant propagation (Cooke, 1977). Another valuable advantage of tissue culture is to produce virus-free plant materials as most of crop plants especially those propagated by vegetative means are systemically infected with one or more virus. Such infection usually reduces crops yield and quality (Xu et al., 1994).

Callus tissues can be used as a source of virus instead of plants growing in greenhouses. The advantage of such application is to protect virus strains from mechanical contamination or by vector insects (McMorran and Allen, 1983; El-Afifi et al., 2003 a, b). In addition, concentration of virus is higher in callus tissue compared with infected leaves (PVX: Dhingra et al., 1987; SbMV: El-Afifi, 1997; ToMV and PVY: El-Afifi et al., 2003 a, b).

Viruses can be easily purify from callus tissues as it is less complicated compared with plant leaf tissues (Duran-Villa et al., 1989) and also containing less amount of plant components (Kassanis, 1967). Antisera produced by immunizing rabbits with such purified preparations can be more specific and gave less non specific reactions when used in virus detection within infected plants (El-Afifi et al., 2003b).

Therefore, the objective of this study is to propagate CMV in tobacco callus culture, comparative study for using infected tobacco leaves and calli for viral purification and polyclonal antisera production and to evaluate the viral infection level in both sources and produced antisera specificity using IC-RT-PCR.

MATERIALS AND METHODS

Virus Isolation
Fifty samples of naturally infected cucumber plants (Collected from the open field of Faculty of Agriculture, Sohag University, Sohag, Egypt) generally showing mosaic, mottling and malformation were used for virus isolation. According to Koenig (1981) I-ELISA was performed on samples using polyclonal antibodies specific for CMV (Subgroup I) (purchased from Agdia Inc., USA) and zucchini yellow mosaic potyvirus (ZYMV) (purchased from AGERI, ARC, Egypt). Samples giving only CMV positive results were mechanically inoculated on Ch. amaranticolor. Local lesions produced were used as a source of single lesion isolation and virus was maintained in N. tabacum cv. White Burley under greenhouse conditions (26°C±2).

Preparing of Virus Infected Tissues
Healthy N. tabacum cv. White Burley plants (carrying 5 leaves) were mechanically inoculated with CMV isolate and kept under greenhouse conditions. Twenty days later, 200 g leaves (showing symptoms) were collected and kept at -20°C till used.

Healthy N. tabacum cv. White Burley callus cultures were prepared using 5x5 mm pieces from upper fully grown leaves as explants. Explants were disinfected (using 0.25% sodium hypochlorite) and cultured on MS medium [containing 1.0 mg benzyl adenine (BA), 2.0 mg naphthalene acetic acid (NAA), 30 g sucrose, 7.0 g agar per liter and pH was adjusted to 5.8] under conditions described by Murashige and Skoog (1962). Twenty days aged calli were inoculated with CMV tobacco infected clarified sap using sterilized syringe connected to Millipore® filter (0.45 μm). Tissues were collected 20 days post inoculation and 200 g was kept at -20°C for usage.

Virus Purification and Evaluation
CMV isolate was purified from both infected leaves and calli tissues (200 g for each) depending on a method described by Lot et al. (1972) with some modifications. Clarification step was omitted when callus tissues were used as a source for virus purification. Concerning leaves, chloroform was added to sap for clarification with rate of 1:1 (v/v) and centrifugation was performed at 3000 rpm/15 min. Supernatant was subjected to two cycles of differential centrifugation: 30000 rpm/1½ h and 3000 rpm/15 min at 4°C. Final pellets were resuspended using 2 mL of 0.005 M borate buffer containing 0.005 M EDTA (pH 9.0) for each purification source and kept at -20°C till used. Purified preparations were evaluated spectrophotometrically (using a Shimadzu UV 1201 spectrophotometer). Virus yields were estimated as described by Noordam (1973) using extinction coefficient of 5.0. Preparations were negatively stained with 2% phosphotungastic acid (PTA) according to Griffin (1990) and examined with JEOL JEM 100 CX 11 transmission electron microscope, at Electron Microscope Unite, Assiut Univ., Assiut, Egypt.

Antisera Production and Evaluation
Polyclonal antiserum produced in a New Zealand white rabbit by injecting purified virus preparation from each purification source depending on the method described by Madhubala et al. (2005) (1 mg of virus with Freund’s incomplete adjuvant, 1:1) intramuscularly six times at 10 days interval. The animal was bled 15 days after the last injection and the antiserum was collected.

Immunoglobulins G (IgGs) purification was carried out as mentioned by Clark and Adams (1977). Final dialyzed proteins were loaded on 10 mL of diethylaminoethyl (DEAE) cellulose column (Whatman Inc., USA), eluted using half strength Phosphate Buffer Saline (PBS) and collected in microtube. Absorption of fractions was measured at 280 nm and concentration of IgGs was adjusted to 1 mg mL-1 (OD280 = 1.46) using half strength PBS, then stored at 4°C. IgGs dilution end points were determined using I-ELISA against clarified infected tobacco sap and healthy tobacco sap was used as a control.

Confirmation of Antisera Specificity and Evaluating Detection of CMV Using IC-RT-PCR
The IC-RT-PCR was performed depending on infected tobacco leaf and callus tissues collected 20 days post virus inoculation. Immunocapturing and cDNA synthesis was carried out as described by Minafera and Hadidi (1994). The following primers (purchased from Invitrogen Corp., USA) were used for the isolation and amplification of CMV cp which were designed depending on CMV (Supgroup I) genes sequences data collected from PubMed (GeneBank) web site (http://www.ncbi.nlm.nih.gov): 5'ATGGACAAATCTGAATCAAC3' (Sense) and 5'TCAAACTGGGAGCACCCCAG3' (Antisense).

PCR was carried out according to Ghosh et al. (2002). Five microliter from resulting cDNA were transferred to tube containing 45 μL PCR reaction mixture contained primers (1 μM final concentration each), Taq DNA polymerase (1 unit), 200 μM of each dNTPs, 5 μL 10x PCR buffer (500 μM KCl, 15 mM MgCl2, 100 mM Tris-HCl, pH 8.0), completed to 45 μL with Sterile deionized water and the reaction was overlaid with 50 μL sterilized mineral oil. PCR program was 94°C initial melting for 3 min followed by 35 cycles of 94°C/1 min, 55°C/1 min, 72°C/2 min and 72°C/10 min final extension (using PerkinElmer cetus thermal cycler, PerkinElmer Inc., USA).

For PCR product analysis, 1.5% agarose gel was used and electrophoresis was carried out in Sub-Cell DNA apparatus (Bio-Rad Lab., USA) at 80V. The gel was photographed under UV-transilluminator using a gel documentation system, band size was determined from the gel photograph using Gel-Pro Analyzer software (Media Cybernetics, USA).

RESULTS

Virus Isolation
CMV of subgroup I was isolated from naturally infected cucumber plants showing mosaic, mottling and malformation (Fig. 1A). Samples gave positive I-ELISA results ranging from 0.946 to 1.079 were mechanically inoculated on Ch. Amaranticolor leaves and gave chlorotic local lesions (Fig. 1B). Lesions were extracted and inoculated on N. tabacum cv. White Burley for propagation.

Virus Purification and Evaluation
UV absorption data show that A260/A280 ratio for virus purified from leaves and calli were 1.10 and 1.25, respectively. Yields were 1.74 and 2.4 mg virus/200 g infected leaves and calli, respectively.

Electron micrographs show spherical virus particles of about 30 nm in diameter (Fig. 2A and B).

Antisera Production and Evaluation
The highest titers were 1:128 and 1:512 for antisera produced using virus purified from leaves and calli, respectively (Table 1). It was observed that purified antiserum prepared from healthy leaves gave slightly higher I-ELISA readings with tobacco healthy sap compared with that of virus purified from calli.

Confirmation of Antisera Specificity and Evaluating Detection of CMV Using IC-RT-PCR
By analysis the PCR products on agarose gel, bands with the expected size of 657 bp were observed representing CMV cp (Fig. 3). Results indicated that bands produced from callus infected tissues were slightly higher in intensity compared with those of tobacco infected leaves.


Fig. 1: CMV infected Cucumber leaf showing mosaic, mottling and malformation (A), chlorotic local lesions produced on Ch. Amaranticolor leaf 15 days post inoculation with CMV infected cucumber sap (B)

Fig. 2: Electron micrographs of negatively stained purified virus preparations obtained from infected tobacco leaves (A) and calli (B)

Table 1: CMV IgGs evaluation against infected and healthy tobacco sap
*Each ELISA result (R) was the average of three readings.**Reaction of crude purified virus from leaves (1) and calli (2) with crude antiserum. Reaction of infected (I) and healthy (H) tobacco leaves sap with anti-sera produced by rabbit immunization with CMV purified from leaves (IgGs1) and from calli (IgGs2) + Positive reaction, - Negative reaction

Fig. 3: IC-RT-PCR for amplification of CMV cp from tobacco infected leaves (lanes 1 and 2) or callus (Lanes 4 and 5) tissues. Healthy leaves (Lane 3) and callus (Lane 6) as a controls. M: Lambda DNA/EcoRI+HindIII marker (Promega, USA)

DISCUSSION

CMV has a relatively wide host range, giving systemic symptoms on cucumber plants and can be isolated from single local lesions produced on mechanically inoculated Chenopodium leaves (Palukaitis et al., 1992; Madhubala et al., 2005). Also ELISA and electron microscopy can be used as a helpful tool to confirm isolation success after biological studies (Honda and Matsui, 1973; Raj et al., 2002; Madhubala et al., 2005).

Tissue culture has one valuable advantage as it can be used for propagation and preservation of plant viruses, avoiding isolates contamination under greenhouse conditions (El-Afifi et al., 2003 b).

The virus under study was purified from tobacco leaves and calli, results showed that purified preparation obtained from calli was relatively higher in both purity and yield. It was found that CMV can be purified from tobacco callus tissues without passing with the clarification step representing another advantage of tissue culture in virus studies. Also less plant components were observed in electron micrographs of calli purified CMV preparations compared with that purified from leaves. Such results were in harmony with those of PVY and ToMV found by El-Afifi et al. (2003 a,b).

Callus is a less complicated plant tissue compared with leaves, containing less plant inhibitors and components (Kassanis, 1967). Ikeda et al. (1987) found that roots, leaves and stems of Mirabilis jalapa showed high inhibitory activity against plant viruses compared with cultured cells. Duran-Vila et al. (1989) proved that infected citrus callus is a good host system for virus replication and purification.

Data of antisera production showed that antiserum produced from calli purified viral preparation was highly specific since it gave much weaker reaction with healthy tobacco sap. Antiserum of callus viral preparation has higher titer (1:512) compared with antiserum of leaves viral preparation which has a titer of 1:128. Similar trend was also found by Lyal and Gorbunova (1992) as they succeeded in producing highly specific antiserum for soybean mosaic virus using clarified sap of infected soybean tissue culture. El-Afifi et al. (2003b) produced antisera of higher titer and specificity for PVY and ToMV which were purified from infected tobacco callus tissues.

CMV infected tobacco callus culture can gave a clean medium for viral molecular studies, genes isolation and amplification. The cp gene of CMV was successfully amplified from infected tobacco callus tissues by IC-RT-PCR. Agarose gel electrophoresis result revealed the expected band size of 657 bp representing CMV cp gene. Some investigators detected virus genes in plant tissue culture by means of molecular protocols (Eggenberger et al., 1989; Covey and Turner, 1993; Pelah et al., 1994).

REFERENCES
Brunt, A.A., K. Crabtree, M.J. Dallwitz, A.J. Gibbs and L. Watson, 1996. Viruses of Plants. Descriptions and Lists from the VIDE Database. 2nd Edn., CAB International, Wallingford, UK., ISBN: 0-85198-794-X, Pages: 1484.

Clark, M.F. and A.N. Adams, 1977. Characteristics of the microplate method of enzyme-linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol., 34: 475-483.
CrossRef  |  PubMed  |  Direct Link  |  

Cooke, R.C., 1977. Tissue culture propagation of African violets. Hortic. Sci., 12: 549-549.

Covey, S.N. and D.S. Turner, 1993. Changes in populations of cauliflower mosaic virus DNA and RNA forms during turnip callus proliferation. J. Gen. Virol., 74: 1887-1887.

Dhingra, M.K., S.M.P. Khurana, T.N. Lakhanpal, R. Chandra and N.E. Foldo, 1987. Maintenance and elimination of potato virus X in leaf calli of Indian potatoes. Proceedings of the Conference of the European Association of Potato Research, Aalborg, July 26-31, 1987, Denmark, pp: 46-47.

Duran-Villa, N., M. Cambra, V. Medina, C. Ortega and L. Navarro, 1989. Growth and morphogenesis of citrus tissue culture infected with citrus tristeza virus and citrus infections variegation virus. Phytopathology, 79: 820-826.

Eggenbrger, A.L., D.M. Stark and R.N. Beachy, 1989. The nucleotide sequence of a soybean mosaic virus coat Protein-coding region and its expression in Escherichia coli, Agrobacterium tumefaciens and tobacco callus J. Gen. Virol., 70: 1853-1860.
CrossRef  |  Direct Link  |  

El-Afifi, S.I., 1997. Detection of some viruses affecting banana, potato and soybean plants in tissue culture by ELISA. Proceeding of the 1st Conference of Agriculture Science, Dec. 13-14, Faculty of Agriculture, Assiut University.

El-Afifi, S.I., A.M.E. El-Ahdal, M.H. Abdel-Ghaffar and A.M. El-Borollosy, 2003. Evaluation studies on multiplication of tobacco mosaic virus and potato virus Y in callus culture. I Biological and microscopic detection. Ann. Agric. Sci., 40: 1525-1544.

El-Afifi, S.I., A.M.E. El-Ahdal, M.H. Abdel-Ghaffar and A.M. El-Borollosy, 2003. Evaluation studies on multiplication of tobacco mosaic virus and potato virus Y in callus culture. II Purification and antisera production. Ann. Agric. Sci., 41: 1535-1549.

Ghosh, S.B., L.H.S. Nagi, T.R. Ganapathi, S.M. Paul Khurana and V.A. Bapat, 2002. Cloning and sequencing of potato virus Y coat protein gene from Indian isolate and development of transgenic tobacco for PVY resistance. Curr. Sci., 82: 7-10.

Griffin, R.L., 1990. Using the Transmission Electron Microscope in the Biological Sciences. Ellis Horwood, New York, pp: 99-101.

Honda, Y. and C. Matsui, 1973. Electron microscopy of cucumber mosaic virus-infected tobacco leaves showing mosaic symptoms. Phytopathology, 64: 534-539.

Hord, M.J., A. García, H. Villalobos, C. Rivera, G. Macaya and M.J. Roossinck, 2001. Field Survey of Cucumber mosaic virus Subgroups I and II in crop plants in costa rica. Plant Dis., 85: 952-954.
Direct Link  |  

Ikeda, T., Y. Takanami, S. Imaizumi, T. Matsumoto, Y. Mikami and S. Kubo, 1987. Formation of anti-plant viral protein by Mirabilis jalapa L. cells in suspention culture. Plant Cell Rep., 6: 216-218.

Kassanis, B., 1967. Plant Tissue Culture. In: Methods in Virology, Maramorosch, K. and H. Koprowski, (Eds.), Acad. Press, New York and London, pp: 537-566.

Koenig, R.C., 1981. Indirect ELISA methods for broad specificity detection of plant viruses. J. Gen. Virol., 55: 55-62.

Lot, H., J. Marrou, J.B. Quiot and C.H. Esvan, 1972. Contribution à l'etude du virus de la mosaïque du concombre (CMV). II. Methode rapide de purification du virus. Annales de Phytopathologie, 4: 25-38.

Lyal, R.V. and N.I. Gorbunova, 1992. Immunodiagnosis of soybean mosaic virus. Sel Skokozyaistvennaya Biol., 1: 165-168.

Madhubala, R., V. Bhadramurthy, A.I. Bhat, P.S. Hareesh, S.T. Retheesh and R.S. Bhai, 2005. Occurrence of Cucumber mosaic virus on vanilla (Vanilla planifolia Andrews). India. J. Biosci., 30: 339-350.
PubMed  |  Direct Link  |  

McMorran, J.P. and T.C. Allen, 1983. Maintenance, symptoms and distribution of potato viruses X, S, Y, A, M and leaf roll in potato tissue culture plantlets. Am. Potato J., 60: 839-847.

Minafera, A. and A. Hadidi, 1994. Sensitive detection of grapevine virus A, B or leafroll associated III from viruleferous mealybugs and infected tissues by cDNA amplification. J. Virol. Methods, 47: 175-188.

Murashige, T. and F. Skoog, 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant., 15: 473-497.
CrossRef  |  Direct Link  |  

Noordam, D.D., 1973. Identification of Plant Viruses: Methods and Experiments. Center for Agricultural Publishing and Documentation, Netherlands, ISBN-13: 9789022004647, Pages: 207.

Palukaitis, P., M.J. Roossinck, R.G. Dietzgen and R.I.B. Francki, 1992. Cucumber mosaic virus. Adv. Virus Res., 41: 281-348.

Pelah, D., A. Altman and H. Czosnek, 1994. Tomato yellow leaf curl virus DNA in callus cultures derived from infected tomato leaves. Plant Cell Org. Cult., 39: 37-42.

Raj, S.K., A. Srivastava, G. Chandra and B.P. Singh, 2002. Characterization of cucumber mosaic virus isolate infecting Gladiolus cultivars and comparative evaluation of serological and molecular methods for sensitive diagnosis. Curr. Sci., 83: 9-10.

Roossinck, M.J., 1999. Cucumoviruses (Bromoviridae)-General Features. In: Encyclopedia of Virology, Granoof, L. and R.G. Webster (Eds.). Academic Press, SanDiego, USA., pp: 315-320.

Singh, Z., R.A.C. Jones and M.G.K. Jones, 1995. Identification of cucumber mosaic virus subgroup I isolates from banana plants affected by infectious chlorosis disease using RT-PCR. Plant Dis., 79: 713-716.
Direct Link  |  

Xu, L.P., R.K. Chen and Y.P. Li, 1994. Elimination of sugarcane mosaic virus by callus tissue culture and apical culture. J. Fujian Agric. Univ., 23: 253-256.

©  2014 Science Alert. All Rights Reserved
Fulltext PDF References Abstract